Scholarly article on topic 'Association between polymorphism in the Prolactin I promoter and growth of tilapia in saline-water'

Association between polymorphism in the Prolactin I promoter and growth of tilapia in saline-water Academic research paper on "Biological sciences"

CC BY-NC-ND
0
0
Share paper
Academic journal
Aquaculture Reports
OECD Field of science
Keywords
{Microsatellite / " Oreochromis " / " PRL " / QTL / "Repetitive elements" / "Salinity tolerance"}

Abstract of research paper on Biological sciences, author of scientific article — Ariel Velan, Gideon Hulata, Micha Ron, Tatiana Slosman, Andrey Shirak, et al.

Abstract Tilapias are a group of species with a variable tolerance to high salinity, which are cultured worldwide in fresh, brackish and seawater. Prolactin I (PRL I) is known as a key hormone in osmoregulatory physiological pathways. A previous study, conducted in a single family, reported on association between polymorphism in a repetitive element within the promoter of the PRL I gene and growth rate of tilapia in saline water. This study was aiming to further validate this association in a larger sample size, and was conducted in nine families over two consecutive breeding seasons. We have confirmed this association in the three F2 families of Oreochromis mossambicus × Oreochromis niloticus hybrids challenged in the first year. The same pattern of improved growth for genotypes with shorter alleles originating from the O. niloticus grand-parental fish, although O. mossambicus is considered to be a more salt tolerant species, was demonstrated. The effects accounted for 13–15% of the phenotypic variance for growth rate (P <0.05). In the six families from the second spawning season there was no association between the gene polymorphism and the fish growth in saline water. No association was evident between the polymorphism in the PRL I promoter and the expression of the gene.

Academic research paper on topic "Association between polymorphism in the Prolactin I promoter and growth of tilapia in saline-water"

Contents lists available at ScienceDirect

Aquaculture Reports

journal homepage: www.elsevier.com/locate/aqrep

Aquaculture

Association between polymorphism in the Prolactin I promoter and growth of tilapia in saline-water

Ariel Velan, Gideon Hulata, Micha Ron, Tatiana Slosman, Andrey Shirak, Avner Cnaani *

Institute of Animal Science, Agricultural Research Organization, BetDagan 50250, Israel

ARTICLE INFO ABSTRACT

Tilapias are a group of species with a variable tolerance to high salinity, which are cultured worldwide in fresh, brackish and seawater. Prolactin I (PRLI) is known as a key hormone in osmoregulatory physiological pathways. A previous study, conducted in a single family, reported on association between polymorphism in a repetitive element within the promoter of the PRLI gene and growth rate of tilapia in saline water. This study was aiming to further validate this association in a larger sample size, and was conducted in nine families over two consecutive breeding seasons. We have confirmed this association in the three F2 families of Oreochromis mossambicus x Oreochromis niloticus hybrids challenged in the first year. The same pattern of improved growth for genotypes with shorter alleles originating from the O. niloticus grandparental fish, although O. mossambicus is considered to be a more salt tolerant species, was demonstrated. The effects accounted for 13-15% of the phenotypic variance for growth rate (P <0.05). In the six families from the second spawning season there was no association between the gene polymorphism and the fish growth in saline water. No association was evident between the polymorphism in the PRL I promoter and the expression of the gene.

© 2015 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND

license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

CrossMark

Article history:

Received 24 October 2014

Received in revised form 22 February 2015

Accepted 1 March 2015

Available online 20 March 2015

Keywords:

Microsatellite

Oreochromis

Repetitive elements Salinity tolerance

1. Introduction

Tilapias are a group of species with great economic importance; second only to carps in fishes' global production. Although primarily native in freshwater, they are euryhaline species that can tolerate wide range of salinities. Throughout the world tilapias are cultured in various types of waters, including brackish underground water, estuaries and open sea cages. Species of tilapia differ in their salinity tolerance, as is expressed in various production traits, such as growth, reproduction and survival. Among the economically important species, Oreochromis mossambicus (Mozambique tilapia) and its hybrids are commonly cultured in saline water due to their high salinity tolerance, while Oreochromis niloticus (Nile tilapia) dominates in fresh water culture due to its superior performance in this environment (Suresh and Lin, 1992; Cnaani and Hulata, 2011).

