CC BY-NC-ND
0Annals of Agricultural Science (2016) xxx(xx), xxx-xxx
HOSTED BY
Faculty of Agriculture, Ain Shams University Annals of Agricultural Science
www.elsevier.com/locate/aoas
Screening of isolated potential probiotic lactic acid bacteria for cholesterol lowering property and bile salt hydrolase activity
M.G. Shehata a*, S.A. El Sohaimya, Malak A. El-Sahnb, M.M. Youssefb
a Food Technology Department, Arid Lands Cultivation Research Institute, City of Scientific Research and Technological Application, Alexandria, Egypt
bFood Science and Technology Dept., Fac. of Agric., Alexandria Univ., 21545 El-Shatby, Alexandria, Egypt Received 27 January 2016; accepted 6 March 2016
KEYWORDS
Probiotics; Lactic acid bacteria; Antimicrobial activity; Bile tolerance; Acid tolerance; Cholesterol removal; Bile salt hydrolase
Abstract A total of 142 isolates of lactic acid bacteria (LAB) were isolated from dairy and non-dairy sources. The LAB isolates were screened for antimicrobial activity. Out of 142 isolates only 68 isolates exhibited antimicrobial activity. Among these isolates, nine showed wide spectrum antimicrobial activity as well as good bile salt, acid and phenol tolerance. Seven isolates of the latter ones showed more than 20% cholesterol reduction and an observed bile salt hydrolase (BSH) activity. The promising isolates were identified using phenotypic, biochemical and genetic methods.
© 2016 Production and hosting by Elsevier B.V. on behalf of Faculty of Agriculture, Ain Shams
University.
Introduction
In recent years, different investigations support the importance of probiotics as apart of healthy diet for humans and animals and as a way to provide a natural, safe and effective barrier against microbial infections (Angmo et al., 2016; Oh and Jung, 2015). According to the definition by the World Health Organization (WHO), probiotics are ''live microbial food supplements which, when administered in adequate amounts confer a health benefit on the host" (FAO/WHO, 2001). Among the usually used microorganisms, lactic acid bacteria (LAB) are regarded as a major group of probiotic bacteria (Collins
* Corresponding author. Tel.: +20 34593420; fax: +20 34593423. E-mail address: gamalsng@gmail.com (M.G. Shehata). Peer review under responsibility of Faculty of Agriculture, Ain-Shams University.
and Gibson, 1999). They are non-pathogenic, technologically suitable for industrial processes, acid tolerance, bile tolerance and produce antimicrobial substances (Mojgani et al., 2015). They are classified as generally recognized as safe (GRAS) microorganisms because of their long and safe use as starter cultures in fermented products.
Nowadays, most probiotic bacteria are belonging to the genera Lactobacillus and Bifidobacterium (Prasad et al., 1998). However, species belonging to the genera Lactococcus, Enterococcus and Saccharomyces (Salminen and von Wright, 1998; Sanders and in't Veld, 1999) are also considered as pro-biotic microorganisms.
According to the guidelines for the evaluation of probiotics in food reported by a Joint FAO/WHO working group (Vijaya et al., 2015), two of the currently most widely used in vitro tests are resistance to gastric acidity and bile salts, as based on both survival and growth studies. Other functional properties used
http://dx.doi.org/10.1016/j.aoas.2016.03.001
0570-1783 © 2016 Production and hosting by Elsevier B.V. on behalf of Faculty of Agriculture, Ain Shams University.
to characterize probiotics are the production of antimicrobial compounds and cholesterol removal (Park et al., 2007; Xie et al., 2015). The mechanism through which probiotics may antagonize pathogens involves production of antimicrobial compounds such as lactic acid, acetic acid, hydrogen peroxide and bacteriocins.
Certain studies showed that among the other effects of pro-biotic include, consumption of lactic acid bacteria reduced carriage of pathogens microorganism, decreased certain risk factors for coronary artery disease, and resulted in a dose-dependent reduction in the symptoms of Irritable bowel syndrome (Vries et al., 2006). It seems that, in the research for strains with probiotic potential, food might also be a good source of suitable isolates for finding new probiotic strains for functional food products. Several probiotics bacteria are found to produce bile salt hydrolase (BSH) that helps to reduce serum cholesterol (Miremadi et al., 2014) and hence BSH activity is also considered as an additional criterion for the selection of probiotics. The aim of the present study was to isolate, identify and screen for potential probiotic lactic acid bacteria with high cholesterol capacity and bile salt hydrolase activity.
Materials and methods
Collection of samples
Samples were collected from the normal habitats of lactic acid bacteria (LAB) such as raw animal milk, fermented foods (Boza, Zabady, Rayeb), cheese (Ras, Kareish), calves infant faeces and intestinal of marine fish (Table 1). Samples were transported to the laboratory in ice box and stored at ffi 4 0C.
Isolation of lactic acid bacteria
Milk samples were incubated at 30 0C; 37 0C; 42 0C, while samples of cheese, Zabady and Rayeb were cultured in sterilized reconstituted skim milk and incubated until coagulation. Coagulated samples were then streaked on over agar surface of MRS medium (De Man et al., 1960) and were incubated anaerobically at 30 0C, 37 0C or 42 0C for 48 h. Boza, calves infant faeces and intestine of marine fish samples, were diluted serially from 10—1 to 10—7' then 0.1 ml aliquot of the higher dilutions (10—4 to 10—7) were spread on to MRS plates and incubated at 30, 37 and 42 0C for 48 h.
White and creamy colonies were picked up randomly and purified by three successive transfers on MRS medium. The cultures were routinely checked for purity by microscopic examination.
The pure cultures were characterized using Gram stain, cell morphology and catalase reaction according to standard procedures (Sharpe, 1979). Gram-positive and catalase-negative isolates were selected and stored at —80 0C in MRS broth plus 28% glycerol (El-Soda et al., 2003). The purified cultures were activated by subculturing twice in MRS broth before use.
Antimicrobial activity assays
Screening of LAB isolates for antimicrobial activity
The Antimicrobial activity spectrums of cells free supernatants of (LAB) isolates were determined against ten pathogens (Table 2) using spot-on-lawn method (Barefoot and Klenhammer, 1983). LAB isolates were cultivated in MRS for 16-18 h with 1% inoculum then cells were removed from MRS medium by centrifugation (6500g for 10min, 4 0C) to obtain cell free supernatant. Lawns of pathogenic strains were prepared by adding 0.125 ml (2 x 107 cell/ml) of 10x diluted overnight culture to 5 ml of corresponding soft agar (Table 2). The contents of the tubes were gently mixed and poured over the surfaces of pre-poured MRS agar plates. Ten microliter of each cell free supernatant was spotted onto the surface of the soft agar plate and after 24 h of incubation, the plates were
Table 1 Isolation sources of lactic acid bacteria.
