Scholarly article on topic 'Identification of putative new Escherichia coli flagellar antigens from human origin using serology, PCR-RFLP and DNA sequencing methods'

Identification of putative new Escherichia coli flagellar antigens from human origin using serology, PCR-RFLP and DNA sequencing methods Academic research paper on "Animal and dairy science"

CC BY-NC-ND
0
0
Share paper
OECD Field of science
Keywords
Escherichia coli / antigens / bacterial / polymerase chain reaction / polymorphism / restriction fragment length

Abstract of research paper on Animal and dairy science, author of scientific article — Monique Ribeiro Tiba, Claúdia de Moura, Marcelo Falsarella Carazzolle, Domingos da Silva Leite

Abstract Escherichia coli has been isolated frequently, showing flagellar antigens that are not recognized by any of the 53 antisera, provided by the most important reference center of E. coli, The International Escherichia and Klebsiella Center (WHO) of the Statens Serum Institute, Copenhagen, Denmark. The objective of this study was to characterize flagellar antigens of E. coli that express non-typeable H antigens. The methods used were serology, PCR-RFLP and DNA sequencing. This characterization was performed by gene amplification of the fliC (flagellin protein) by polymerase chain reaction in all 53 standards E.coli strains for the H antigens and 20 E. coli strains for which the H antigen was untypeable. The amplicons were digested by restriction enzymes, and different restriction enzyme profiles were observed. Anti-sera were produced in rabbits, for the non-typeable strains, and agglutination tests were carried out. In conclusion,the results showed that although non-typeable and typable H antigens strains had similar flagellar antigens, the two types of strains were distinct in terms of nucleotide sequence, and did not phenotypically react with the standard antiserum, as expected. Thirteen strains had been characterized as likely putative new H antigen using PCR-RFLP techniques, DNA sequencing and/or serology.

Academic research paper on topic "Identification of putative new Escherichia coli flagellar antigens from human origin using serology, PCR-RFLP and DNA sequencing methods"

Identification of putative new Escherichia coli flagellar antigens from human origin using serology, PCR-RFLP and DNA sequencing methods

Authors

Monique Ribeiro Tiba1 Claudia de Moura2 Marcelo Falsarella Carazzolle3

Domingos da Silva Leite4

:MSc; Dr.; Post-doctorate, Universidade Estadual de Campinas - UNICAMP, Sao Paulo, Brazil 2MSc; PhD Candidate, UNICAMP, Sao Paulo, Brazil

3MSc, Dr.; Physicist, UNICAMP, Sao Paulo, Brazil

4MSc, Dr.; Professor, UNICAMP, Sao Paulo, Brazil

ABSTRACT

Escherichia coli has been isolated frequently, showing flagellar antigens that are not recognized by any of the 53 antisera, provided by the most important reference center of E. coli, The International Escherichia and Klebsiella Center (WHO) of the Statens Serum Institute, Copenhagen, Denmark. The objective of this study was to characterize flagellar antigens of E. coli that express non-typeable H antigens. The methods used were serology, PCR-RFLP and DNA sequencing. This characterization was performed by gene amplification of the fliC (flagellin protein) by polymerase chain reaction in all 53 standards E.coli strains for the H antigens and 20 E. coli strains for which the H antigen was untypeable. The amplicons were digested by restriction enzymes, and different restriction enzyme profiles were observed. Anti-sera were produced in rabbits, for the non-typeable strains, and agglutination tests were carried out. In conclusion,the results showed that although non-typeable and typable H antigens strains had similar flagellar antigens, the two types of strains were distinct in terms of nucleotide sequence, and did not phenotypically react with the standard antiserum, as expected. Thirteen strains had been characterized as likely putative new H antigen using PCR-RFLP techniques, DNA sequencing and/or serology.

Keywords: Escherichia coli; antigens; bacterial; polymerase chain reaction; polymorphism; restriction fragment length.

[Braz J Infect Dis 2011;15(2):144-150]©Elsevier Editora Ltda.

