Scholarly article on topic ' Synergic role of the two ars operons in arsenic tolerance in P seudomonas putida KT2440 '

Synergic role of the two ars operons in arsenic tolerance in P seudomonas putida KT2440 Academic research paper on "Biological sciences"

0
0
Share paper
Academic journal
Environmental Microbiology Reports
OECD Field of science
Keywords
{""}

Academic research paper on topic " Synergic role of the two ars operons in arsenic tolerance in P seudomonas putida KT2440 "

environmental microbiology reports

Environmental Microbiology Reports (2014) 6(5), 483-489

iocl«1y^> for applied

doi:10.1111/1758-2229.12167

Synergic role of the two ars operons in arsenic tolerance in Pseudomonas putida KT2440

Matilde Fernández,1* Zulema Udaondo,2,3 José-Luis Niqui,2 Estrella Duque1 and Juan-Luis Ramos1,3

1 Department of Environmental Protection, Consejo Superior de Investigaciones Científicas, CSIC-EEZ, Granada, 18008, Spain.

2Bio-Iliberis R&D, Peligros, Granada, 18210, Spain. 3Abengoa Research, Campus Palmas Altas, Sevilla, 41014, Spain.

Summary

The chromosome of Pseudomonas putida KT2440 carries two clusters of genes, denoted arsl and ars2, that are annotated as putative arsenic resistance operons. In this work, we present evidence that both operons encode functional arsenic-response regulatory genes as well as arsenic extrusion systems that confer resistance to both arsenite [As(III)] and arsenate [As(V)]. Transcriptional fusions of Pare1 and Pars2 to lacZ revealed that expression of both operons was induced by arsenite and arsenate. We generated single mutants in arsl and ars2, which showed lower resistance to arsenic than the wild-type strain. A double ars1/ars2 was found to be highly sensitive to arsenic. Minimum inhibitory concentrations (MICs) for single mutants decreased two- to fourfold with respect to the parental strain, while in the double mutant the MIC decreased 128-fold for arsenite and 32-fold for arsenate. Bioinformatic analysis revealed that the ars2 resistance operon is part of the core genome of P. putida, while the arsl operon appears to only occur in the KT2440 strain, suggesting that arsl was acquired by horizontal gene transfer. The presence of arsl in KT2440 may explain why it exhibits higher resistance to arsenic than other P. putida strains, which bear only the ars2 operon.

Introduction

Arsenic is a highly toxic element present in many terrestrial and aquatic environments derived from natural and

Received 11 March, 2014; accepted 4 April, 2014. *For correspondence. E-mail juan.ramos@research.abengoa.com; Tel. (+34) 648102090; Fax (+34) 955413371.

anthropogenic sources (Tsai etal, 2009). In natural environments, it is mostlyfound astrivalent arsenite [As(III)] or pentavalent arsenate [As(V)]. Arsenite is significantly more toxic for living organisms because of its strong ability to react with sulfhydryl groups in proteins and because it depletes intracellular glutathione, giving rise to unspecific oxidative processes and the production of reactive oxygen species (Baker-Austin etal., 2007). The harmful effects of arsenate are due to its structural similarity to phosphate, which allows it to behave as an inhibitor of a wide spectrum of reactions, including the synthesis of ATP (Dopson etal., 2003; Baker-Austin etal., 2007; Huertas and Michán, 2013).

The location of ars genes, which have been observed on both chromosomes and plasmids, does not impact their ability to confer resistance to arsenic (Rosen, 1995; Oremland and Stolz, 2003; Páez-Espino etal., 2009). The archetypal bacterial defence/tolerance system consists of a transcriptional regulator, an efflux system and an arsenate reductase. The archetypal genetic organization is arsRBCH, which encodes the ArsR transcriptional repres-sor; the ArsB membrane-bound transporter that extrudes arsenite; theArsC arsenate reductase; andArsH, which is a protein of unknown function that influences arsenic resistance. The transcriptional repressor/regulator ArsR is bound to its promoter in the absence of arsenite, which blocks transcription; however, in the presence of arsenite, conformational changes release it from its cognate promoter (Xu etal., 1996; 1998; Páez-Espino etal., 2009). In addition to the arsRBCH core genes, some microorganisms carry other genes related to arsenic resistance. Examples of these genes include: arsA, an ATPase that provides energy to the extrusion system (Rosen,

2002); arsD, an arsenic metallochaperone (Lin etal., 2006); arsT, a gene for a putative thioredoxin reductase (Wang etal., 2006); and arsH, a NADPH-dependent quinone reductase, which seems to play a role in the response to oxidative stress caused by arsenite (Hervás etal, 2012).