Isolation Number of Number Location
Sources examined of
samples isolates
Boza (BO) 2 43 Manfalut City, Assiut
Governorate, Egypt
Tanta city, Gharbia
Governorate, Egypt
Calves 2 10 Private farm,
infants Damanhour city,
faeces (F) Beheira Governorate,
karish cheese 3 20 Alexanderia, local
(k) markets
Milk (M) 2 10 Alexanderia, local
markets
Ras cheese 3 15 Alexanderia, local
(R) markets
Rayeb Milk 2 19 Alexanderia, local
(RM) markets
The 2 0 Alexanderia, local
intestines of markets
marine fish
Zabady (Z) 4 25 Alexanderia, local
markets
Total 20 142
Table 2 Indicator strains and their growth conditions.
Pathogenic microorganisms
Medium and growth temperature
Bacillus subtilis DB 100 host Candida albicans ATCC MYA-2876 Clostridium botulinum ATCC 3584 Escherichia coli BA 12296 isolated by dr sobhy
Klebsiella pneumoniae ATCC12296 Salmonella senftenberg ATCC 8400 Staphylococcus aureus NCTC 10788 Staphylococcus epidermidis Streptococcus dysgalactiae subsp. Equisimilis
Streptococcus pyogenes
Nutrient Broth, 37 0C YPDa Broth, 37 0C TPGYb Broth, 37 0C LBc Broth, 37 0C
LBc Broth, 37 0C Nutrient Broth, 37 0C Nutrient Broth, 37 0C Nutrient Broth, 37 0C Nutrient Broth, 37 0C
Nutrient Broth, 37 0C
a YPD broth: Yeast peptone dextrose. b TPGY broth: tryptone-peptone-glucose-yeast extract. c LB broth: Luria-Bertani medium.
checked for the appearance of an inhibition zone. Clear zones around the spots indicate the antimicrobial activity of isolated bacteria.
Quantification of antimicrobial activity
Antimicrobial activity in the supernatant was determined by an adaptation of the critical two fold dilution method (Parente et al., 1994). Each tested isolate was subcultured in MRS for 24 h, counted and adjusted to give 109 cell/ml. The culture was used to inoculate (1%) fresh MRS and propagated for 24 h. Supernatant was obtained by centrifugation (9000g for 15 min). Serial two-fold dilutions of supernatant were carried out in MRS. Activity was quantified by taking the reciprocal of the highest dilution that exhibited a clear zone of inhibition and was expressed as activity units (AU) per millilitre of culture media. The titre of the antibacterial substance, in AU/ml, was calculated as (1000/d) D, where D is the dilution factor and d is the amount of supernatant in il (Parente et al., 1994).
Acid tolerance
Isolates of LAB were propagated twice in MRS broth (1% v/v) for 20 h at 37 0C before experimental use. The cells from 100 ml MRS culture were harvested by centrifugation (4300g, 10 min), and washed three times in phosphate-buffered saline, pH 7.0. Washed cell pellets were then suspended in (1/10) cultivation volume in the same buffer, hence obtaining a 10-fold increase in cell density. To 1 ml of the washed cell suspension, 5 ml of simulated gastric juice and 1.5 ml NaCl (0.5 w/v) were added. Simulated gastric juice was prepared freshly daily by suspending pepsin (3 g/L) in sterile saline (0.5% w/v) and adjusting the pH to 2.0 with concentrated HCl (Charteris et al., 1998). The materials were vortexed for 10 s and incubated at 37 0C for 3 h. Aliquots of 0.1 ml were then removed at constant intervals (0, 1, 2, 3 h) for determination of total viable count. Dilutions were made (up to 10~4) and cells were plated in duplicate on MRS agar. Plates were incubated at 37 0C for 72 h before enumeration (Charteris et al., 1998).
Bile tolerance
Bile containing MRS broth was prepared by the addition of 0.3 (v/v) of bile salt (Bio Basic Canada INC.). The cells from 100 ml (20 h MRS tested culture) were collected by centrifugation (3400g, 10 min), washed twice in saline (8.5 g NaCl/L) and resuspended in 10 ml MRS broth. This suspension was inoculated (1%) into MRS broth lacking or containing bile salt. After 0, 1, 2 and 3 h of incubation at 37 0C, viable counts on MRS agar plates and absorbance of the culture at 625 nm were determined (Matijasic and Rogelj, 2000). Experiments of acid and bile tolerance were repeated three times each with duplicate analysis.
Phenol tolerance
Phenol tolerance experiments were performed as described by Aswathy et al. (2008) with slight modifications. The overnight
cultures of LAB isolates were inoculated (1%) into MRS broth with (0.2 and 0.5% v/v) or without phenol. Bacterial cells in the culture broth were measured by reading the absorbance (A) at 600 nm after 24 h of incubation at 37 0C. The experiments were repeated twice in duplicate.
Cholesterol assimilation
Freshly prepared MRS broth, supplemented with 0.3% oxgall (Bio Basic Canada INC.) as bile salt and filter sterilized water soluble cholesterol (100 ig/ml), was inoculated with each isolate at 1% level and incubated anaerobically at 37 0C for 24 h. After incubation period, cells were removed by centrifu-gation (9000g for 15 min) and the remaining cholesterol in the spent broth was determined calorimetrically using o-phthalaldehyde method described by Rudel and Morris (1973). One millilitre of the cell- free broth was added to 1 mL of KOH (33% wt/vol) and 2 mL of absolute ethanol, vortexed for 1 min, followed by heating at 37 0C for 15 min. After cooling, 2 mL of distilled water and 3 mL of hexane were added and vortexed for 1 min. One millilitre of the hexane layer was transferred into a glass tube and evaporated in water bath at 65 0C. The residue was immediately dissolved in 2 mL of o-phthalaldehyde reagent. After complete mixing, 0.5 mL concentrated sulphuric acid was added and the mixture was vortexed for 1 min. Absorbance was read at 550 nm (T80 UV/Vis spectrometer PG Instruments LDT, United Kingdom) after 10 min. All experiments were replicated twice.
Screening of probiotic LAB for bile salts hydrolases activity (BSH)
Qualitative determination of bile salts hydrolases activity
The BSH activity was determined as described by Du Toit et al. (2003). The LAB isolates were grown on MRS agar plates containing 0.5% (w/v) taurodeoxycholic acid sodium salt (TDCA; Sigma, USA) and 0.037% calcium chloride. Plates were incubated under anaerobic conditions at 37 0C for 72 h. The precipitation zone surrounding colonies indicated the bile salt hydrolase activity of bacteria.