INTRODUCTION

Submitted on: 08/15/2010 Approved on: 10/21/2010

Correspondence to:

Monique Ribeiro Tiba Rua Visconde de Taunay, 147/41, Vila Itapura, Campinas, SP, Brazil mrtiba@gmail.com

Financial Support:

FAPESP CAPES

We declare no conflict of interest.

Escherichia coli is the predominant facultative member of the normal human intestinal flora. This species also includes different pathovars which are associated with intestinal and extraintestinal diseases in humans and animals. Some E. coli variants have been identified as pathogens that encode an array of pathogenic factors harmful for the respective host.1,2 The O polysaccharide and flagellin are the two major antigens of Gram-negative bacteria, also known respectively as the O and H antigens. Since the early 1940's, agglutination of these two antigens has served as the foundation of E. coli serotyping with 187 "O" and 53 "H" being characterized to date.3

Serology has been used to track strains in epidemiological studies and has allowed the characterization of pathogenic E. coli se-rotypes. Two main groups of such frequent serotypes were defined: serotypes from diar-rhoeal disease and serotypes from extraintes-

tinal disease.4 However, several difficulties have been observed, when the H serotyping of E. coli is applied as routine laboratory standard: (I) the expression of H-antigens can be dependent on various environmental signals and identification of the complete set of serotypes is a time-consuming process and requires the use of 53 specific antisera; and (II) there is a great deal of cross-reactions among E. coli strains.1,2,5

The flagellum (the organelle responsible for motility) consists of repeated subunits of the protein flagellin (fliC). The flagellin proteins are conserved in their terminal domains, whereas, the central domain is variable and carries serotype-specific epitopes.6 Flagellin genes are suitable for PCR amplification, and variability between the PCR products can subsequently be assessed by restriction analysis (PCR-RFLP) or DNA sequencing.1,3,7 Molecular biology techniques offer the potential for rapid and reproducible analysis of bacterial diversity.8 However,

serotyping has been the mainstay in the characterization and diagnostic of E. coli, and this technique remains essential for taxonomic and epidemiological purposes.2,9

The aim of this study was to characterize the H antigens of motile, serologically non-typeable H antigens strains, from various clinical origins (cases of gastroenteritis, bloody diarrhoea, HUS, urinary tract infection). Rabbit antisera were produced against non-typeable strains. A PCR-restriction fragment length polymorphism (PCR-RFLP) test that detects and characterizes fliC was used to build a database of restriction patterns (P-types) and to recognize H-types.1,2 One non-typeable strain that the H antigen was not recognized by PCR-RFLP was selected and the fliC gene was sequenced to compare with those already described in the literature.

MATERIALS AND METHODS

Bacterial strains

The reference strains belonging to various O- and H-antigen groups representing the flagella antigens H1 to H56 were included in this study,10 and they were obtained from the E. coli Reference Laboratory, Santiago de Com-postela, Spain (Tablel). Moreover, a total of 20 serologically non-typeable H antigens strains from various clinical origins were used in this study (Table 2). The clinical E. coli strains were donated by Dr. Helmut Tschape (Robert Koch Institute, National Reference Centre of Salmonella and other enterics, Wernigerode, Germany) and by Dr. Jorge Blanco (E. coli Reference Laboratory, Santiago de Compostela, Spain). All E. coli isolates were stored at room temperature in nutrient broth (NB) 0.75% agar and preserved in glycerol cultures at -80°C.

Sera, serum absorption, and H-antigen serotyping

To determine the O- and H-antigens, we used antisera against reference E. coli H-antigens that were obtained from the E. coli Reference Laboratory, Santiago de Com-postela, Spain. The application of the E. coli reference collection and the reference sera produced according to recommendation of the International Escherichia and Klebsiella Centre (WHO) was used. Reference E. coli and clinical E. coli strains were serotyped at the Universidade Estadual de Campinas.