Pseudomonas putida KT2440 is a versatile soil bacterium that exhibits high arsenic tolerance (Cánovas etal.,

2003) and it is considered a model microorganism for the study of bioremediation, plant-microbe interactions and other relevant processes with the aim of understanding the biology of soil microorganisms (Timmis, 2002; Duque etal., 2007; Fernández etal., 2012). The annotation of

© 2014 The Authors. Environmental Microbiology Reports published by Society for Applied Microbiology and John Wiley & Sons Ltd.

This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and

distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are

the P. putida KT2440 genome revealed the presence of two putative arsRBCH operons, known as ars1 and ars2 (Nelson etal., 2002). Cánovas and colleagues (2003) showed that the genetic location of the ars1 cluster is atypical and is therefore thought to have been acquired through horizontal gene transfer (Cánovas etal., 2003). Recently, Chen and colleagues (2013) engineered KT2440 for use in the bioremediation of environmental arsenic through the expression of a heterologous arsenite S-adenosylmethionine methyltransferase. The recombinant strain methylated inorganic arsenic to generate less toxic organoarsenicals.

To study the contribution of ars operons towards arsenic resistance, we generated single and double ars mutants, and also fused the ars promoter to 'lacZto study the expression levels of the two operons. We found that

both operons function to sense and extrude arsenic, and that they act synergistically to provide KT2440 with extremely high levels of resistance to arsenic.

Results and discussion

Organization of the ars genes

Sequence analyses confirmed that the ars1 and ars2 clusters of P. putida KT2440 (Supporting Information Table S1) contain a core set of genes that match the archetypal arsRBCH organization (Fig. 1A). In the case of the ars1 cluster, there are additional three genes located downstream of asrH1 that could form part of the operon. The putative function of the corresponding gene products are proposed to be a phosphatase, a monooxygenase

01 2 3456 789 10 11 12 m m ü - M

Fig. 1. A. Schematic representation of ars operons in KT2440. The complete genome sequence of P. putida KT2440 was retrieved from the NCBI database. I: ars1 operon, II: ars2 operon.

B. RT-PCR assays. RT-PCR products (lanes with even numbers) and their respective negative controls without RT step (lanes with odd numbers). I: ars1 operon; lane 0: Molecular Weight Marker VIII (Roche); lane 1: arsRB1 amplicon; lane 2 arsRB1 negative control; lane 3: arsBC1 amplicon; lane 4: arsBC1 negative control; lane 5: arsCH1 amplicon; lane 6: arsCH1 negative control; lane 7: arsH1/PP1926 amplicon; lane 8: arsH1/PP1926 negative control; lane 9 PP1926/PP1925 amplicon; lane 10: PP1926/PP1925 negative control; lane 11: PP1925/PP1924 amplicon; and lane 12: PP1925/PP1924 negative control. II: operon ars2; lane 0: Molecular Weight Marker VIII; lane 1: arsRB2 amplicon; lane 2: arsRB2 negative control; lane 3 arsBC2 amplicon; lane 4: arsBC2 negative control; lane 5: arsCH2 amplicon; and lane 6: arsCH2 negative control.

and a phosphinothricin N-acetyltransferase respectively; however, their relationship to arsenic resistance is unclear.

The genes in each of the clusters overlap with each other or are separated by short sequences of only a few nucleotides, suggesting that they are indeed operons. In order to investigate this, we performed qualitative RT-PCR assays with primers based on the 3' terminal end of each gene and the 5' terminal end of the downstream adjacent gene (Supporting Information File S1, Table S2) with the aim of experimentally verifying that genes in the arsl and ars2 operons are truly polycistronic. Results (Fig. 1B) confirmed that the genes in each operon were, in fact, co-transcribed.