Quantitative determination of bile salts hydrolases activity The BSH activity was determined by measuring the amount of amino acid liberated from conjugated bile salts, by the probi-otic isolates as described by Tanaka et al. (2000) with several modifications. Briefly, from cultures grown for 20 h at 37 0C, cells were harvested by centrifugation at 9700g for 15 min, washed twice with 0.1 M sodium phosphate buffer containing 10 mM dithiothreitol (DTT), pH 6.8 and re-suspended in the same buffer to obtain a suspension with an optical absorbance (A600 nm) of 3.0. Cell suspension was sonicated for 60 s. with cooling on ice with two cycles of 16 mm using a sonicator (Sonics and Materials Inc., Vibro cell), followed by centrifuga-tion at 9700g for 15 min. The reaction mixture consisted of 180 mL of 0.1 M sodium phosphate buffer, pH 6.0, 10 mL of a 200 mM appropriate conjugated bile salt, 10 mM DTT and 10 mL of cell-free extract. The reaction mixture was incubated at 37 0C for 30 min., then a sample (100 iL) was taken and 200 iL of 15% (w/v) trichloroacetic acid was added to terminate the reaction. The sample was centrifuged (9700g for 15 min) and 200 iL of the supernatant was added to 200 iL
of distilled water and 1.9 mL of ninhydrin reagent (5 mg nin-hydrin, 1.2 mL glycerol, and 0.7 mL 0.5 M pH 5.5 sodium citrate buffer). The mixture was vortexed and boiled for 14min. After subsequent cooling, the absorbance at 570 nm was determined using glycine or taurine as standard. One unit of BSH activity (U/ml) was defined as the amount of enzyme that liberated 1 mmol of amino acid from the substrate per min. Protein concentration was determined by the Lowry method (Lowry et al., 1951), with bovine serum albumin (Sigma) as standard. All experiments were repeated twice.
Identification of the promising LAB isolates
Phenotypic characterization
The promising LAB isolates were phenotyped as described in Bergey's manual of systematic bacteriology (Logan and De Vos, 2009). The following tests were applied: cell morphology; growth at 15, 37 and 45 0C; and growth in MRS containing 2.5%, 4% and 6.5% NaCl. Fermentation patterns were determined using API 50 CHL and API 20 kits (Biomerieux SA, France) according to the manufacturer's instructions.
Molecular identification
Extraction of bacterial DNA. The DNA extraction and purification from bacterial isolates were carried out according to the procedure described by Cheng and Jiang, 2006. Overnight bacterial cultures were centrifuged individually at 15,000g for 10min. Pellets were washed with 400 il SET buffer (75 mM NaCl, 25 mM EDTA, 20 mM Tris, pH 7.5), then centrifuged at 10,000g for 10 min. The pellets were resuspended in TE buffer (Tris-EDTA buffer, pH 8.0), 100 il tris-saturated phenol (pH 8.0) was added and the suspensions were centrifuged at 10,000g for 10 min at 4 0C. Mixtures composed each of 160 il of the obtained aqueous phase, 40 il TE buffer and 100 il chloroform were centrifuged at 10,000g for 10 min. The resulting supernatant (100 il) was mixed with 40 il TE buffer and 5 il RNase (10 mg/ml) and incubated at 37 0C for 10 min. Then 100 il chloroform was added and the mixture was centrifuged at 15,000g for 10 min at 4 0C. The purity as well as the yield of DNA in the aqueous phase was assessed spectrophotometrically.
Polymerase chain reaction amplification. Universal primers identifying LAB, designed using the invariant region in the 16 s rDNA sequences for LAB (Wang et al., 1996), were obtained from Sigma Scientific Services Co., Germany. The reaction mixture (20 il) consisted of 5 il colourless GoTaq® reaction Buffer (5x), 0.25 il GoTaq® DNA Polymerase (5 u/il) (Promega, USA), 2.5 il PCR nucleotide Mix (10 mM), 1 il of each primer 5/CGTGCCAGCCGCGGTAA-TACG 3/and 5/GGGTTGCGCTCGTTGCGGGACT TAACCCAACAT 3/) as forward and reverse primers, respectively, 2 il genomic DNA and 8.25 il of nuclease-free water.
The PCR amplification was carried out in the thermo cycler PCR (Santa Clara, California, United States) according to the following programme: initial denaturation at 95 0C for 5 min, amplification for 30 cycles [95 0C/40 s (denaturation), 55 0C/40 s (annealing), 72 0C/1 min (extension)], then final extension at 72 0C for 10 min. The products were separated on 1% agarose gel containing ethidium bromide (1 ig/ml), then image was taken using gel documentation system
(Syngene Bio Maging, Canada). The DNA marker 1001500 bp (TAKARA BIO INC., Shiga, Japan) was used as the molecular weight standard.
Sequencing of DNA. The DNA sequencing reactions were performed using an automated DNA sequencer. Database searches were performed using the latest release of nonredundant DNA sequence database present at the National Centre for Biotechnology Information (NCBI) website located at: http://www.ncbi.nlm.nih.gov/BLAST (Altschul et al., 1997).
Statistical analysis
Data were statistically analysed with CoStat software (version 6.303). One-way analysis of variance was used to study significant difference between means, with significance level at P = 0.05.
Results and discussions
Screening of LAB isolates for their antimicrobial activity
One hundred and forty-two LAB were isolated from various sources (Table 1). All isolated bacteria fit the classification of LAB as Gram-positive, catalase negative (Sharpe, 1979). The antimicrobial activity is one of the most important selection criteria for probiotic. The LAB isolates were screened for production of antimicrobial agents against 10 pathogens (Table 2).
Out of 142 LAB isolates only 68 isolates exhibited antagonistic activity with varying degrees. Out of sixty LAB strains isolated from zabady and cheese samples, only thirty-eight strains showed inhibitory activity against the tested pathogens. No antagonistic activity could be observed for LAB strains isolated from milk and calves infant faeces. The LAB strains that showed inhibitory activity against more than six of the tested pathogens were isolated from Boza and Rayeb milk samples. On the other hand, LAB isolates obtained from zabady, Ras cheese and Karish exhibited antagonistic activity only against three or less of the tested pathogens. Indicator pathogens can be organized in descending order according to their sensitivity to the tested isolates as follows: Escherichia coli BA 12296 was sensitive to 41 isolates while Staphylococcus epi-dermidis, Salmonella senftenberg ATCC 8400, Staphylococcus aureus NCTC 10788, Streptococcus pyogenes, Klebsiella pneumoniae ATCC12296, Candida albicans ATCC MYA-2876, Streptococcus dysgalactiae subsp. equisimilis, and Bacillus sub-tilis DB 100 were sensitive to 28,29,23,19,15,14,10,2 of LAB isolates, respectively.
All isolates with antimicrobial activity against any of the tested pathogens (68 isolates) were selected for quantitative determination of their antimicrobial activities (Table 3). Among 68 isolates, only 9 isolates showed wide spectrum activity against four tested pathogens at least.
Among the nine isolates of LAB, only one isolate (RM39) showed strong activity of 1600 AU/ml against Klebsiella pneumoniae ATCC12296 while, four isolates exhibited inhibitory activity of 800 AU/ml against each of Escherichia coli (BO51); Streptococcus pyogenes (RM28); Staphylococcus aureus NCTC 10788 (BO3, RM3), Salmonella senftenberg ATCC
Table 3 Antimicrobial activities of cell-free supernatants of 68 selected LAB isolates against various pathogens.a
Isolate no Sym
Sources Incubation T (C) Antimicrobial activity against pathogens expressed in AU/mlc
Bac Cand. Clo. E. coli Kleb. Sal. St.au. St.epi St.Py. St.