Pituitary hormones regulate fish's osmoregulatory processes. The importance of prolactin (PRL) in fish osmoregulation is known for more than 50 years and it is generally accepted as the freshwater-adapting hormone in most euryhaline teleosts, having a major role in regulating water and ion permeability of the gills,

* Corresponding author. Tel.: +972 3 9683566; fax: +972 3 9605667. E-mail address: avnerc@agri.gov.il (A. Cnaani).

gut and kidney. The role of growth hormone (GH) as the saltwater-adapting hormone is not universal among species, less studied, with inconsistent expression patterns in previous studies on tilapia osmoregulation (Breves et al., 2010; Velan et al., 2011). However, it have been demonstrated that PRL and GH can antagonize each other's osmoregulatory actions (Mancera and McCormick, 2007). Tilapias produce two PRLs, classified as long (188 aa; PRL I) and short (177 aa; PRL II), with the PRL I being more similar to the PRLs of other fish (Manzon, 2002). Differences between O. mossambi-cus and O. niloticus in PRL I expression in response to changes in water salinities were previously found in several studies (Breves et al., 2010; Velan et al., 2011). The tilapia PRL I promoter contains two microsatellites (CA/GT)n scattered among binding sites for the transcription factor Pit-1 (Swennen et al., 1992). The PRL I gene is located on position 19 (cM) in linkage group 4 (LG4) of the tilapia genetic linkage map (Lee et al., 2005). Streelman and Kocher (2002) have previously demonstrated that a polymorphism of 17 di-nucleotides between the microsatellite alleles in the tilapia PRL I promoter is associated with growth in salt water and with differential expression of the PRL I gene, however, their study was based on a single family of F2 hybrids. The present study was designed to re-examine their results, using a larger sample size of several families with more offspring, in order to evaluate the potential usage of this polymorphism for aquaculture purposes.

http://dx.doi.org/10.1016/j.aqrep.2015.03.001

2352-5134/© 2015 The Authors. Published by Elsevier B.V. This is an open access article underthe CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

2. Materials and methods

2.1. Fish breeding, salinity challenge and sampling

The tilapia parental stocks are maintained at the aquaculture facilities of the Agricultural Research Organization in the Volcani Center, Bet-Dagan, Israel. The Mozambique tilapia stock originated from Natal, South Africa and was brought to Israel in the 1970s. The Nile tilapia stock originated from Lake Manzala, Egypt and was brought to Israel, through Swansea University, UK, in the 1990s. The fish used for this study were nine F2 hybrid families, obtained by mating F1 hybrid individuals, progeny of a single-pair cross between an O. mossambicus female and an O. niloticus male. Both grandparental fish were heterozygous for different alleles of the microsatellite in the PRLI promoter (CA33 and CA38 in O. mossambicus, CA30 and CA35 in O. niloticus, resulting in PCR products of 253, 263, 247 and 257 bp, respectively). Given that the parental F1 x F1 cross was 253/263 x 247/257, three or four alleles were segregating in each of the F2 hybrid families.

Breeding groups were set up with one male and 3-5 females in 300-l aquaria. Three days after spawning, eggs were removed from the buccal cavities of females and transferred into glass Zug jars to complete incubation. After completing yolk sack absorption, approximately 14 days post fertilization, fry were moved to 80-l aquaria for two weeks and subsequently each spawn was divided, with half the fish grown in freshwater and half the fish grown in 15 ppt salinity. Fish were fed twice a day with a commercial tilapia feed (36% protein and 5.8% fat, Zemach Feed Meal, Zemach, Israel). Two months later, all fish were weighed and dorsal fin samples were stored in ethanol for further analysis. Broods were collected over two subsequent spawning seasons, three families (A-C) in the first year and six families (D-I) in the second year. Family C was grown for five month, to reach a size that allowed blood and pituitary sampling. These fish were anesthetized with clove oil, blood was collected from the caudal peduncle using hep-arinized syringes, then the fish were decapitated and the pituitary gland was immediately removed, put in RNA stabilization reagent (RNAlater™, Qiagen, Hilden, Germany) and kept at -20 °C for later analysis of gene expression.

This study was approved by the Committee for Ethics in Using Experimental Animals and has been carried out in compliance with the current laws governing biological research in Israel.