Operons ars1 and ars2 are functional in KT2440

Arsenic tolerance in the wild-type Pseudomonas putida KT2440 and its isogenic mutants. Pseudomonas putida KT2440 exhibited high resistance to arsenic compounds, with MICs of 8 mM for arsenite and 256 mM for arsenate (Table 1). With the aim of establishing the role of the arsl and ars2 operons in arsenic tolerance, we constructed insertional mutants to inactivate the efflux transporter of each operon, namely arsBI and arsB2 (Supporting Information Table S1). These insertions exert polar effects on arsCHI and arsCH2 as deduced from RT-PCR assays. We also constructed a double mutant arsB1/arsB2 as described in the Supplementary File S1. These mutants were phenotypically analyzed by MIC assays against arsenite and arsenate in order to determine their arsenic tolerance. The results, summarized in Table 1, show a statistically significant decrease in arsenite tolerance in both single mutants; the MIC for arsBI mutant decreased fourfold and the MIC for the arsB2 mutant dropped twofold with respect to the wild-type strain. MIC analysis revealed

Table 1. Bacterial resistance to arsenic.

Strain Arsenite (mM) Arsenate (mM)

KT2440 (WT) 8 256

KT2440 pCHESI::arsi 2 128

KT2440 mini Ton5::ars2 4 64

KT2440 pCHESI::arsi/ 0.0625 8

miniTn5::ars2

DOT-T1E 4 256

F1 4 256

BIRD1 2 256

HB3264 1 128

Minimum inhibitory concentration of arsenite and arsenate. P. putida KT2440 (WT), its isogenic mutants in ars1 and/or ars2, and other P. putida strains. All results obtained were found statistically significant by Mann-Whitney Rank Sum Test and the one-way ANOVA analysis on ranks.

that the arsl efflux transporter is quantitatively more potent than that of ars2, because the arsl mutant had a lower arsenite MIC than the ars2 mutant. This correlates with the results of transcriptional fusions, which showed higher lacZ expression levels from the arsl promoter in response to the presence of arsenic.

In addition, a dramatic reduction in arsenic resistance in the arsB1/arsB2 double mutant was observed, resulting in a 128-fold decrease in MIC. Arsenate tolerance was also affected in all mutants, especially the arsB1/arsB2 double mutant, which showed a 32-fold decrease in the MIC versus wild type.

It has been previously reported that KT2440 exhibits high resistance to arsenic (Cánovas etal., 2003); however, the role of each of the ars operons in arsenic (arsenite and arsenate) resistance was previously unknown. Our results suggest that the level of resistance conferred by the presence of the two ars operons is much larger than the mere sum of the two individual effects, this indicates that the presence of two functional sets of Ars proteins have a very large synergistic effect in resistance to arsenic compounds.

Arsenic induces the expression of arsl and ars2. To study the expression of arsl and ars2, we constructed transcriptional fusions between the promoter/operator regions of each operon and the 'lacZ reporter gene in the pMP220 plasmid (Supplementary File S1). The resulting constructs, pMP220::Parsi and pMP220::Para2, were initially introduced into KT2440 and the level of induction caused by arsenite and arsenate was determined using P-galactosidase activity as a read-out. The results showed that expression of both operons was induced in the presence of arsenite and arsenate (Fig. 2); the induction was detectable at concentrations above 2 |M; and an increase in P-galactosidase activity was found to be directly proportional to the concentration of arsenic in the culture medium. Similar induction profiles were found when pMP220:Parsi and pMP220:Pars2 were introduced into the single mutants arsBI and arsB2 (Supporting Information Table S3); however, for both the differences were not statistically significant. When pMP220:Parsi and pMP220: Pars2, were introduced into the arsB1/arsB2 double mutant, P-galactosidase analysis revealed that the induction level of arsl and ars2 was higher than in KT2440, especially when the inducer assayed was arsenate (Fig. 2).

A number of in vitro studies with purified ArsR protein have shown that this regulator binds arsenite but does not respond to arsenate, although addition of arsenate to culture medium induced ars operons in vivo (López-Maury etal., 2003; Wang etal., 2009; Zhang etal., 2009). It was proposed that this paradox could be explained by the assumption that arsenate is reduced to

A) KT2440 (WT)

0 2 4 8

[As(III)] (^M) B) Double Mutant ars1lars2

1200 1000 1 800 M600 400 200

[As(III)] (^M)

[As(V)] (^M)

[As(V)] (^M)

Fig. 2. Pafs promoter induction by arsenite [As (III)] and arsenate [As(V)].