1. dBO3 BOb 30 0 0 0 400 0 400 800 200 200 400
2. BO4 BO 30 0 0 0 200 0 200 0 0 0 0
3. BO5 BO 30 0 0 0 200 0 0 0 200 0 0
4. BO6 BO 30 0 0 0 200 0 0 0 0 0 0
5. BO7 BO 30 0 0 0 400 800 200 0 0 0 0
6. BO8 BO 30 0 0 0 200 0 200 0 200 0 0
7. BO12 BO 30 0 0 0 200 0 200 0 200 0 0
8. BO22 BO 37 0 0 0 200 0 200 0 200 0 0
9. BO24 BO 37 0 0 0 200 0 200 0 200 0 0
10. BO27 BO 37 0 0 0 200 0 200 0 200 0 0
11. BO29 BO 37 0 0 0 200 0 200 0 200 0 0
12. BO30 BO 37 0 0 0 200 0 200 0 200 0 0
13. BO31 BO 37 0 0 0 200 0 200 0 200 0 0
14 BO33 BO 37 0 0 0 200 400 400 0 0 0 0
15. bBO34 BO 37 200 0 0 800 800 400 0 0 0 0
16. dBO35 BO 37 0 0 0 800 200 800 200 200 0 200
17. BO36 BO 37 0 0 0 400 0 0 200 400 0 0
18. dBO37 BO 37 800 0 0 400 0 200 200 800 400 400
19. BO42 BO 42 0 0 0 400 200 0 0 400 0 0
20. BO44 BO 42 0 0 0 0 200 400 0 0 400 0
21. BO45 BO 42 0 0 0 200 0 200 200 0 0 0
22. BO46 BO 42 0 0 0 200 0 200 200 0 0 0
23. BO50 BO 42 0 0 0 0 0 200 200 0 200 0
24. dBO51 BO 42 0 400 0 800 200 200 200 400 200 400
25. dBO52 BO 42 0 0 0 400 400 0 0 400 0 400
26. Z1 Zb 30 0 0 200 0 0 0 200 0 200 0
27. Z2 Z 30 0 0 200 0 0 0 200 0 200 0
28. Z3 Z 30 0 0 0 0 200 0 0 200 200 0
29. Z4 Z 30 0 0 0 200 0 0 200 0 200 0
30. Z5 Z 30 0 0 0 0 0 0 0 0 200 0
31. Z8 Z 30 0 0 0 0 200 0 0 0 200 0
32. Z9 Z 30 0 0 0 0 200 0 0 0 0 200
33. Z22 Z 37 0 200 0 400 0 0 0 0 0 0
34. Z23 Z 37 0 0 0 0 200 200 0 0 0 200
35. Z25 Z 37 0 0 0 0 0 400 400 0 0 0
36. Z27 Z 37 0 0 0 200 0 0 200 0 0 0
37. Z28 Z 37 0 0 0 0 200 0 200 400 0 0
38. Z39 Z 37 0 200 0 0 0 0 200 400 0 0
39. Z41 Z 42 0 0 0 0 0 200 200 200 0 0
40. Z42 Z 42 0 0 0 200 0 0 200 200 0 0
41. R20 Rb 37 0 0 0 200 0 0 0 200 0 0
42. R22 R 37 0 0 0 200 0 0 200 0 0 0
43. R24 R 37 0 0 0 200 0 0 200 0 0 0
44. R25 R 37 0 0 0 0 200 200 0 400 0 0
45. R26 R 37 0 0 0 0 0 200 0 0 200 0
46. R27 R 37 0 200 0 0 0 0 200 0 0 0
47. R28 R 37 0 200 0 0 0 0 0 0 0 0
48. R34 R 37 0 0 0 0 0 0 200 200 0 0
49. K1 Kb 30 0 0 0 200 0 0 200 0 0 0
50. K2 K 30 0 0 0 0 0 0 0 0 400 0
51. K4 K 30 0 0 0 0 0 0 200 200 0 0
52. K5 K 30 0 200 0 0 0 0 200 0 400 0
53. K6 K 30 0 0 0 200 0 0 0 0 200 0
54. K7 K 30 0 0 0 0 0 200 0 0 200 0
55. K8 K 30 0 0 0 200 0 0 0 0 0 0
56. K9 K 30 0 200 0 0 0 0 400 0 0 0
57. K23 K 37 0 200 0 200 0 0 0 0 200 0
58. K24 K 37 0 0 0 0 0 0 0 0 0 200
59. K26 K 37 0 200 0 0 0 0 0 0 200 0
60. K27 K 37 0 200 0 200 0 0 0 0 0 0
61. K40 K 42 0 0 0 200 0 0 0 0 0 0
(continued on next page)
Table 3 (continued)
Isolate no Sym Sources Incubation T (C) Antimicrobial activity against pathogens expressed in AU/mlc
Bac Cand. Clo. E. coli Kleb. Sal. St.au. St.epi St.Py. St. dy.
62. K42 K 42 0 200 0 200 0 0 0 0 200 0
63. K43 K 42 0 200 0 0 0 0 0 0 200 0
64. RM1 RMb 30 0 0 0 200 200 200 0 0 0 0
65. dRM3 RM 30 0 1600 0 400 200 0 800 200 200 800
66. RM26 RM 30 0 0 0 0 200 0 0 200 200 0
67. dRM28 RM 30 0 0 0 400 200 800 200 400 800 0
68. dRM39 RM 30 0 200 0 400 1600 400 200 400 0 400
a Bac.: - Bacillus Subtilis; Cand.: - Candida albicans; Clo.: - Clostridium botulinum; E. coli: - Escherichia coli; Kleb.: - Klebsiella pneumoniae; Sal.: - Salmonella Senftenberg; St.au.: - Staphylococcus aureus; St.epi.: - Staphylococcus Epidermidis; Str. pyo.: - Streptococcus pyogenes; St. dy.: - Streptococcus dysgalactiae subsp. Equisimilis. b Sources of isolation: BO: Boza; Z: Zabady; R: Ras cheese; K: karish cheese; RM: Rayeb Milk.
c Activity units/ml cell-free supernatant was calculated according to the following equation: (1000/d) x D 'Where D is the two-fold dilution factor, d is the amount of supernatant used. d Isolates had antimicrobial activity against 4 or more pathogenic microorganisms.
Table 4 Survival of selected lactic acid bacteria isolates under simulated gastric juice conditions at 37 °C.
Isolates code Mean of viable count (log10 CFU ml-1) ± SD Surviving percentage (%)
Time of exposure (h)
0 1 2 3
Bo 3 8.29 ± 0.41a 7.80 ± 0.14bcd 7.04 ± 0.20cd 6.32 ± 0.25d 76.2
Bo 34 8.31 ± 0.29a 7.91 ± 0.03bc 7.21 ± 0.16bc 6.37 ± 0.08d 76.6
Bo 35 8.17 ± 0.317a 7.60 ± 0.23cde 7.36 ± 0.27bc 7.22 ± 0.28ab 88.3
Bo 37 8.55 ± 0.22a 7.86 ± 0.04bcd 7.51 ± 0.14ab 7.33 ± 0.13a 85.7
Bo 51 8.37 ± 0.25a 7.55 ± 0.07de 7.13 ± 0.10cd 6.45 ± 0.38cd 77
Bo 52 8.37 ± 0.44a 8.33 ± 0.45a 7.57 ± 0.17ab 6.59 ± 0.24cd 78.7
RM 3 8.35 ± 0.34a 7.28 ± 0.17e 6.81 ± 0.19de 6.81 ± 0.19bc 81.5
RM 28 8.41 ± 0.44a 7.58 ± 0.13cde 6.60 ± 0.41e 5.72 ± 0.27e 68
RM 39 8.37 ± 0.28a 8.03 ± 0.20ab 7.85 ± 0.09a 6.48 ± 0.30cd 77.4
abcdeMeans in the same column followed by different superscript letters are significantly different (P < 0.05).