2.2. Genotyping

DNA was extracted by the salting-out procedure (Zilberman et al., 2006). All fish used in this study were individually genotyped for the microsatellite within the PRL 1 promoter. Forward (sense: GTTAACATTTTCCACCTTCACG) and reverse (antisense: CTTGCCTC-CATTTTATAGTTCCTT) primers were designed to flank the CA repeat in the tilapia prolactin promoter, about 200 bp upstream of the prolactin 5' UTR. PCR was performed in a 10 |il volume containing 1 x PCR buffer with 2mM MgCl2, 1 U Taq DNA polymerase (JMR, London, UK), 125 |M each dNTP (Fermentas, Hanover, MD, USA) 5 | M each primer and 50 ng of genomic DNA. The amplification conditions were 92 °C for 40 s, 55 °C for 40 s and 72 °C for 1 min, for 30 cycles. One | l PCR product was added to 1.5 | l formamide-loading buffer and 0.5 | l MapMarker 400 TMR standard ladder (Bio Ventures, Murfreesboro, TN, USA). After denaturation at 92 °C for 2 min, 1 | l of the solution was loaded onto an acrylamide gel (4%) in an AB1-377 DNA sequencer (Applied Biosystems). The DNA fragments were separated by electrophoresis and automatically sized by comparison with the internal standard using Genescan software (version 3.1). Genotypes of individual samples were determined by Genotyper software (version 2.0) and automatically exported to a database. Genotypes are presented by fragment

Table 1

Primers used for quantitative real-time PCR.

Gene Primer Sequence Accession no.

GAPDH GAPDH-F GGCATCGTGGAAGGTCTCAT AY140649

GAPDH-R CATTTTACCAGAGGGCCCGT

PRLI PRL-F CACCCAGGAGCTGGACTCT X92380

PRL-R TTGAAGTGCTTGGTCCTTGTC

GH GH-F CGTCTCCTCTCAGCAGATCA M84774

GH-R TTTTGTTGAGCTGACGTTGC

sizes of their alleles, e.g. the 247/263 genotype indicate a heterozygous fish, carrying a 247 bp allele and a 263 bp allele, while the 247/247 genotype indicate a homozygous fish, carrying two 247 bp alleles.

2.3. RNA extraction, cDNA synthesis, and quantitative real-time PCR

Relative quantification of gene expression was measured in 80 fish from family C, 20 fish from each one of the four genotypes. Total RNA was extracted from individual tissues using TR1 reagent (MRC, Cincinnati, OH) and then reverse transcribed into cDNA using Superscript11 Reverse transcriptase (1nvitrogen, Carls-bard, CA). Specific primer pairs for the PRL I and GH genes (Table 1) were used to measure pituitary gene expression. Serial dilutions of PCR products containing the qPCR amplicon were used as standards. Specificity of qPCR assays was demonstrated by performing melting curve analyses on PCR products from standards and biological cDNA template run with qPCR primers and SYBR green. The PCR efficiency using standards and biological cDNA template was confirmed to be nearly identical. Assays were performed using ABsolute™ Blue QPCR SYBR Green ROX Mix in a 10 |l reaction volume, using primers and probes at 250 nM, on a StepOnePlusTM Real-Time PCR System (Applied Biosystems), using the manufacturer's recommended cycling conditions. Data were normalized to GAPDH mRNA transcripts as previously described (Velan et al., 2011) and values were expressed as a fold-change relative to the genotype with the lowest level of expression following the method of Pfaffl (2001).

2.4. Plasma osmolality

For plasma osmolality analysis blood samples were centrifuged for 15min at 5000 x g to separate plasma from red blood cells. Plasma osmolality was measured using a vapor pressure osmome-ter (Vapro Osmometer 5520, Wescor, Logan, UT).

2.5. Statistical analysis

Tests for association between growth and the different genotypes were conducted separately for each family using one-way analysis of variance (ANOVA), with genotypes of F2 as classes. Post hoc comparisons among genotypes were performed using the Tukey-Kramer HSD test (a = 0.05). Data are expressed as means ± SEM.

3. Results

3.1. Association between polymorphism in the PRL I promoter and differential growth

Significant association between polymorphism in the PRL I promoter and differential growth in saline water was found in all three families tested on the first spawning season (Table 2). In two of the three families, full-sibs were also grown in freshwater where

Table 2

The nine F2 families (A-Ca from 1st year, D-1 from 2nd year) tested for marker-trait association. Data are presented as means ± SEM forthe different genotypes. Non-significant differences (P>0.05) are marked as N.S.