A. Wild-type KT2440

B. Double mutant in ars1lars2.

p-Galactosidase activity harbouring transcriptional fusions pMP220::Pars1 (green bars) and pMP220::Pars2 (red bars). Error bars show standard error.

arsenite by ArsC in vivo; however, our in vivo results showed that arsenate-mediated induction occurred in the ars1/ars2 double mutant, despite the fact that arsC is not expressed because of polar effects. This finding led us to speculate that in the double mutant arsenite is produced after arsenate reduction and that an arsenate reductase that does not form part of the ars cluster may exist in the genome. We re-analyzed the genome of KT2440 for potential arsenate reductases and found two additional open reading frames (ORFs): PP1531 and PP1645.

In the case of the double mutant, the induction of Pars1 and Pars2 is higher than in the parental strain. In addition, induction of ars1 and ars2 in the double mutant was seen at lower concentrations than in the wild type, with induction being detected at concentrations of 1 |M (data not shown). Thus, we propose that arsenite produced by these putative reductases (PP1531 and PP1645) cannot be extruded and is accumulated inside the cell, causing higher induction levels than in the parental strain.

cgattgtaaatatctgctttaccgcatattcgaatagtcatatatt

-35 -10

cggatttccagatattggccgtacgcgcattcccaggaggtcacatg +1

gagctgcaagcgcacaagcccaggaaggcttgctagcacatatgg

aaatacgtatattcggttttccgtatgtacaggcacccccatg -10 +1

Fig. 3. Nucleotide sequences of Parai and Para2 promoters. Predicted -35 and -10 sequences are underlined; transcription start points, as determined by 5'RACE, are marked in red; putative Shine-Dalgarno sequences are shown in green and the predicted translation start codons are shown in bold.

Identification of the transcription start point of the ars1 and ars2 operons

The transcriptional start points (tsp) of arsl and ars2 were determined using the 5'-RACE system. For the arsl operon (Fig. 3), the main tsp was identified as the nucleotide in position 2176963 of the genome of KT2440. This nucleotide is located 38 nucleotides upstream of the putative ATG start codon, which is preceded by a standard AGGAGG Shine-Dalgarno sequence four nucleotides upstream. The tsp for the ars2 operon (Fig. 3) was mapped to position 3107734 in the chromosome, 21 nucleotides upstream from the putative translational start codon. In both cases, -10 and -35 sequences with high similarity to those recognized by the 670/RNA polymerase were identified in silico using Bprom software.

Various consensus binding sites have been proposed for ArsR regulators in different microorganisms: the core dyad sequence ATCAA(N)6-mTTGAT is conserved among Bacillus subtilis (Sato and Kobayashi, 1998), Synechocystis spp (Lopez-Maury etal., 2003) and Campylobacter sp. strains (Wang etal., 2009; Nakajima etal., 2013). In Escherichia coli, Xu and colleagues (1996) proposed the 5'-TCAT(N)7TTTG-3' motif as the

binding site for the ArsR protein. While the ars1 and ars2 promoters in P. putida KT2440 do not contain this characteristic ArsR binding sequence, we identified in both a 15 nucleotide consensus region, 5'-TATATTCGGNTTT CC-3' (Table 2), which overlaps with the -10 region and the tsp. This sequence does not exist at any other place in the genome of KT2440 but is present in the promoter region of the ars operon in other P. putida strains and a number of P. aeruginosa strains (Table 2). Although in vivo footprinting assays are needed to support this proposal, it is likely that in P. putida the ArsR proteins bind to a sequence that is different from those previously described for other microorganisms.

Phylogenetic relationships

At the strain level, amino acid sequence alignments revealed a 63% identity between ArsR1 and ArsR2, 76% between ArsB1 and ArsB2, 65% between ArsC1 and ArsC2, and 81% between ArsH1 with ArsH2. Nucleotides sequence alignments showed that the entire ars1 and ars2 operons share 71% sequence identity.

A BLASTn search of ars2 showed top matches with ars operons of P. putida strains BIRD, F1, ND6 and DOT-T1E, with 99%, 98%, 97% and 97% identity respectively; while the ars1 operon shared 72% identity with P. mendocina NK-01, P. fluorescens Pf0-1, Pseudomonas sp. UW4 and P. stutzeri DSM10701.