BO: - Boza & RM: - Rayeb Milk.
Results are expressed as mean ± SD, and each value is the average of three experiments and each was carried out in duplicate.
8400 (RM28). Growth of pathogens is inhibited by the production of antimicrobial compounds such as organic acids, hydrogen peroxide, diacetyl and bacteriocins by LAB as well as their competition for nutrients (Bezkorvainy, 2001; Tambekar et al., 2009).The nine promising LAB isolates were examined for further probiotic criteria such as bile, acid and phenol tolerance as well as their cholesterol removal capacities.
Tolerance to acid and bile
As probiotics are usually administrated orally, they must have the ability to survive passage through the stomach and small intestine. Therefore, resistance to the low pH of the gastric juice in the stomach and the bile salt in the small intestine is one of the important selection criteria for probiotic (Olejnik et al., 2005). In the present study, all the selected LAB isolates were able to survive simulated gastric juice at pH 2 after 3 h of incubation (Table 4). They retained varying levels (68-88.3%) of viability. The highest survival was for BO35 isolate while the least survival was observed for RM28 isolate.
Acid tolerance of bacteria is important not only for withstanding gastric stresses, but also a prerequisite for their use
as dietary adjuncts and enables strains to survive for longer period of time in high acid carrier food without larger reduction in humans (Conway et al., 1987; Prasad et al., 1998).
Tolerance to bile salts is a prerequisite for colonization and metabolic activity of bacteria in small intestine of the host (Havenaar et al., 1992). This will help Lactobacillus spp. and Lactococcus spp. to reach the small intestine and colon and contribute in balancing the intestinal microflora (Tambekar and Bhutada, 2010). All the tested strains exhibited bile tolerance with varying degrees. Among the tested LAB isolated in the present study, BO34 isolate demonstrated the highest bile salt tolerance followed by BO52 isolate (Table 5).
Phenol tolerance
For a strain to be a probiotic, it has to survive the action of toxic metabolites, primarily phenols, produced during the digestion process (Hoier, 1992). Some aromatic amino acids derived from dietary or endogenously produced proteins can be deaminated in the gut by bacteria leading to the formation of phenols which have bacteriostatic properties (Suskovic et al., 1997).
Table 5 Survival of selected lactic acid bacteria isolates in MRS broth supplemented with 0.3% bile salts after 0, 1, 2 and 3 h at 37 °C. Isolates code Mean of viable count (log10 CFU ml-1) ± SD Surviving percentage (%)
Time of exposure (h)
0 1 2 3
Bo 34 8.05 ± 0.05a 7.63 ± 0.26ab 7.04 ± 0.21a 6.85 ± 0.10ab 85
Bo 35 7.98 ± 0.43a 6.77 ± 0.41d 6.54 ± 0.21c 5.69 ± 0.32d 71.3
Bo 51 8.25 ± 0.20a 6.81 ± 0.41cd 6.45 ± 0.42c 5.82 ± 0.45cd 69.8
Bo 52 8.41 ± 0.32a 7.98 ± 0.29a 7.24 ± 0.22a 6.85 ± 0.14a 81.4
Bo 37 8.36 ± 0.44a 8 ± 0.12a 7.39 ± 0.1a 6.57 ± 0.22ab 78.5
Bo 3 8.39 ± 0.39a 7.98 ± 0.33a 6.58 ± 0.40bc 6.35 ± 0.33abc 75.6
RM 39 8.2 ± 0.16a 7.36 ± 0.21bc 6.55 ± 0.06c 6.20 ± 0.65bcd 75.6
RM 28 8.19 ± 0.28a 7.51 ± 0.07ab 7.29 ± 0.06a 6.49 ± 0.40ab 79.2
RM 3 8.51 ± 0.46a 7.45 ± 0.54ab 6.99 ± 0.26ab 6.66 ± 0.17abc 78.2
abcde Means in the same column followed by different superscript letters are significantly different (P < 0.05). BO: - Boza & RM: - Rayeb Milk.
Results are expressed as mean ± SD, each value is the average of three experiments and each was carried out in duplicate.
Fig. 1 illustrates the effect of two different phenol concentrations (0.2% and 0.5%) on the growth of nine LAB isolates after 24 h of incubation in MRS medium at 37 °C. The examined LAB isolates showed different degrees of sensitivity towards different concentrations of phenol. The highest tolerance (95.89%) to 0.2% phenol concentration was demonstrated for BO37 followed by RM39 (94.1%), while, BO52 had the lowest tolerance. At 0.5 phenol concentration, all the tested LAB isolates exhibited varying relative growth percentage ranged between 15.1% and 21.7%. Vizoso Pinto et al. (2006) observed varying degrees of sensitivity for four strains of Lactobacillus johnsonii and six strains of L. plantarum towards 0.4% phenol concentration while L. plantarum strains were less sensitive.
Cholesterol removal by LAB isolates
Hypercholesterolemia (elevated blood cholesterol level) is considered a major risk factor for the development of coronary heart disease. Therefore, lowering the serum cholesterol level is important to prevent the disease. The cholesterol - removing
ability of LAB isolates was assessed in vitro in the presence of oxgall after 24 h of anaerobic growth at 37 °C (Fig. 2). All the nine LAB isolates showed the ability to remove cholesterol from the media. They exhibited varying degrees of cholesterol lowering ability ranged from 8.4% to 43.5%. The BO37 isolate manifested superior ability (43.75%) to remove cholesterol from the medium which was significantly higher than those of the other examined LAB isolates. The lowest value of cholesterol assimilation was traced in BO35 isolate. The ability of in vitro cholesterol level reduction in model culture media has been shown for numerous strains of LAB (Pereira and Gibson, 2002; Lavanya, 2001; Wang et al., 2012; Miremadi et al., 2014). Further studies are required to determine the mechanism(s) involved in the removal of cholesterol by those probiotic LAB isolates.
Screening of LAB isolates for BSH activity
Qualitative determination of bile salts hydrolases activity
The ability of probiotic strains to detoxify bile salt by producing BSH enzyme activity has often been included among the
ro M 50
lat el 40
10.2% phenol 0.5% phenol
RM28 RM39 Bo3 Bo37 Bo34 Bo51 Bo52 Bo35 RM3 Isolates lactic acid bacteria
Fig. 1 Effect of phenol concentration on the growth of LAB isolates. BO: - Boza & RM: - Rayeb Milk.