Genotype of the parental F1b

Salinityc

Offspring genotype

Weight (g)

A1 247/263 x 253/257 54 FW 247/253 247/257 253/263 257/263 5.8 ± 0.87 7.4 ± 0.97 6.9 ± 1.07 7.2 ± 0.83 N.S.

A2 247/263 x 253/257 65 SW 247/253 247/257 253/263 257/263 6.2 ± 0.61 4.4 ± 0.49 5.3 ± 0.52 4.4 ± 0.30 R2 = 0.13; P<0.05

B1 247/263 x 247/253 59 FW 247/247 247/253 247/263 253/263 6.3 ± 0.71 6.1 ± 0.71 7.3 ± 0.49 6.3 ± 0.79 N.S.

B2 247/263 x 247/253 55 SW 247/247 247/253 247/263 253/263 6.4 ± 0.81 7.9 ± 1.08 5.5 ± 0.91 4.6 ± 0.74 R2 = 0.13; P<0.05

C 247/263 x 247/253 87 SW 247/247 247/253 247/263 253/263 21.0 ± 1.79 17.1 ± 2.13 14.0 ± 1.77 13.5 ± 1.19 R2 = 0.15; P<0.01

D 257/263 x 253/257 192 SW 253/257 257/257 253/263 257/263 5.5 ± 0.54 4.9 ± 0.52 5.9 ± 0.48 5.3 ± 0.53 N.S.

E 253/257 x 253/257 147 SW 253/253 253/257 257/257 3.0 ± 0.25 2.7 ± 0.14 2.9 ± 0.20 N.S.

F 247/263 x 253/257 84 SW 247/253 247/257 253/263 257/263 4.5 ± 0.66 4.2 ± 0.58 4.5 ± 0.50 3.9 ± 0.33 N.S.

G 257/263 x 247/253 67 SW 247/257 253/257 247/263 253/263 10.6 ± 1.05 12.0 ± 1.92 10.9 ± 1.50 8.2 ± 1.47 N.S.

H 247/263 x 247/263 90 SW 247/247 247/263 263/263 3.5 ± 0.57 3.7 ± 0.27 3.5 ± 0.29 N.S.

1 247/263 x 247/263 55 SW 247/247 247/263 263/263 14.5 ± 2.00 11.3 ± 1.21 15.4 ± 1.50 N.S.

a Families A and B were classified into two subgroup for freshwater (A1, B1) and saline water (A2, B2) challenges. b Presented as maternal genotype x paternal genotype. c FW (fresh water) - 0.1 ppt; SW (saline water) - 15 ppt.

no correlation between the genetic polymorphism and growth was found. In these two families, fish carrying the 247/253 genotype for PRL I had improved growth in saline water (P< 0.05) and the polymorphism in this locus explained 13% of the within family variation (Fig. 1). In the third family, fish carrying the allelic combination 247/247 for PRLI had improved growth in saline water (P< 0.01) and the polymorphism in this locus explained 15% of the within family variation (Fig. 2). In all three families there was a similar pattern of improved growth for genotypes with shorter alleles originating from the O. niloticus grand-parental fish, although O. mossambicus is considered to be a more salt tolerant species. No associations were found in the six families tested on the following spawning season. The sample sizes of these families were in the same range

as in the three families which exhibited significant associations (Table 2).

3.2. Gene expression and plasma osmolality

1n family C, in which association was found between polymorphism in the PRL I promoter and differential growth in saline water, fish carrying the 247/247 genotype had the highest growth and the lowest levels of plasma osmolality and PRL I expression (Figs. 2 and 3). However, the associations between plasma osmo-lality, or the relative expression of the PRL I and GH genes in the pituitary (Fig. 3), with either body weight or genotype, were not statistically significant.

Fig. 1. Weight of the four genotypes in progeny of families A (above) and B (below), grown in salt water (dark bars) and fresh water (light bars). Groups sharing the same letter are not significantly different (a = 0.05).

Fig. 2. Weight (dark squares) and plasma osmolality (gray bars) of fourgenotypes in progeny of family C. Data are presented as means ± SEM for the different genotypes. Groups sharing the same letterare not significantly different (a = 0.05).

Fig. 3. Relative mRNA expression of PRL I (dark bars) and GH (light bars). Data are presented as means ± SEM for the different genotypes.