A phylogenetic tree (Fig. 4) was generated using CLUSTALW2 and multiple alignments of nucleotide sequences from arsR1, arsR2 and the sequences of other arsR genes from sequenced strains of P. putida (Matilla etal, 2011; Molina etal, 2014; Wu etal, 2011). Within the phylogenetic tree, ars1 is located on a separate branch, confirming that ars1 is more dissimilar to other ars operons in this species. Cánovas and colleagues (2003) already noted that ars1 was located at a chromosomal region with an atypical genome signature (Weinel etal., 2002). Our results preclude the hypothesis of a putative

Table 2. Consensus sequence in Pars of P. putida.

DOT-T1E

ND6_arsA

KT2440_ars2

aNBRC1464

B136-33

UCBPP-PA14

KT2440_ars1

ND6_arsB

ACGTATATTCGGCTTTCC-------GTATGTACAGGCA--CCC--------CCATG

ACGTATATTCGGCTTTCC-------GTATGTACAGGCA--CCC--------CCATG

ACGTATATTCGGCTTTCC-------GTATGTACAGGCA--CCC--------CCATG

ACGTATATTCGGCTTTCC-------GTATGTACAGGCA--CCC--------CCATG

ACGTATATTCGGTTTTCC-------GTATGTACAGGCA--CCC--------CCATG

ACGTATATTCGGCTTTCC-------ATATGTATTGGTG--CCG--------CGATG

ACGTATATTCGCTTTTCC-------ATATG-TCTGGTG--TTG--------CCATG

CCGTATATTCGGCTTTCC-------ATATATTCAGGAAGGCCCAG------CGATG

CCGTATATTCGGCTTTCC-------ATATATTCAGGAAGGCCCAG------CGATG

GCGTATATTCGATTATCC-------ATATGTTTTGGTG--CAA--------CCATG

TCATATATTCGGATTTCCAGATATTGGCCGTACGCGCATTCCCAGGAGGTCACATG TCATATATTCGATTTTCCG-----AATAAGCTCTGAGG-TCCC--------CGATG

39 39 39 39 39 39

38 43 43

Clustal Multiple Alignment of Pars sequences of a number of different Pseudomonas strains, P. areuginosa B136-33 and P. areuginosa UCBPP-PA14. Predicted translational start codons are indicated in bold.

Fig. 4. Phylogenetic relationship of ars operons. Phylogenetic tree from Clustal Multiple Alignment of arsR sequences of P. putida strains deposited in the database.

gene duplication origin for these two operons and support the hypothesis that arsl was acquired by horizontal transfer at a relatively recent point in the evolution of P. putida KT2440. In fact, the arsl operon is located within one of the largest genomic islands in the chromosome of KT2440; its size is around 60 kb and it contains 45 ORFs flanked by a gene encoding a phage integrase (Weinel etal, 2002).

The current pan-genome of P. putida, which we based on the analysis of 10 complete genome sequences, was used to evaluate the presence of ars operons in the core genome. We found that the ars2 operon is present in all P. putida strains while arsl genes are not (Z. Udaondo and J.L. Ramos, unpubl. data). In fact PP1924 is a gene exclusive to KT2440, and two other genes of the arsl operon (PP1925 and PP1926) are not part of the core genome of P. putida. The ND6 strain also has two ars operons, but both exhibit a low degree of identity with the arsl operon.

Arsenic tolerance in other P. putida strains

In order to study whether the presence of the differential operon arsl confers a higher degree of arsenic resistance to KT2440, we tested arsenic tolerance in other P. putida strains which are phylogenetically very close to KT2440, but which contain only the ars2 operon: F1, BIRD1, DOT-T1E and HB3267. The results revealed that all tested strains exhibited a statistically significant lower arsenic resistance than KT2440 (Table 1), especially when arsen-ite was used, exhibiting MICs between twofold (F1 and DOT-T1E) and eightfold (HB3264) lower than those of KT2440. Thus, our study suggests that the acquisition of arsl likely provided an advantage through improved resistance to arsenic, and may reveal, in part, why P. putida strains such as KT2440 can thrive in habitats polluted with arsenic.