Hyperimmune rabbit antisera against non-typeable strains were produced by the Bacterial Antigens Laboratory in Universidade Estadual de Campinas. Using the clinical E. coli strains and the standard protocol for

Table 1. E. coli H-antigens reference strains

O6:H1 O9:H12 O86:H25 086:H36 O156:H47

O3:H2 O18:H13 O38:H26 O42:H37 O16:H48

O53:H3 O23:H15 O58:H27 O69:H38 O6:H49

O50:H4 O46:H16 O148:H28 O110:H39 O8:H51

O4:H5 O15:H17 O138:H29 O41:H40 O11:H52

O120:H6 O17:H18 O86:H30 O137:H41 O148:H53

O1:H7 O32:H19 O73:H31 O70:H42 O161:H54

O105:H8 O126:H20 O114:H32 O140:H43 O4:H55

O30:H9 O146:H21 O60:H33 O3:H44 O139:H56

O108:H10 O158:H23 O160:H34 O125:H45

O26:H11 O51:H24 O134:H35 O115:H46

Table 2. E. coli clinical strains carrying serologically non-typeable H-antigens

N° Original code Serogroup N° Original code Serogroup

1C VTH 15 (STEC) O81 2A 01-03443 (STEC) O55

2C VTH 110 (EHEC) O84 3A 00-04915 (EHEC) O76

3C VTH 118 (EHEC) O26 5A 00-04447 (STEC) O91

4C 28011a (EHEC) O84 7A 00-08242 (STEC) O136

5C 33141a (EPEC) ONT 8A 00-03034 (-) O25

6C 46103B (-) ONT 9A 00-07153 (-) O74

7C 40478B (EHEC) ONT 10A 00-00848 (-) O126

8C 48629c(1) (EPEC) O86 11A 00-05951 (STEC) R

9C 48629c(2) (EPEC) ONT 13A 00-08712 (STEC) O15

14A 99-01406 (EPEC) O68

15A 00-09775 (EPEC) O76

ONT, undertermined by typing sera; R, rough strains.

(-), negative to virulence factors: eae (enterocyte attaching and effacing), vt1 (verocytotoxin type 1), vt2 (verocytotoxin type 2), bfp ( bundle forming pilus), eaf (EPEC adherence factor).

deriving rabbit antisera.11 The production and absorption of antisera and tube H-antigen agglutination were carried out as described previously by Ewing (1986).

DNA preparation

A single colony was grown in 3.0 mL of Luria-Bertani medium, overnight at 37°C. Genomic DNA was purified by using the "Wizard Genomic DNA Purification System Kit" (Promega/EUA). The purified DNA was suspended in 100 ^L of water and stored at 4°C.

Primers and PCR amplification

The primers used in this study are listed in Table 3. Each PCR was carried out using a 30 ^L reaction mixture containing 2 mM MgCl2, each deoxynucleoside triphosphate at a concentration of 0.2 mM, each primer at a concentration of 10 pmol and 1.5 U of Taq DNA polymerase (Fermentas). PCR conditions included de-naturation for 60s at 94°C, annealing for 60s at 60°C and extension for 120s at 72°C for 30 cycles, in a Thermal Cycler (Gene Amp PCR System 9700/Perkin Elmer Corporation, Norwal CT/USA). The amplified DNA product was visualized by standard submarine gel elec-trophoresis using 10 mL of the final reaction mixture on a 1.5% agarose gel in TAE buffer (1.6 M Tris-ED-TA, 0.025 M acetic acid). Amplified DNA fragments of specific sizes were located by UV fluorescence, after staining with ethidium bromide. The 1-kpb DNA ladder (Fermentas) was used as a standard for determining molecular size of PCR products.

Restriction patterns

The PCR-RFLP protocol developed by Fields et al.,7and Machado et al.,1 was carried out. The amplified fliC gene was cleaved with HhaI restriction endonuclease (Invit-rogen), when fliC(M) primers were used, and RsaI restriction endonuclease (Invitrogen), when fliC(F) primers were used. Fifteen microliters of each PCR product was digested with restriction endonuclease, according to the manufacture's instructions. Restriction fragments were separated by electrophoresis on a 2% agarose gel

Metaphor (FMC Bioproducts/USA) for 5h at 4.8 V/cm.1 A 100-bp DNA ladder (Fermentas) was used as external and internal fragment size standard. The restriction fragments were stained with ethidium bromide and documented by Image Master VDS (Amersham Pharmacia Biotech/ USA. Gel Compar II (Applied Maths/ Belgium) was used to identify RFLP patterns and to establish a database for fliC fingerprinting. Fragments were considered identical if their sizes did not differ by more than 3.5% (allowed error).