4. Discussion

The association found in the three families from the first spawning season between genotypes and growth in saline water conforms to the findings of Streelman and Kocher (2002). However, contrary to their results, no differential expression of the PRL I gene was demonstrated in the pituitary among different genotypes. As GH is a salt-water adapting hormone, which can antagonize PRL, we have also measured its expression in the same family. However, there was also no differential expression of the GH gene in the pituitary.

The 13-15% within-family phenotypic variances explained by this polymorphism is similar in its magnitude to other QTL found in fish. Previous studies that were searching for QTL for growth rate found explained variance in the range of 11-25% in rainbow trout (O'Malley et al., 2003) and 7-19% in tilapia (Cnaani et al., 2004). The lack of marker-trait association in the six families from the second spawning season is raising a question whether this is indeed a polymorphism within a causative gene, or a QTL linked to PRL I. The phenomenon of few families showing marker-trait associations with moderate effects together with no differences in gene expression favors the QTL hypothesis. However, the correspondence between spawning season and marker-trait associations favors a non-genetic effect on the causative gene. While in both years fish were grown in the same culture systems, with food, salt and water from the same sources, there were some other parameters that were not controlled, such as total biomass in the systems, changes in ambient temperatures, and fluctuations in the quality of the supplied freshwater.

O. mossambicus is considered to be a more salt tolerant species than O. niloticus, with improved growth performance in saline water (Cnaani and Hulata, 2011). However, in the present study the allele associated with improved growth in saline water originated from the O. niloticus grand-parental fish. This result coincides with that of Streelman and Kocher (2002). The phenomenon that the favorable QTL allele for growth originates from the non-favorable parental line for growth was previously found in tilapia's cold tolerance and stress response studies (Cnaani et al., 2003, 2004) as well as in QTL studies of other fish species, such as trout and carp (Palti et al., 2001; Kongchuma et al., 2011), and even in pigs (Gao et al., 2010).

Streelman and Kocher (2002) hypothesized that the length differences of the tandem repeat directly influence gene regulation. Although this hypothesis was not investigated here, there is a similar trend in our results, of improved growth of fish carrying the shorter tandem repeats. Moreover, the allele size differences in Streelman and Kocher's study were much larger than in the lines used in this study (17 di-nucleotides repeats compared to 8 di-nucleotides). Thus, following their hypothesis, the effect of repeat length in the promoter of PRL I on the gene expression may be quantitative, explaining the milder differences in growth and gene expression found in this study. Another possible factor can be the actual length of the CA repeats. While in the population of our study the repeats where in the range of 30-38 di-nucleotides, in family analyzed by Streelman and Kocher the range was 14-31 di-nucleotides. The factor of repeat length was studied by Agnese et al. (2008) in the black-chinned tilapia (Sarotherodon melanotheron), which demonstrated that the microsatellite in the PRL I promoter is under selection in natural populations across Africa. Similarly, it was demonstrated in gilthead sea bream (Sparus aurata) that in habitats of different salinities there is a selection for microsatellite length in the promoter region of the PRL and GH genes (Chaoui et al., 2012).

In summary, we provide further evidence that genetic polymorphism in the PRL I gene is associated with growth in saline water. The results of significant associations in only few of the families could indicate a segregating QTL linked to PRL I rather than a direct

effect of this gene, non-genetic effect on the causative gene, or a quantitative effect of the microsatellite length. Further study, with repeated spawns from other families, and additional genetic markers adjacent to PRL I, is needed to assess the QTL location and the effecting factors.

Acknowledgments

A.V. contribution to this research was part of his M.Sc. dissertation at the Hebrew University of Jerusalem. This study was supported by a grant from the Chief Scientist of the Ministry of Agriculture and Rural Development (Grant no. 356-0486-07). This is contribution No. 705/15 from the Agricultural Research Organization.

