Scholarly article on topic 'Emergence of Citrobacter freundii carrying IMP-8 metallo-β-lactamase in Germany'

Emergence of Citrobacter freundii carrying IMP-8 metallo-β-lactamase in Germany Academic research paper on "Biological sciences"

0
0
Share paper
Academic journal
New Microbes and New Infections
OECD Field of science
Keywords
{"Antimicrobial resistance" / IMP / "infection control" / "laboratory surveillance" / metallo-β-lactamases / "multidrug resistance"}

Abstract of research paper on Biological sciences, author of scientific article — S. Peter, C. Wolz, M. Kaase, M. Marschal, B. Schulte, et al.

Abstract Metallo-β-lactamases (MBLs) in Enterobacteriaceae are an increasing problem worldwide. This report describes the isolation of Citrobacter freundii carrying IMP-8 MBL from three patients during the period from March 2012 until March 2013 in Germany. The bla IMP-8 enzyme is predominantly found in Asia, where IMP-8 has spread to various enterobacterial species causing serious infections. To our best knowledge, this is the first report of bla IMP-8 habouring Enterobacteriaceae in Europe.

Academic research paper on topic "Emergence of Citrobacter freundii carrying IMP-8 metallo-β-lactamase in Germany"

NEW MICROBES IN HUMANS - NEW RESISTANT MICROBES IN HUMANS

I0.I002/nmi2.36

Emergence of Citrobacter freundii carrying IMP-8

metallo-b-lactamase in Germany

S. Peter12, C. Wolz1,2, M. Kaase3, M. Marschal12, B. Schulte1,2, W. Vogel4, I. Autenrieth1,2 and M. Willmann1,2

1) Institute of Medical Microbiology and Hygiene, University of Tubingen, 2) German Centre for Infection Research (DZIF), partner site Tubingen, Tubingen, 3) National Reference Laboratory for Multidrug Resistant Gram-negative Bacteria, Department of Medical Microbiology, Ruhr University Bochum, Bochum and 4) Medical Centre, Department of Haematology, Oncology, Immunology, Rheumatology and Pulmonology, University of Tubingen, Tubingen, Germany

Abstract

Metallo-b-lactamases (MBLs) in Enterobacteriaceae are an increasing problem worldwide. This report describes the isolation of Citrobacter freundii carrying IMP-8 MBL from three patients during the period from March 2012 until March 2013 in Germany. The b/aIMP_8 enzyme is predominantly found in Asia, where IMP-8 has spread to various enterobacterial species causing serious infections. To our best knowledge, this is the first report of b/aIMP-8 habouring Enterobacteriaceae in Europe.

Keywords: Antimicrobial resistance, IMP, infection control, laboratory surveillance, metallo-b-lactamases, multidrug resistance Original Submission: 3 October 2013; Revised Submission: 22 December 2013; Accepted: 14 January 2014 Article published online: 21 March 2014 New Microbe New Infect 2014; 2: 42-45

Introduction

The emergence and spread of carbapenemase-producing Enterobacteriaceae is an increasing problem of global dimensions. Originally, metallo-b-lactamases (MBLs) were associated with resistance in Gram-negative non-fermenters, but they

have become increasingly important regarding carbapenem resistance in Enterobacteriaceae. MBLs confer resistance to almost all b-lactam antibiotics and are not inactivated by b-lactamase inhibitors, hence limiting treatment options in the individual patient and presenting a major challenge for infection control within the hospital setting [1].

To date, the occurrence of carbapenem-resistant Entero-bacteriaceae in Germany is still a rare event; however, outbreaks involving KPC and VIM-1 carrying Klebsiella pneumoniae isolates have been described [2,3]. In the year 2012, VIM-1 was the most prevalent MBL detected in Enterobacte-riaceae in Germany, followed by NDM-1 and GIM-1 [2]. IMP type MBLs were first identified in Pseudomonas aeruginosa in Japan [4] and have since been reported predominantly from Asia [5]. With the exception of Italy, IMP-type enzymes have rarely been reported from other countries in Europe [1,5,6].