DNA manipulation and sequencing

The fliC gene was first PCR amplified, and the PCR product was inserted into pGEM T-easy kit (Promega/ USA). Analysis of cloned fragments and transformation in DH5a strain were performed using standard methods.12 fliC PCR products were purified with the enzyme ExoSAP-IT, according to the instructions of the manufacturer (GE Health Care/USA). Subsequently, 5.0 (L of purified PCR product were mixed with 4.0 (L ET Terminator™ mix (GE Health Care/USA), 1.0 (L sequencing primers T7 (forward) and M13 (reverse). The thermal program consisted of 30 cycles of 20s at 95°C, 15s at 50°C and 1 min at 60°C. The purification of the sequencing products was obtained by mixing 1 (L of ammonium acetate (7.5M) and 27.5 (L absolute ethanol, followed by incubation in the dark for 30 min, and subsequent centrifugation at 3,700 rpm for 75 min at 4°C. Separation of the DNA fragments was obtained in a Megabace 1,000 system (GE Health Care/USA). Voltage and time of injection were 3kV and 120s. Running was performed at 9kV for 100 min at 44°C.

DNA sequence was assembled and edited by using the programs Phred, Phrap, and Consed. BLAST was used for searching databases, including the GenBank. Sequence alignment and comparison were carried out using ClustalW. After analysis, an internal primer pair was constructed: fliC 1C: AACTAACG-GTACTAACTCTGACA and fliC1Crev: CCACTAC-CGTCTCAGCTTT to obtain a complete fliC sequence, because the entire gene was large and when the DNA sequencer (Megabace 1000 system) was used approximately just 600 pb were obtained.The DNA sequence has been deposited in GenBank under the accession n° GQ423574.

RESULTS

Serotyping

Determination of the O- and H-antigens was performed according to Ewing, 1986, by agglutination with specific hyperimmune rabbit antisera. All H-antigen reference collection and from various clinical origin strains were

Table 3. Sequence of primer's used for PCR amplification

Primers Oligonucleotides 5'- 3'

fliC(F)1 ATGGCACAAGTCATTAATACCCAAC

fliC(F)2 CTAACCCTGCAGCAGAGACA,

fliC(M)1 CAAGTCATTAATAC(A/C)AACAGCC

fliC(M)2 GACAT(A/G)TT(A/G)GA(G/A/C)ACTTC(G/C)GT

serotyped with respect to their H-antigens using the classical agglutination tests.

All clinical strains were titrated with all existing 53 antisera initially in 1:100 dilutions and the results of agglutination tests were negative, meaning that the clinical strains used in this work, had non-typeable H-antigens.

To analyze the flagellar serology of the non-typeable strains, hyperimmune rabbit antisera against the Hantigen were produced. Antibody cross-absorption assays were carried out, and the H-antigen agglutination tests were performed in tubes. Moreover, the results of serotyping (Table 4) showed that these antisera produced against non-typeable strains shared a specific partial H-antigen factor absent in the reference strains. All non-typeable E. coli clinical strains were negative to serotyping using reference antisera (53 H-antisera).

NR, negative reaction; Strains 4C, 6C and 11A were not obtained antisera.

fliC-RFLP analysis of E. coli reference strains

To correlate the H-antigen pattern with fliC polymorphisms, PCR-amplified fliC fragments were subjected to RFLP analysis. This analysis was performed three times or more for each strain studied. Patterns were designated by a letter P, followed by a number (Table 1). All E. coli reference strains tested gave rise to a PCR product (varying in size from 0.8 to 2.7 kbp) with the exception of fliC(F) H17, H25, and H53. The fliC was not amplified either in the H53 antigen when fliC(M) was used, even under different PCR condition, indicating inadequate primer homology.