50 45 ' 40 35 30
Bo 3 Bo 34 Bo 35 Bo 37 Bo 51 Bo 52 RM 3 RM 28 RM 39 LAB isolates
Fig. 2 Cholesterol removal by LAB isolates. BO: - Boza & RM: - Rayeb Milk.
Fig. 3 The BSH activity of LAB isolates grown on bile salt - MRS medium as manifested by the formation of precipitation zone around the colony. The code numbers 1-9 represent the LAB isolates as follows: 1: BO3; 2: BO34; 3: BO35; 4: BO37; 5: BO51; 6: BO52; 7: RM3; 8: RM28; 9: RM39. BO: - Boza & RM: - Rayeb Milk.
criteria for probiotic strain selection (Noriega et al., 2006). Bile salt hydrolase is an enzyme that catalyses the deconjugation of bile salt to liberate free primary bile acids (Gilliland and Speck, 1977).
When bile salt hydrolase producing LAB isolates were streaked on MRS plates containing TDCA, the taurine conjugated bile acid was deconjugated producing deoxycholic acid.
The deconjugation activity of LAB isolates was manifested in Fig. 3, and copious amounts of deoxycholic acid precipitated around active colonies and diffused into the surrounding medium.
Out of nine LAB isolates previously selected based on their high antimicrobial activity, eight isolates displayed BSH activity to different levels. Four isolates (BO35, BO37, BO52,
RM39) exhibited high BSH activity by providing large precipitation zones (2.03, 2.45, 2.25, and 1.98 mm, respectively) around colonies on plate assay. Notwithstanding, the other four isolates demonstrated low BSH activity by expressing small (less than 1.5 mm) precipitation zones.
The presence of bile salt hydrolase (BSH) in probiotics renders them more tolerant to bile salts, which also helps to reduce the blood cholesterol level of the host (Noriega et al., 2006).
Contrary to the results of the present study, Begley et al. (2006) reported that BSH activity has not been detected in bacteria isolated from environments from which bile salts are absent. It is worthy to mention that all the eight BSH-positive LAB isolates are not associated with gastrointestinal environment.
Quantitative determination of bile salts hydrolases activity The highest total BSH activity (3.09 u/ml) towards tauro-cholate was displayed by RM39 LAB isolate compared with other LAB isolates Table 6. In contrast, the lowest total BSH activity (0.25 u/ml) was demonstrated for RM3 isolate. Specific activity of BSH did not correlate well with total BSH activity by most LAB isolates due to varying protein content in cell extracts. The RM39 and RM3 isolates had high (3.09 u/ml) and low (0.25 u/ml) total BSH activity, respectively and exhibited the same trend as well with respect to the specific activity. Meanwhile, BO37 isolate that had high total BSH activity (2.47 u/ml) displayed low specific activity (0.85 u/ mg). Similar results were reported by Liong and Shah (2005) for lactobacillus strains towards different bile salts. Several studies have indicated that the mechanism for in vitro removal of cholesterol is linked to the bile salt hydrolase activity of probiotic strains (Kimoto et al., 2002; Liong and Shah, 2005). Moreover, the decomposition of bile salts by BSH enzyme would disrupt the formation of the cholesterol micelle which in turn prevents cholesterol absorption (Klaver and Van der Meer, 1993).
From the genetic data, it was obvious that BSH is an intra-cellular enzyme. This is consistent with the observation that no
enzyme activity was present in the supernatants of overnight cultures, while activity was released either by sonication or other cell disruption methods or by lysis in assays performed with whole cells due to the lytic properties of the bile salts (Lunden and Savage, 1990; Grill et al., 1995; Tanaka et al., 2000).
Identification of promising LAB isolates Phenotypic characterization
The seven promising isolated strains (BO3, BO34, BO37, BO51, BO52, RM28, RM39) are Gram positive, catalase negative, non-spore forming and fermenting glucose. All the isolates are rod shaped except RM39 and BO37 that are spherical cells. The physiological and biochemical characteristics of the selected LAB isolates Table 7 are similar to those described in Bergey's Manual of Determinative of Bacteriology (Logan and De Vos, 2009) for the genera Lactobacillus and Lactococcus. Further, biochemical characterization using API 50 CHL for Lactobacilli and API 20 for cocci showed the similarity in characteristics with the corresponding identified LAB species (Table 8). Bill et al. (1992) and Klinger et al. (1992) indicated that some commercial identification systems often yield good results regarding genus identification but they were not fully adequate at the species level.
Table 6 BSH activity of lactic acid bacteria isolates on sodium taurocholate.a
Isolates BSH activityb-c
Total protein Total activity Specific activity
(mg/ml) (U/ml) (U/mg)
Bo 34 1.22 ± 0.27b 1.64 ± 0.28d 1.34 ± 0.32a
Bo 35 2.62 ± 0.61a 2.31 ± 0.22bc 0.88 ± 0.25cd
Bo 37 2.89 ± 0.26a 2.47 ± 0.45b 0.85 ± 0.09d
Bo 51 1.08 ± 0.44b 0.67 ± 0.34e 0.62 ± 0.5e
Bo 52 2.14 ± 0.89a 1.95 ± 0.15cd 0.91 ± 0.52c
RM 3 0.42 ± 0.49b 0.25 ± 0.15ef 0.59 ± 1.19e
RM 28 2.54 ± 0.66a 2.25 ± 0.24bc 0.88 ± 0.16cd
RM 39 2.96 ± 0.11a 3.09 ± 0.27a 1.04 ± 0.13b
BO: - Boza & RM: - Rayeb Milk.
a Results are expressed as means ± standard deviation; values are means of triplicate.
b BSH activity from cell free extracts of lactic acid bacteria isolates grown on MRS broth supplemented with 6 mM sodium taurocholate.
c Means in the same column followed by different superscript letters are significantly different (P < 0.05).
Table 7 Physiological characteristics of lactic acid bacteria
isolates.
Characteristics LAB isolates
BO BO BO BO BO RM RM
3 34 37 51 52 28 39
Gram strain + + + + + + +
Catalase - - - - - - -
production
Glucose - - - - - - -
fermentation
Growth:
15 °C + - + + + - +
37 °C + + + + + + +
45 °C + + - + + + -
2% + + + + + + +
4% + + + + + + +
6.5% - - + + + - +
BO: - Boza & RM: - Rayeb Milk.
Table 8 Identification of LAB isolates by API 50 CHL and API 20 kits.
Isolates Species identified by API test
BO 3 Lactobacillus rhamnosus
BO 34 Lactobacillus delbrueckii subsp. bulgaricus
BO 37 Lactococcus lactic subsp. lactis
BO 51 Lactobacillus paracasei
BO 52 Lactobacillus paracasei
RM 28 Lactobacillus gasseri
RM 39 Lactococcus lactic subsp. lactis
BO: - Boza & RM: - Rayeb Milk.
m во37 rm2S boJ2 bo34 bo5i rm„ bo3
1000 900 800 700 600 500 400
300 200
Fig. 4 PCR products for lactic acid bacteria isolates (BO37; RM28; BO52; BO34; BO51; RM39 and BO3) in a 2% agarose gel. Lane 1 (DNA Ladder from 100 bp to 1500 bp), lanes 2-7 (isolates lactic acid bacteria). BO: - Boza & RM: - Rayeb Milk.