Here, we report the isolation of Citrobacter freundii harbouring MBL IMP-8 from three patients between March 2012 and March 2013. All isolates were obtained from rectal swabs. All three patients had underlying haematological conditions (acute myeloid leukaemia n = 2 and myelodysplas-tic syndrome n = 1) and underwent haematopoietic stem cell transplantation. They were screened from rectal swabs for colonization with multidrug resistant Gram-negative bacteria on a weekly routine schedule.

Laboratory Analysis

Identification of the isolates was performed using matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI TOF-MS) (AXIMA Assurance, bioMerieux SA, Marcy l'Etoile, France; Saramis Database Version 4.09) and the VITEK 2 identification system (bioMerieux SA). Antimicrobial susceptibility testing was initially performed with the VITEK 2 system (bioMerieux SA) and confirmed by Etest (bioMerieux SA). Results were interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines (http://www.eucast.org/fileadmin/src/media/PDFs/ EUCAST_files/Breakpoint_tables/Breakpoint_table_v_3.l.pdf). The detection of extended-spectrum b-lactamase genes b/aCTX-M, b/aTEM, b/aSHV, [7] and carbapenemase genes b/aOXA-48 [8], b/aKPC [9], b/aNDM [10], b/aIMPand b/aVIM [11] was performed as described previously. Sequencing of the IMP genes was performed using class 1 integron primer 3CS (5'-AAG CAG ACT TGA CCT GA-3') in combination with primer IMP-A, and 5CS (5'-GGC ATC CAA GCA GCA AG-3') in combination with primer IMP-B [11]. Sequence identification was determined by comparison with the sequences available in GenBank (http:// www.ncbi.nih.gov/BLAST) and with the reference sequences of

Corresponding author: S. Peter, Institute of Medical Microbiology and Hygiene, Elfriede-Aulhorn-Strasse 6, 72076 Tubingen, Germany E-mail: silke.peter@med.uni-tuebingen.de

© 2014 The Authors. New Microbes and New Infections published by John Wiley & Sons Ltd on behalf of the European Society of Clinical Microbiology and Infectious Disease. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.

the Lahey database (http://www.lahey.org/studies). Alignment was performed using BioEdit version 7.1.11 (Ibis Biosciences, Carlsbad, CA, USA). Genomic fingerprinting of the isolates was done by the enterobacterial repetitive intergenic consensus (ERIC) method using the ERIC2 primeras described previously [12]. Plasmids were extracted using the Qiagen large construct kit (Qiagen, Hilden, Germany) and digested using EcoRI and BamHI to allow for size estimation of the plasmids. Southern blotting was performed following a standard protocol. Briefly, DNA was blotted onto positively charged nylon membranes (Roche Biochemicals, Basel, Switzerland) in denaturation solution (3 M NaCl, 0.4 M NaOH) by capillary transfer. High stringency hybridization was performed in accordance with the instructions given by the manufacturer of the digoxigenin labelling and detection kit (Roche Biochemicals). Digoxigenin-labelled DNA probes were generated with a digoxigenin-labelling PCR kit as described in the manufacturer's instructions (Roche Biochemicals) using the oligonucleotides IMP-A and IMP-B.

Results

The characteristics of the isolates are summarized in Table 1. All three isolates were resistant to piperacillin-tazobactam, cefuroxime and cefotaxime. The MIC of meropenem was >32 mg/L for the isolate of patients two and three, whereas meropenem MIC for patient one was intermediate with an MIC of 8 mg/L. All three strains were susceptible to tigecy-cline, colistin and amikacin. Molecular detection of ESBL genes blaCTX-M, blaTEM, blaSHV and carbapenemase genes b/aOXA-48, blaKPC, blaNDM and blaVIM was negative in all three isolates. The IMP PCR gave a positive result and subsequent determination of the nucleotide sequence revealed an MBL of the IMP-8 type. The sequence was compared with the reference sequence (GenBank accession number AF322577) [13]. The blaIMP-8 gene detected in the three isolates harboured a non-coding point mutation at position 18 (T?C) as shown in Fig. 1. Additionally, an IMP-8 carrying plasmid of approximately

TABLE 1. Characteristics of IMP-8 carrying Citrobacter freundii isolates from rectal swabs of three hospitalized patients in Germany