HhaI-fliC gene restriction fragments were observed in 52 E. coli reference strains. A total of 44 different patterns were observed after HhaI restriction (Table 5) and a total of 40 different patterns were observed after RsaI restriction (Table 5). When RsaI- fliC(F) was used, a common pattern was observed for the fliC from the H1, H28, H31 strains (P1), the H2, H30 and H35 strains (P2), the H7, H19 and H27 strains (P7), the H9 and H14 strains (P8), the H11 and H47 strains (P10). When HhaI-fliC(M) was used, the H3 and H8 strains (P3), the H6, H10, H19 and H27 strains (P6), the H11 and H47 strains (P9), the H23 and H43 strains (P18), the H28 and H42 strains (P22) had a common pattern. The fliC genes for H11, H19, H27, H28 and H47 antigens were indistinguishable with both restriction enzymes.

Detection of non-typeable antigen by PCR-RFLP

Since many pathogenic E. coli strains were motile but, non-typeable by serotyping, the determination of fliC polymorphism might be a quick altenative for H-antigen typing. The flagellin gene was amplified in all strains studied (Table 6). We detected single bands ranging from 1.1 to 2.6 kbp when fliC(M) was used and single bands from 1.3 to 2.7 kbp when fliC(F) was used. When RsaI-flic(F) was used, in eleven non-typeable strains there were no patterns comparable to those from E. coli reference strains. Three strains sharing the P2 pattern, and four strains sharing the P8, P10, P11, and P13 patterns respectively (Table 5). When HhaI-fliC(M) was used there were no patterns comparable to those from reference strains in thirteen non-typeable strains. Two strains shared the P2 pattern, two other strains shared the P10 pattern and three strains sharing the P9, P13 and P41 patterns respectively (Table 6). Two strains had the same pattern (P2) when both techniques were used. This strain was identified as being similar to the H2 antigen. Most of these non-typeable strains revealed unknown RFLP patterns among the H antigens H1 to H56 (Table 6).

Table 4. Results of PCR-RFLP and serotyping of non-typeable E. coli strains

Strains PCR-RFLP fliC(M) PCR-RFLP fliC(F) Titer of non-typeable antisera against standard H antigen strains

1C - - H11 (1:6400)

2C P2 P2 H2 (1:12800)

3C P9 P10 H11 (1:12800)

5C - - NR

7C - - NR

8C P41 - NR

9C - - NR

2A - P8 H9 (1:12800)

3A - - NR

5A - - NR

7A - - NR

8A P10 P11 H12 (1:12800)

9A P10 - NR

10A - P2 H30 (1:12800)

13A P13 P13 H16 (1:12800)

14A - - NR

15A - - NR

Table 5. Polymorphisms of fliC(F) and fliC(M) PCR products and their restriction patterns obtained (molecular pattern)

H antigen reference strain O antigen RFLP (RsaI) in bp Molecular of fliC(F) PCR products pattern RFLP (HhaI) in bp of fliC(M)-PCR products Molecular pattern