Functionality of the putative phosphinothricin N-acetyltransferase from ars1

As mentioned above, the last gene of the arsl operon, PP1924, encodes a putative phosphinothricin N-

acetyltransferase. In order to test whether the functional prediction is correct, we assayed phosphinothricin (PPT) resistance in the wild type and in the arsl mutant using MIC assays. The results showed that the arsl mutant exhibited a statistically significant drop in resistance to PPT (twofold lower) than the wild-type strain (Supporting Information Table S4). In addition, when P. putida KT2440 was cultured in medium containing arsenite (25 |M), KT2440 exhibited increased cross-tolerance to PPT (Supporting Information Table S4).

PPT, is a potent herbicide that blocks glutamine synthetase and it is able to inhibit Pseudomonas growth (Ramos etal., 1991). In fact, arsenic compounds have been used historically in agriculture as herbicides, especially in cotton production (Bednar etal., 2002). Although the real connection between these genes, which are located in the same operon, and their respective involvement in arsenic and PPT tolerance, remains unknown, the arsl operon is an important factor that warrants further study and may help explain the competitive advantage of this soil bacterium.

Acknowledgements

Work in this study was supported by Fondo Social Europeo and Fondos FEDER from the European Union, through several projects BI02010-17227, ST-FLOW from the EC. We thank Ben Pakuts for critical reading of this manuscript.

References

Baker-Austin, C., Dopson, M., Wexler, M., Sawers, R.G., Stemmler, A., Rosen, B.P., and Bond, P.L. (2007) Extreme arsenic resistance by the acidophilic archaeon Ferroplasma acidarmanus Fer1. Extremophiles 11: 425434.

Bednar, A.J., Garbarino, J.R., Ranville, J.F., and Wildeman, T.R. (2002) Presence of organoarsenicals used in cotton production in agricultural water and soil of the southern United States. J Agric Food Chem 50: 7340-7344. Cánovas, D., Cases, I., and de Lorenzo, V. (2003) Heavy metal tolerance and metal homeostasis in Pseudomonas putida as revealed by complete genome analysis. Environ Microbiol 5: 1242-1256.

Chen, J., Qin, J., Zhu, Y.G., de Lorenzo, V., and Rosen, B.P. (2013) Engineering the soil bacterium Pseudomonas putida for arsenic methylation. Appl Environ Microbiol 79: 4493-4495.

Dopson, M., Baker-Austin, C., Koppineedi, P.R., and Bond, P.L. (2003) Growth in sulfidic mineral environments: metal resistance mechanisms in acidophilic micro-organisms. Microbiology 149: 1959-1970.

Duque, E., Molina-Henares, A.J., de la Torre, J., Molina-Henares, M.A., del Castillo, T., Lam, J., and Ramos, J.L. (2007) Towards a genome-wide mutant library of Pseudomonas putida strain KT2440. In Pseudomonas, Vol. V: A Model System in Biology. Ramos, J.L., and Filloux, A. (eds). Dorchester, The Netherlands: Springer, pp. 227-251.

Fernández, M., Niqui-Arroyo, J.L., Conde, S., Ramos, J.L., and Duque, E. (2012) Enhanced tolerance to naphthalene and enhanced rhizoremediation performance for Pseudomonas putida KT2440 via the NAH7 catabolic plasmid. Appl Environ Microbiol 78: 5104-5110.

Hervás, M., López-Maury, L., León, P., Sánchez-Riego, A.M., Florencio, F.J., and Navarro, J.A. (2012) ArsH from the cyanobacterium Synechocystis sp. PCC 6803 is an efficient NADPH-dependent quinone reductase. Biochemistry 51: 1178-1187.

Huertas, M.J., and Michán, C. (2013) Indispensable or toxic? The phosphate versus arsenate debate. Microb Biotechnol 6: 209-211.

Lin, Y.F., Walmsley, A.R., and Rosen, B.P. (2006) An arsenic metallochaperone for an arsenic detoxification pump. Proc Natl Acad Sci USA 103: 15617-15622.

López-Maury, L., Florencio, F.J., and Reyes, J.C. (2003) Arsenic sensing and resistance system in the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol 185: 5363-5371.

Matilla, M.A., Pizarro-Tobías, P., Roca, A., Fernández, M., Duque, E., Molina, L., etal. (2011) Complete genome of the plant growth-promoting rhizobacterium Pseudomonas putida BIRD-1. J Bacteriol 193: 1290.

Molina, L., Udaondo, Z., Duque, E., Fernández, M., Molina-Santiago, C., Roca, A., etal. (2014) The spread of antibiotic resistance markers from a Pseudomonas putida strain isolated from a hospital. PLoS ONE 9: e81604.