Etest results: MIC for the antimicrobial agents in mg/L and interpretation11

Patient Source Isolation date TZP CXM CTX CAZ FEP ATM ERT MEM TIG CIP AN COL

1 Rectal swab March 2012 128 R >256 R 16 R >256 R 16 R 2 I >32 R 8 I 0.75 S 8R 2S 0.75 S

2 Rectal swab June 2012 96 R >256 R 16 R >256 R 24 R 3 I >32 R >32 R 0.75 S 16 R 2S 1 S

3 Rectal swab March 2013 >256 R >256 R 24 R >256 R 24 R 2 I >32 R >32 R 0.75 S 12 R 2S 1 S

I, intermediate; R, resistant; S, susceptible; AN, amikacin; ATM, aztreonam; CAZ, ceftazidime; CIP, ciprofloxacin; COL, colistin; CTX, cefotaxime; CXM, cefuroxime; ERT, ertapenem; MEM, meropenem; TIG, tigecycline; TZP, piperacillin-tazobactam.

interpretation according to the EUCAST clinical breakpoints (http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/Breakpoint_table_v_3.Lpdf).

IMP-8 ATGflAGfiflRTTATTTG'lfTTflTGTGTATGCTTCCTTTGTAGCRTTACTGCCGCaGGaGCGGCTTTGCCTGflTTTRflflRflTCGAGflflGCTTGflAGRAGGTGTTTaTGTTCaTfiCATCGTTCGflaGRflGTTSRCGGTTGGGG Patients ATGAAGAflATTRTTTGTCTTATGTGTATGCTTCCTTTGTAGCATTACTGCCGCAGGAGCGGCTTTGCCTGRTTTRAARRTCGAGRAGCTTGRAGRAGGTGTTTATGTTCATACATCGTTCGRAGRAGTTflRCGGTTGGGG

150 160 170 180 190 200 210 220 230 240 250 260 270 280

.... | . - - - | - ... | .... | .- - . | .... | .... |.... | ....|.... | . - - . | - ... | .... | .... | .---[--.. |.. - . j - - . . | .... 1 - - - - |.... | .... | .... | .... | ... - 1 .... | - - - - | - ...| IMP-8 TGTTGTTTCTARACACGGTTTGGTGGTTCTTGTARACACTGACGCCTRTCTGRTTGACACTCCATTTACTGCTACAGATACTGARRAGTTAGTCRATTGGTTTGTGGAGCGCGGCTRTAARRTCRAAGGCACTRTTTCCT

Patients TGTTGTTTCTARACACGGTTTGGTGGTTCTTGTARACACTGACGCCTATCTGATTGACACTCCATTTACTGCTACAGATACTGARAAGTTAGTCAATTGGTTTGTGGAGCGCGGCTATAARATCAAAGGCACTATTTCCT

290 300 310 320 330 340 350 360 370 380 390 400 410 420 ----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|----|

IMP-8 CRCATTTCCATRGCGRCAGCACAGGGGGARTRGAGTGGCTTRRTTCTCRATCTATTCCCACGTATGCATCTGAATTAACARRTGRACTTCTTAARAARGACGGTAAGGTGCAAGCTARAARCTCRTTTAGCGGAGTTRGT

Patients CRCATTTCCATRGCGACAGCACAGGGGGAATRGAGTGGCTTRATTCTCRATCTATTCCCACGTATGCRTCTGAATTARCARRTGflACTTCTTAflRAflflGACGGTAAGGTGCAAGCTARAARCTCATTTAGCGGAGTTAGT

430 440 450 460 470 480 490 500 510 520 530 540 550 560

. ... | .... | .... | .... | .... | .... | .... | .... | .... | .... | ....[.... | .... | .... | .... | .... | .... | .... 1----| .... | .... | .... | .... | .... |----| .... | ... . | .... |

IMP-8 TATTGGCTRGTTAAAAATAAAATTGRAGTTTTTTRTCCCGGCCCGGGGCACACTCAAGATAACGTAGTGGTTTGGTTACCTGAAAAGAAAATTTTATTCGGTGGTTGTTTTGTTAAACCGGACGGTCTTGGTARTTTGGG