H1 O6 630, 330, 310 P1 285, 195, 170, 70 P1

H2 O3 570, 410, 320, 120 P2 1370,180 P2

H3 O53 720, 320, 290, 150 P3 360, 350, 150, 110 P3

H4 050 440, 255, 230 P4 340, 285, 100, 60, 50 P4

H5 04 1290 P5 770, 260, 160, 120 P5

H6 0120 565, 335, 320 P6 750, 150, 110, 70, 50 P6

H7 O1 570, 340, 330 P7 790, 200, 150, 120, 105 P7

H8 0105 710, 330, 295, 150 P3 360, 350, 150, 110 P3

H9 1115, 315, 170 P8 735, 470, 215, 120, 70 P8

H10 0108 540, 320, 310 P9 740, 160, 115, 70, 50 P6

H11 026 560, 300, 160 P10 445, 435, 300, 220 P9

H12 09 730, 410, 280, 160, 130 P11 655, 410, 230, 175, 120 P10

H14 018 1115, 315, 170 P8 340, 245, 220, 110, 105, 60 P11

H15 023 440, 325, 300, 230, 95 P12 390, 360, 320, 215, 130 P12

H16 046 390, 330, 300, 150 P13 1220, 230, 140 P13

H17 015 _a - 355, 305, 110, 70 P14

H18 017 760, 420, 150, 120, 95 P14 660, 250 P15

H19 032 550, 335, 325 P7 750, 150, 110, 70, 50 P6

H20 0126 385, 315, 300, 230, 200 P15 710, 420, 200, 110, 60 P16

H21 0146 1275 P16 720, 210, 110, 70, 55 P17

H23 0158 680, 390, 350, 300, 130 P17 460, 320, 210, 145, 105, 70 P18

H24 051 550, 440, 310, 275, 140 P18 540, 340, 195, 145, 135 P19

H2 5 086 _a - 625, 195, 130, 125 P20

H26 038 860, 570, 150 P19 290, 260, 210, 180, 160, 130,100 P21

H27 058 560, 340, 330 P7 740, 155, 110, 70, 50 P6

H28 0148 620, 335, 320 P1 315, 235, 210, 110, 100, 80, 70 P22

H29 0138 380, 340, 310, 175, 110 P20 740, 280, 125, 80, 70 P23

H30 086 590, 420, 310, 120 P2 410, 280, 240, 150, 115, 100, 85 P24

H31 073 610, 320, 310 P1 380, 320, 285, 240, 215, 115, 65 P25

H32 0114 760, 525, 305 P21 430, 370, 300, 250, 210, 170, 130, 80 P26

H33 060 670, 420 P22 235, 230, 210, 105 P27

H34 0160 640, 535, 415 P23 670, 315, 160, 135 P28

H35 0134 570, 410, 310, 120 P2 1210, 220, 195 P29

H36 086 690, 560, 290, 210, 150, 105 P24 740, 595, 445, 305, 220 P30

H37 042 840, 330, 230, 130 P25 680, 270, 240 P31

H38 069 320, 180, 165, 150, 120 P26 995, 130 P32

H39 0110 310, 280, 270, 210, 110, 90 P27 390, 250, 210, 170, 110, 105 P33

H40 041 315, 290, 250, 145, 85 P28 380, 340, 195, 160 P34

H41 0137 430, 320, 300, 270, 215, 130 P29 570, 440, 160, 130 P35

H42 070 640, 320, 310, 95 P30 320, 235, 210, 115, 70, 60 P22

H43 0140 390, 350, 300, 290, 130 P31 465, 320, 215, 150, 115, 75 P18

H44 03 710, 610, 500, 300, 90 P32 335, 315, 275, 250, 190, 110, 70 P36

H45 0125 430, 380, 315, 215, 140, 130, 110 P33 455, 410, 260, 250, 115 P37

H46 0115 460, 315, 300, 250, 200, 105 P34 400, 310, 215, 180, 110, 80 P38

H47 0156 575, 300, 155 P10 445, 430, 300, 230 P9

H48 016 630, 470, 290, 95 P35 515, 290, 210, 125, 100 P39

H49 06 410, 310, 290, 260, 210, 130, 70 P36 540, 350, 200, 150, 130 P40

H51 08 360, 310, 270, 210, 150, 115 P37 1000, 250, 205, 105 P41

H52 011 695, 375, 180, 90 P38 335, 260, 220, 140 P42

H53 0148 _a - -a -

H54 0161 780, 315, 255, 200, 145, 115 P39 525, 330, 275, 165, 115, 110 P43

H5 5 04 900, 305, 105 P40 440, 235, 165, 130, 80, 60 P44

H56 0139 900, 305, 105 P40 440, 230, 160, 125, 80, 60 P44

a, not amplified by PCR.