Molecular identification
Molecular methods are important for bacterial identification (Drancourt et al., 2000; Sghir et al., 2000; Greetham et al., 2002; Heilig et al., 2002) and possibly more accurate for LAB than the conventional phenotypic methods. In the present study, 16sr-DNA of the total genomic DNA from promising LAB isolates was amplified and sequenced for identification. Amplification using universal primer produced a PCR product of approximately 600 bp (Fig 4). The sequencing data of purified 16S r-DNA of isolates were employed for bacterial identification. The sequences of the selected isolates were aligned with the 16S r-DNA sequences from the GenBank database (website) to identify the studied microorganism. 16S r-DNA sequencing data of the selected isolates clearly showed (BO 3) 90% homology to Lactobacillus rham-nosus & (BO 34) 96% homology to Lactobacillus delbrueckii subsp. Bulgaricus & (BO 37) 99% homology to Lactococcus lactic subsp. lactis & (BO 51) 100% homology to Lactobacillus paracasei & (BO 52) 100% homology to Lactobacillus paraca-sei & (RM 28) 100% homology to Lactobacillus gasseri and (RM 39) 98% homology to Lactococcus lactic subsp. lactis.
Conclusion
In the present study, 142 LAB strains were isolated from different sources and only nine isolates were selected on the basis of their high antagonistic activity. The nine promising LAB isolates exhibited good resistance to gastrointestinal conditions (pH, 2; bile salt, 0.3%; phenol 0.2-0.5%), high cholesterol removal and expressed BSH activity. Among the promising LAB isolates, BO37 which isolated from Boza and identified as Lactococcus lactic subsp. lactis manifested the highest
cholesterol removal ability (43.7%) and good BSH activity (2.47 u/ml). Accordingly, owing to its good probiotic properties, this strain could be potentially used in functional food and health products especially where cholesterol reduction in food is the main target. Further in vivo study is necessary to prove the hypocholesterolemic effect of the isolated Lactococ-cus lactic subsp. lactis. Moreover in vitro studies are required to determine the mechanism(s) involved in the reduction of cholesterol by such a promising isolate.
References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25, 3389-3402. Angmo, K., Kumari, A., Bhalla, T.C., 2016. Probiotic characterization of lactic acid bacteria isolated from fermented foods and beverage of Ladakh. LWT - Food Sci. Technol. 66, 428-435. Aswathy, R.G., Ismail, B., John, P.J., Nampoothiri, K.M., 2008. Evaluation of the probiotic characteristics of newly isolated lactic acid Bacteria. Appl. Biochem. Biotechnol. 10, 8183-8186. Barefoot, S.F., Klenhammer, T.R., 1983. Detection and activity of lactacin B, a bacteriocin produced by Lactobacillus acidophilus. Appl. Environ. Microbiol. 45, 1808-1815. Begley, M., Hill, C., Gahan, C.G.M., 2006. Bile salt hydrolase activity
in probiotics. Appl. Environ. Microbiol. 72, 1729-1738. Bezkorvainy, A., 2001. Probiotics: determinants of survival and
growth in the gut. Am. J. Clin. Nutr. 73, 399-405. Bill, J., Catimel, B., Bannerman, E., Jacquet, C., Yersin, M.N., Caniaux, I., Monget, D., Rocourt, J., 1992. API Listeria: a new and promising one-day system to identify Listeria isolates. App. Environ. Microbiol. 58, 1857-1860. Charteris, W.P., Kelly, P.M., Morelli, L., Collins, J.K., 1998. Development and application of an in vitro methodology to determine the transit tolerance of potentially probiotic Lactobacil-lus and Bifidobacterium species in the upper human gastrointestinal tract. J. Appl. Microbiol. 84, 759-768. Cheng, H., Jiang, N., 2006. Extremely rapid extraction of DNA from
bacteria and yeasts. Biotechnol. Lett. 28, 55-59. Collins, M.D., Gibson, G.R., 1999. Probiotics, prebiotics and synbi-otics: approaches for modulating the microbial ecology of the gut. Am. J. Clin. Nutr. 69, 1052S-1057S. Conway, L.P., Gorbach, L.S., Goldin, R.B., 1987. Survival of lactic acid bacteria in the human stomach and adhesion to intestinal cells. J. Dairy Sci. 70, 1-12. De Man, J.C., Rogosa, M., Sharpe, M.E., 1960. Medium of
lactobacilli. J. Appl. Bacteriol. 23, 130-135. Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Grayral, J.P., Raoult, D., 2000. 16S Ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. J. Clin. Microbiol. 38, 3623-3630. Du Toit, M., Dicks, L.M.T., Holzapfe, W.H., 2003. Identification of heterofermentative lactobacilli isolated from pig faeces by numerical analysis of total soluble cell protein patterns and RAPD-PCR. Lett. Appl. Microbiol. 37, 12-16. EL-Soda, M., Ahmed, N., Omran, N., Osman, G., Morsi, A., 2003. Isolation, identification and selection of lactic acid bacterial cultures for cheese making. Emir. J. Food Agric. 15, 51-71. FAO/WHO, 2001. Report of a Joint FAO/WHO expert consultation on evaluation of health nutritional properties of probiotics in food including powder milk with live lactic acid bacteria. World Health Organization and Food and Agriculture Organization of the United Nations, London, Ontario, Canada. Gilliland, S.E., Speck, M.L., 1977. Deconjugation of bile acids by intestinal lactobacilli. Appl. Environ. Microbiol. 33, 15-18.
Greetham, H.L., Giffard, C., Hutson, R.A., Collins, M.D., Gibson, G. R., 2002. Bacteriology of the Labrador dog gut: a cultural and genotypic approach. J. Appl. Microbiol. 93, 640-646.
Grill, J.P., Schneider, F., Crociani, J., Ballongue, J., 1995. Purification and characterization of conjugated bile salt hydrolase from Bifidobacterium longum BB536. Appl. Environ. Microbiol. 61, 2577-2582.
Havenaar, R., Ten Brink, B., Huis in't Veld, J.H.J., 1992. Selection of strains for Probiotic use. In: Fuller, R. (Ed.), Probiotics. The Scientific Basis. Chapman and Hall, London, pp. 209-221.
Heilig, H.G.H.J., Zoetenda, lE.G., Vaughan, E.E., Marteau, P., Akkermans, A.D.L., De Vos, W.M., 2002. Molecular diversity of Lactobacillus ssp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA. App. Environ. Microbiol. 68, 114-123.
Hoier, E., 1992. Use of probiotic starter cultures in dairy products. In: The 25th Annual Convention, Australian Institute of Food Science Technology, Sydney, Australia.
Kimoto, H., Ohmomo, S., Okamoto, T., 2002. Cholesterol removal from media by lactococci. J. Dairy Sci. 85, 3182-3188.