Nakajima, T., Hayashi, K., Nagatomi, R., Matsubara, K., Moore, J.E., Millar, B.C., and Matsuda, M. (2013) Molecular identification of an arsenic four-gene operon in Campylobacter lari. Folia Microbiol 58: 253-260.

Nelson, K.E., Weinel, C., Paulsen, I.T., Dodson, R.J., Hilbert, H., Martins dos Santos, V.A., etal. (2002) Complete genome sequence and comparative analysis of the meta-bolically versatile Pseudomonas putida KT2440. Environ Microbiol 4: 799-808.

Oremland, R.S., and Stolz, J.F. (2003) The ecology of arsenic. Science 300: 939-944.

Páez-Espino, D., Tamames, J., de Lorenzo, V., and Cánovas, D. (2009) Microbial responses to environmental arsenic. Biometals 22: 117-130.

Ramos, J.L., Duque, E., and Ramos-Gonzalez, M.I. (1991) Survival in soils of an herbicide-resistant Pseudomonas

putida strain bearing a recombinant TOL plasmid. Appl Environ Microbiol 57: 260-266.

Rosen, B.P. (1995) Resistance mechanisms to arsenicals and antimonials. J Basic Clin Physiol Pharmacol 6: 251263.

Rosen, B.P. (2002) Biochemistry of arsenic detoxification. FEBS Lett 529: 86-92.

Sato, T., and Kobayashi, Y. (1998) The ars operon in the skin element of Bacillus subtilis confers resistance to arsenate and arsenite. J Bacteriol 180: 1655-1661.

Timmis, K.N. (2002) Pseudomonas putida a cosmopolitan opportunist par excellence. Environ Microbiol 4: 779-781.

Tsai, S.L., Singh, S., and Chen, W. (2009) Arsenic metabolism by microbes in nature and the impact on arsenic remediation. Curr Opin Biotechnol 20: 659-667.

Wang, L., Chen, S., Xiao, X., Huang, X., You, D., Zhou, X., and Deng, Z. (2006) arsRBOCTarsenic resistance system encoded by linear plasmid pHZ227 in Streptomyces sp. strain FR-008. Appl Environ Microbiol 72: 3738-3742.

Wang, L., Jeon, B., Sahin, O., and Zhang, Q. (2009) Identification of an arsenic resistance and arsenic-sensing system in Campylobacter jejuni. Appl Environ Microbiol 75: 5064-5073.

Weinel, C., Nelson, K.E., and Tümmler, B. (2002) Global features of the Pseudomonas putida KT2440 genome sequence. Environ Microbiol 4: 809-818.

Wu, X., Monchy, S., Taghavi, S., Zhu, W., Ramos, J., and van der Lelie, D. (2011) Comparative genomics and functional analysis of niche-specific adaptation in Pseudomonas putida. FEMS Microbiol Rev 35: 299-323.

Xu, C., Shi, W.P., and Rosen, B.P. (1996) The chromosomal arsR gene of Escherichia coli encodes a trans-acting metalloregulatory protein. J Biol Chem 271: 2427-2432.

Xu, C., Zhou, T., Kuroda, M., and Rosen, B.P. (1998) Metalloid resistance mechanisms in prokaryotes. J Biochem 23: 16-23.

Zhang, Y.B., Monchy, S., Greenberg, B., Mergeay, M., Gang, O., Taghavi, S., and van der Lelie, D. (2009) ArsR arsenic-resistance regulatory protein from Cupriavidus metalli-durans CH34. Antonie Van Leeuwenhoek 96: 161-170.

Supporting information

Additional Supporting Information may be found in the online version of this article at the publisher's web-site:

File S1. Experimental procedures.

Table S1. Microorganisms used in this study.

Table S2. Oligonucleotides used in this study; restriction sites

are shown underlined; Asterisk indicates being included in 5'

RACE System kit (Invitrogen).

Table S3. |3-Galactosidase activity of wild-type KT2440 (WT) and the single and double mutants harbouring transcriptional fusions pMP220::Parsi and pMP220::Pars2. Table S4. Minimum inhibitory concentration (MIC) on arsenic-free medium and in medium containing arsenite 25 |M. All results obtained were statistically significant using the Mann-Whitney Rank Sum Test and one-wayANOVAanalysis by ranks.