Table 6. fliC gene restriction analysis of non-typeable E.coli strains using RsaI and HhaI

E. coli RFLP (RsaI) in bp of Molecular fliC fragment RFLP (HhaI) in bp of Molecular fliC fragment

strains fliC(F)-PCR products pattern size (bp) FliC(M) PCR products pattern size (bp)

1C 595, 520, 375, 320, 285, 230, 140 P41 1,420 895, 295, 220 P45 1,360

2C 560, 410, 320, 125 P2 1,470 1305, 220 P2 1,390

3C 565, 290, 150 P10 1,430 445, 435, 315, 220 P9 1,410

4C 565, 400, 315, 130 P2 1,470 1350, 180 P2 1,395

5C 310, 260, 185, 150, 105 P42 1,445 875, 360, 285, 260, P46 1,350

210, 170, 150, 110

6C 1320 P43 1,300 735, 210, 115 P47 1,180

7C 415, 280, 230, 190, 95 P44 1,790 615, 430, 370, 120 P48 1,625

8C 335, 290, 250, 240, 190, 130, 105 P45 1,740 1005, 260, 210, 100 P41 1,695

9C 570, 440, 420, 235, 180 P46 1,670 1040, 350, 120 P49 1,620

2A 1100, 320, 170, P8 2,050 760, 480, 215, 130 P50 1,955

3A 315, 270, 170, 150, 105 P47 1,495 260, 210, 180, 160, 115, 85 P51 1,460

5A 645, 570, 420 P48 1,660 690, 310, 250, 110 P52 1,590

7A 580, 375, 310, 290, 225, 185 P49 1,720 710, 425, 210 P53 1,660

8A 715, 430, 300, 175, 145 P11 1,785 645, 400, 225, 165, 120 P10 1,710

9A 420, 355, 320, 240, 205, 130 P50 1,775 635, 400, 215, 165, 115 P10 1,550

10A 560, 420, 320, 125 P2 1,725 650, 380, 250, 215, P54 1,665

165, 120, 85, 65, 50

11A 560, 420, 330, 135 P2 1,500 615, 375, 205, 155, 95, 60, 50 P55 1,630

13A 375, 325, 295, 140 P13 1,555 1350, 180 P13 1,460

14A 1005, 550, 310, 280, 140 P51 2,690 720, 435, 380, 290, 220 P56 2,065

15A 555, 520, 370, 250, 135 P52 1,720 625, 350, 205, 105 P57 1,630

Nucleotide sequence analysis

The full gene sequence was obtained for one strain and T7 and M13 primers based on the pGEMT-easy vector were used. An internal pair of primers based on within sequenced E. coli fliC gene was also constructed. The non-typeable strain, showed two expected conserved regions in the N-ter-minal and C-terminal portions, whereas the central region was quite variable. The complete nucleotide sequence of fliC gene has 1,541bp (accession number GQ423574).

DNA alignment was based on the amino acid alignment stored in the database of the National Center for Biotecnol-ogy Information (NCBI). Our sequence for the type strain VTH-15 is 99% identical to those of H21 antigen. Synonymous and nonsynonymous substitution were observed throug the program BLASTx. The deduced amino acid sequences of this fliC gene differ in up to one amino acid from those of the H21 type strain.

DISCUSSION

E. coli of specific serotype can be associated with certain clinical syndromes, even though the serological antigens do not correlate with virulence. It has been shown that antigenic typing of E. coli is extremely useful in epidemiological studies.4 Currently, some isolates are generally not very motile and non-typeable and several difficulties have been observed, when the H serotyping of E. coli was applied as a routine laboratory standard.1,2,5

To confirm putative new H-antigens, hyperimmune rabbit antisera were produced and endpoint agglutination tests with all known H-group reference strains were used to confirm specificity. Six antisera obtained against non-typeable H antigen crossreacted with the reference H-antigen, but the fliC(F) and fliC(M) patterns results were distinct. Although there are several minor relationships among the recognized H-antigens, the absorbed H antiserum is required for their

exact identification. An important relationship exists between E. coli H-antigens H11 and H21.11 We demonstrated that the antiserum obtained from VTH-15 strain had the final antiserum dilution of 1:6,400, while nucleotide sequencing demonstrated similarity of 99% to H21 type strain. Results by tests in absorbed antiserum were negative to H11 and H21 antigens. Defining and establishing new H-antigen types will remain a task of the International Escherichia and Klebsiella Centre (WHO).