Klaver, F.A.M., Van der Meer, R., 1993. The assumed assimilation of cholesterol by Lactobacilli and Bifidobacterium bifidum is due to their bile salt deconjugating activity. Appl. Environ. Microbiol. 59, 1120-1124.
Klinger, J.M., Stowe, R.P., Obenhuber, D.C., Groves, T.O., Mishra, S.K., Pierson, M.D., 1992. Evaluation of the biolog automated microbial identification system. App. Environ. Microbiol. 58, 2089-2092.
Lavanya, B., 2001. Screening and characterization of lactic acid bacteria from fermented milk. Brit. J. Dairy Sci. 2, 5-10.
Liong, M.T., Shah, N.P., 2005. Bile salt deconjugation ability, bile salt hydrolase activity and cholesterol co-precipitation ability of lactobacilli strains. Int. Dairy J. 15, 391-398.
Logan, N.A., De Vos, P., 2009. Genus I. Bacillus. In: De Vos, P., Garrity, G.M., Jones, D., Krieg, N.R., Ludwig, W., Rainley, F.A., Schleifer, K.H., Whitman, W.B. (Eds.), Bergey's Manual of Systematic Bacteriology. Springer Science and Business Media, New York, pp. 21-108.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the folin phenol reagent. J. Biol. Chem. 193, 265-275.
Lunden, S., Savage, D.C., 1990. Characterization and purification of bile salt hydrolase from Lactobacillus sp. strain 100-100. J. Bacteriol. 172, 4171-4177.
Matijasic, B.B., Rogelj, I., 2000. Lactobacillus K7: A new candidate for a probiotic strain. F. Technol. Biotechnol. 38, 113-119.
Miremadi, F., Ayyash, M., Sherkat, F., Stojanovska, L., 2014. Cholesterol reduction mechanisms and fatty acid composition of cellular membranes of probiotic Lactobacilli and Bifidobacteria. J. Funct. Foods. 9, 295-305.
Mojgani, N., Fatimah, H.F., Vaseji, N., 2015. Characterization of indigenous Lactobacillus strains for probiotic properties. Jundisha-pur J. Microbiol. 8 (2), 1-2.
Noriega, L., Cuevas, I., Margolles, A., de los Reyes-Gavilan, C.G., 2006. Deconjugation and bile salts hydrolase activity by Bifidobac-terium strains with acquired resistance to bile. Int. Dairy J. 16, 850855.
Oh, Y.J., Jung, D.S., 2015. Evaluation of probiotic properties of Lactobacillus and Pediococcus strains isolated from Omegisool, a traditionally fermented millet alcoholic beverage in Korea. LWT Food Sci. Technol. 63, 437-444.
Olejnik, A., Lewandowska, M., Obarska, M., Grajek, W., 2005. Tolerance of Lactobacillus and Bifidobacterium strains to low pH, bile salts and digestive enzymes. EJPAU 8, 25-32.
Parente, E., Brienza, C., Moles, M., Ricciardi, A., 1994. A comparison of methods for the measurement of bacteriocin activity. J. Microbiol. Meth. 22, 95-108.
Park, Y.H., Jong, G.K., Young, W.S., Sae, H.K., Kwang, Y.W., 2007. Effect of dietary inclusion of Lactobacillus acidophilus ATCC 43121 on cholesterol metabolism in rats. J. Microbiol. Biotechnol. 17, 655-662.
Pereira, D.I.A., Gibson, G.R., 2002. Cholesterol assimilation by lactic acid bacteria and bifidobacteria isolated from the human gut. Appl. Environ. Microbiol. 68, 4689-4693.
Prasad, J., Gill, H., Smart, J., Gopal, P.K., 1998. Selection and characterization of Lactobacillus and Bifidobacterium strains for use as probiotics. Int. Dairy J. 8, 993-1002.
Rudel, L.L., Morris, M.D., 1973. Determination of cholesterol using o-phtaldealdehyde. J Lipid Res. 14, 364-366.
Salminen, S., von Wright, A., 1998. Current probiotics—safety assured. Microbial. Ecol. Health Disease 10, 68-77.
Sanders, M.E., in't Veld, J.H., 1999. Bringing a probiotic-containing functional food to the market: microbiological, product, regulatory and labeling issues. Antonie Van Leeuwenhoek 76, 293-315.
Sghir, A., Gramet, G., Suau, A., Rochet, V., Pochart, P., Dore, J., 2000. Quantification of bacterial groups within human fecal microbiota by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 66, 2263-2266.
Sharpe, M.E., 1979. Identification of the lactic acid bacteria. In: Skinner, F.A., Lovelock, D.W. (Eds.), Identification Methods for Microbiologists. Academic Press, London, pp. 233-259.
Suskovic, J., Brkic, B., Matosic, S., Maric, V., 1997. Lactobacillus acidophilus M92 as potential probiotic strain. Milchwissenschaft 52, 430-435.
Tambekar, D.H., Bhutada, S.A., Choudhary, S.D., Khond, M.D., 2009. Assessment of potential probiotic bacteria isolated from milk of domestic animals. J. Appl. Biosci. 15, 815-819.
Tambekar, D.H., Bhutada, S.A., 2010. Studies on antimicrobial activity and characteristics of bacteriocins produced by Lactobacil-lus strains isolated from milk of domestic animals. Internet J. Microbiol. 8, 1-6.
Tanaka, H., Hashiba, H., Kok, J., Mierau, I., 2000. Bile salt hydrolase of Bifidobacterium longum - biochemical and genetic characterization. Appl. Environ. Microbiol. 66, 2502-2512.
Vijaya, K.B., Vijayendra, S.V.N., Reddy, O.V.S., 2015. Trends in dairy and non-dairy probiotic products — a review. J. Food Sci. Technol. 52, 6112-6124.
Vizoso Pinto, M.G., Franz, C.M.A.P., Schillinger, U., Holzapfel, W., 2006. Lactobacillus spp. With in vitro probiotic properties from human faeces and traditional fermented products. Int. J. Food Microbiol. 109, 205-214.
Vries, M.C., Vaughan, E.E., Kleerebezem, M., de Vos, W.M., 2006. Lactobacillus plantarum-survival, functional and potential probiotic properties in the human intestinal tract. Int. Dairy J. 16, 10181028.
Wang, J., Zhang, H., Chen, X., Chen, Y., Menghebilige, B.Q., 2012. Selection of potential probiotic lactobacilli for cholesterol-lowering properties and their effect on cholesterol metabolism in rats fed a high-lipid diet. J. Dairy Sci. 95, 1645-1654.
Wang, R.F., Cao, W.W., Cerniglia, C.E., 1996. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl. Environ. Microbiol. 62, 1242-1247.
Xie, Y., Zhang, H., Liu, H., Xiong, L., Gao, X., Jia, H., Lian, Z., Tong, N., Han, T., 2015. Hypocholesterolemic effects of Kluyver-omyces marxianus M3 isolated from Tibetan mushrooms on diet-induced hypercholesterolemia in rat. Brazil. J. Microbiol. 46, 389395.