References

Agnese, J.-F., Adepo-Gourene, B., Nyingi, D., 2008. Functional microsatellite and possible selective sweep in natural populations of the black-chinned tilapia Sarotherodon melanotheron (Teleostei, Cichlidae). Mar. Genomics 1,103-107. Breves, J.P., Hasegawa, S., Yoshioka, M., Fox, B.K., Davis, L.K., Lerner, D.T., Takei, Y., Hirano, T., Grau, E.G., 2010. Acute salinity challenges in Mozambique and Nile tilapia: differential responses of plasma prolactin, growth hormone and branchial expression of ion transporters. Gen. Comp. Endocrinol. 167,135-142. Chaoui, L., Gagnaire, A.-P., Guindand, B., Quignard, J.-P., Tsigenopoulos, C., Kara, M.H., Bonhomme, F., 2012. Microsatellite length variation in candidate genes correlates with habitat in the gilthead sea bream Sparus aurata. Mol. Ecol. 21, 5497-5511.

Cnaani, A., Hulata, G., 2011. Improving salinity tolerance intilapias: past experience

and future prospects. Isr. J. Aquacul. Bamidgeh 63,533. Cnaani, A., Hallerman, E.M., Ron, M., Weller, J.I., Indelman, M., Kashi, Y., Gall, G.A.E., Hulata, G., 2003. Detection of a chromosomal region with two quantitative trait loci, affecting cold tolerance and fish size, in an F2 tilapia hybrid. Aquaculture 223,117-128.

Cnaani, A., Zilberman, N., Tinman, S., Hulata, G., Ron, M., 2004. Genome-scan analysis for quantitative trait loci in an F2 tilapia hybrid. Mol. Genet. Genomics 272, 162-172.

Gao, Y., Flori, L., Lecardonnel, J., Esquerre, D., Hu, Z.L., Teillaud, A., Lemonnier, G., Lefevre, F., Oswald, I.P., Rogel-Gaillard, C., 2010. Transcriptome analysis of porcine PBMCs after in vitro stimulation by LPS or PMA/ionomycin using an expression array targeting the pig immune response. BMC Genomics 11, 292.

Kongchuma, P., Sandel, E., Lutzky, S., Hallerman, E.M., Hulata, G., David, L., Palti, Y., 2011. Association between IL-10a single nucleotide polymorphisms and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio). Aquaculture 315, 417-421.

Lee, B.-Y., Lee, W.-J., Streelman, J.T., Carleton, K.L., Howe, A., Hulata, G., Slettan, A., Terai, Y., Kocher, T.D., 2005. A second generation genetic linkage map of tilapia (Oreochromis spp.). Genetics 170, 237-244.

Mancera, J.M., McCormick, S.D., 2007. Role of prolactin, growth hormone, insulinlike growth factor I and cortisol in teleost osmoregulation. In: Baldisserotto, B., Mancera, J.M., Kapoor, B.G. (Eds.), Fish Osmoregulation. Science Publishers, Enfield, NH, pp. 497-515.

Manzon, L.A., 2002. The role of prolactin in fishosmoregulation: a review. Gen. Comp. Endocrinol. 125, 291-310.

O'Malley, K.G., Sakamoto, T., Danzmann, R.G., Ferguson, M.M., 2003. Quantitative trait loci for spawning date and body weight in rainbow trout: testing for conserved effects across ancestrally duplicated chromosomes. J. Hered. 94, 273-284.

Palti, Y., Nichols, K.M., Waller, K.I., Parsons, J.E., Thorgaard, G.H., 2001. Association between DNA polymorphisms tightly linked to MHC class II genes and IHN virus resistance inbackcrosses of rainbow and cutthroat trout. Aquaculture 194, 283-289.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 45.

Streelman, J.T., Kocher, T.D., 2002. Microsatellite variation associated with prolactin expression and growth of salt-challenged tilapia. Physiol. Genomics 9,1-4.

Suresh, A.V., Lin, C.K., 1992. Tilapia culture in saline waters - a review. Aquaculture 106, 201-226.

Swennen, D., Poncelet, A.C., Sekkali, B., Rentierdelrue, F., Belayew, A., 1992. Structure ofthe tilapia (Oreochromis mossambicus) prolactin-1 gene. DNA Cell Biol. 11, 673-684.

Velan, A., Hulata, G., Ron, M., Cnaani, A., 2011. Comparative time-course study on pituitary and branchial response to salinity challenge in Mozambique tilapia (Oreochromis mossambicus) and Nile tilapia (O. niloticus). Fish Physiol. Biochem. 37, 863-873.

Zilberman, N., Reikhav, S., Hulata, G., Ron, M., 2006. High-throughput genomic DNA extraction protocol from tilapia's fin tissue. Aquaculture 255, 597-599.