Using the fliC PCR-RFLP method several authors showed that non-motile E. coli strains possess fliC- RFLP patterns that did not correspond to known H E. coli anti-gens.7,8 However, non-typeable strains have fliC RFLP patterns that did not correspond to the pattern identified for the H1 to H56 antigens and might therefore represent novel H-antigen types.

In the present study, we have shown that the fliC gene could be amplified in all non-typeable E. coli strains, and a considerable polymorphism of the HhaI and RsaI restrictions products of the amplified fliC gene could be detected (Table 6) and used for a flagellar identification system.

The diversity of amplification products was examined with the use of HhaI and RsaI, which demonstrated to be a feasible and rapid method for identification and subtyping of H-antigens. For each of the fliC products obtained from non-typeable strains, a restriction pattern (P-type) was generated. A total of 12 kinds of P-types were determined, when RsaI (PCR-RFLP RsaI) was used and a total of 13 kinds of P-types were detected with the use of HhaI.

Nucleotide sequencing of the non-typeable E. coli (VTH-15) from human clinical isolates is deposited in GenBank as GQ423574. Flagellin genes are identified on the basis of the homology with known flagellin genes. Complete nucleotide sequencing of fliC gene from non-typeable strain demonstrated similarity of 99% to those previously published for the H21 type strain. Although most of the H-antigens of E. coli have been already described at the molecular level3 a few remained to be analyzed, especially the non-typeable strains.

In conclusion, fliC diversity has been showed by using the PCR-RFLP technique in non-typeable strains. These putative new H groups in E. coli strains isolated from humans will be used in the epidemiological and occurrence studies. However, defining and establishing new H antigens type will remain a task of the International Escherichia and Klebsiella Centre (WHO).

REFERENCES

1. Machado J, Grimont F, Grimont PAD. Identification of Escherichia coli flagellar types by restriction of the amplified fliC gene. Res Microbiol 2000; 151:535-546.

2. Prager R, Strutz U, Fruth A, Tschäpe H. Subtyping of pathogenic Escherichia coli strains using flagellar (H) - antigens: serotyping versus fliC polymorphisms. Int J Med Microbiol 2003; 292:477-486.

3. Wang L, Rothemund D, Curd H, Reeves PR. Species-wide variation in the Escherichia coli flagellin (H-antigen) gene. J Bacteriol 2003; 185:2936-2943.

4. 0rskov I, 0rskov F. Escherichia coli serotyping and in man and animals. Can J Microbiol 1992; 38:699-704.

5. Ratiner YA. Temperature-dependent flagellar antigen phase variation in Escherichia coli. Res Microbiol 1999; 150:457-463.

6. Schoenhals G, Whitfield C. Comparative analysis of flagellin sequences from Escherichia coli strains possessing serologically distinct flagellar filaments with a shared complex surface pattern. J Bacteriol 1993; 175:5395-5402.

7. Fields PI, Blom K, Hughes HJ, Helsel LO, Feng P, Swaminathan B. Molecular characterization of the gene encoding H antigen in Escherichia coli and development of a PCR-Restriction fragment length polymorphism test for identification of E. coli O157:H7 and O157:NM. J Clin Microbiol 1997; 35:1066-1070.

8. Amhaz JMK, Andrade A, Bando SY, Tanaka TL, Moreira-Filha CA, Martinez MB. Molecular typing and phylogenetic analysis of enteroinvasive Escherichia coli using the fliC gene sequence. FEMS Microbiol Lett 2004; 235:259-264.

9. Scheutz F, Cheasty T,Woodward D, Smith HR. Designation of O174 and O175 to temporary O groups OX3 and OX7, and six new E. coli O groups that include Verocytotoxin-producing E. coli (VTEC): O176, O177, O178, O179, O180 and O181. AP-MIS 2004; 112:569-584.

10. 0rskov F, 0rskov I, Jann B, Jann K. Serology, chemistry, and genetics of O and K antigens of Escherichia coli. Bacteriol Rev 1977; 41:667-710.

11. Ewing WH, Edwards, PR. The genus Escherichia. Identification of Enterobacteriaceae, Burgess, Minneapolis, 1983.

12. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. New York CSHL, 1989.