Patients TRTTGGCIRGTTRARRRTRRAATTGfiAGTTTTTTATCCCGGCCCGGGGCACACTCAAGATAACGTAGTGGTTTGGTTACCTGAARRGRRAATTTTRTTCGGTGGTTGTTTTGTTRAACCGGACGGTCTTGGTAATTTGGG

IMP-8 Patients

TGACGCAAATTTAGAAGCTTGGCCAAAGTCCGCCAAAATATTAATGTCTAAATATGGTAAAGCAAAACTGGTTGTTTCAAGTCATAGTGAAATTGGGGACGCATCACTCTTGAAACGTACATGGGAACAGGCTGTTAAAG TGACGCAAATTTAGAAGCTTGGCCAAAGTCCGCCAAAATATTAATGTCTAAATATGGTAAAGCAAAACTGGTTGTTTCAAGTCATAGTGAAATTGGGGACGCATCACTCTTGAAACGTACATGGGAACAGGCTGTTAAAG

710 720 730 740

GGCTAAATGAAAGTAAAAAACCATCACAGCCAAGTAACTAA

Patients GGCTAAATGAAAGTAAAAAACCATCACAGCCAAGTAACTAA

FIG. 1. Sequence of the b/aIMP_8 gene of three Citrobacter freundii strains isolated from hospitalized patients in Germany. Compared with the sequence of the IMP-8 reference strain (GenBank accession number AF322577 [13]), a non-coding point mutation at position 18 was identified in the IMP-8 from the three Citrobacter freundii strains (grey shaded).

44 New Microbes and New Infections, Volume 2 Number 2, March 20l4

28 500 bp could be isolated from all C. freundii strains. Genomic fingerprinting by the ERIC method revealed indistinguishable PCR patterns in all isolates (data not shown).

Conclusion

Acknowledgement

This work was supported by the German Centre for Infection Research (DZIF). We thank Nadine Hoffmann for expert technical assistance.

This is the first report of IMP-8 MBL in Enterobacteriaceae in Germany. IMP-8 is very uncommon in Europe, only once reported from Portugal in a Pseudomonas mendocina strain [6, 14]. In contrast, IMP-8 is frequently encountered in Asia, especially in Taiwan, where IMP-8-producing Enterobacteriaceae are involved in serious infections. Yan et al. reported on a case series of 37 patients with bloodstream infections caused by a large variety of IMP-8-producing enterobacterial species including Escherichia coli, K. pneumoniae, Enterobacter cloacae and C. freundii [15]. Furthermore, aggravating the issue, phenotypic screening for IMP-8-positive Enterobacteriaceae is extremely difficult because of the lack of distinctive pheno-types. Investigation of 95 IMP-8-positive Enterobacteriaceae revealed susceptibility to ertapenem in 21% and to merope-nem in 45%, whereas phenotypic combined disk tests using EDTA and phenylboronic acid were positive in only 40% of the isolates [16]. These observations from Taiwan suggest that IMP-8 is capable of spreading between enterobacterial species, causing serious problems in terms of infection control measures and limiting therapeutic options in critically ill patients.

The role of faecal carriage of MBL-producing Enterobacte-riaceae remains unclear and has not been investigated in a large-scale epidemiological study. Faecal carriage of one C. freundii VIM-1 has been reported from Spain in an outpatient, who was also colonized with two different VIM-1-car-rying K. pneumoniae isolates [17]. In an Italian hospital, eight VIM-1-carrying C. freundii strains were isolated from rectal swab samples during active screening following the detection of a K. pneumoniae carbapenemase (KPC) -positive patient [18].

None of our three patients became infected by the IMP-8 C. freundii strains, but nevertheless it is alarming that IMP-8 MBL circulates in the gut flora of patients at high risk of nosocomial infections. Even more worrisome is the fact, that the IMP-8 gene is located on a plasmid, which might facilitate the transfer of the resistance gene within enterobacterial species. Our findings emphasize the importance of establishing screening schemes and laboratory diagnostic algorithms to ensure the implementation of efficient infection control measures and therapeutic strategies, not only in high-prevalence countries, but also in countries with a low incidence of MBL producing Enterobacteriaceae.

Conflict of Interest

None declared.

References

1. Cornaglia G, Giamarellou H, Rossolini GM. Metallo-ß-lactamases: a last frontier for ß-lactams? [Review] Lancet Infect Dis 2011; 11: 381-393.

2. Nationales Referenzzentrum fur gramnegative Krankenhauserreger (Kaase M. Zur aktuellen Situation bei Carbapenemase-bildenden gramnegativen Bakterien [current situation of carbapenemase producing Gram-negative]). Epidemiol Bull 2013; 19: 167-171.

3. Steinmann J, Kaase M, Gatermann S et al. Outbreak due to a Klebsiella pneumoniae strain harbouring KPC-2 and VIM-1 in a German University Hospital, July 2010 to January 2011. Euro Surveill 2011; 16: pii: 19944.

4. Watanabe M, Iyobe S, Inoue M, Mitsuhashi S. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991; 35: 147-151.

5. Zhao WH, Hu ZQ. IMP-type metallo-ß-lactamases in Gram-negative bacilli: distribution, phylogeny, and association with integrons. Crit Rev Microbiol 2011; 37: 214-226.

6. Grundmann H, Livermore DM, Giske CG et al. Carbapenem-non-sus-ceptible Enterobacteriaceae in Europe: conclusions from a meeting of national experts. Euro Surveill 2010; 15: pii: 19711.

7. Cao V, Lambert T, Nhu DQ, et al. Distribution of extended-spectrum ß-lactamases in clinical isolates of Enterobacteriaceae in Vietnam. Antimicrob Agents Chemother 2002; 46: 3739-3743.

8. Poirel L, Heritier C, Tolun V, Nordmann P. Emergence of oxacillin-ase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimic-rob Agents Chemother 2004; 48: 15-22.

9. Yigit H, Queenan AM, Anderson GJ, et al. Novel carbapenem-hydrolyz-ing ß-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 2001; 45: 1151-1161.

10. Kaase M, Szabados F, Wassill L, Gatermann SG. Detection of carbapenemases in Enterobacteriaceae by a commercial multiplex PCR. J Clin Microbiol 2012; 50: 3115-3118.

11. Pitout JD, Gregson DB, Poirel L, McClure JA, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-ß-lactamases in a large centralized laboratory. J Clin Microbiol 2005; 43: 3129-3135.

12. Johnson JR, O'Bryan TT. Improved repetitive-element PCR fingerprinting for resolving pathogenic and nonpathogenic phylogenetic groups within Escherichia coli. Clin Diagn Lab Immunol 2000; 7: 265-273.

13. Yan JJ, Ko WC, Wu JJ. Identification of a plasmid encoding SHV-12, TEM-1, and a variant of IMP-2 metallo-ß-lactamase, IMP-8, from a clinical isolate of Klebsiella pneumoniae. Antimicrob Agents Chemother 2001; 45: 2368-2371.

14. Santos C, Caetano T, Ferreira S, Mendo S. First description of bla IMP-8 in a Pseudomonas mendocina isolated at the Hospital Infante D. Pedro, Aveiro, Portugal. Res Microbiol 2010; 161: 305-307.

15. Yan JJ, Lee NY, Chen HM et al. Bloodstream infections caused by IMP-8-producing Enterobacteriaceae isolates: the need for clinical

laboratory detection of metallo-ß-lactamases? Eur J Clin Microbiol Infect Dis 2013; 32: 345-352.

16. Liao IC, Chen HM, Wu JJ, Tsai PF, Wang LR, Yan JJ. Metallo-ß-lac-tamase-producing Enterobacteriaceae isolates at a Taiwanese hospital: lack of distinctive phenotypes for screening. APMIS 2011; 119: 543-550.

17. Gijon D, Curiao T, Baquero F, Coque TM, Canton R. Fecal carriage of carbapenemase-producing Enterobacteriaceae: a hidden reservoir in

hospitalized and nonhospitalized patients. J Clin Microbiol 2012; 50: 1558-1563.

18. Gaibani P, Ambretti S, Farruggia P et al. Outbreak of Citrobacter freundii carrying VIM-1 in an Italian Hospital, identified during the carbapen-emases screening actions, June 2012. Int J Infect Dis 2013; 17: e7l4-e7l7.