Scholarly article on topic 'Circulating and Tissue-Resident CD4 +  T Cells With Reactivity to Intestinal Microbiota Are Abundant in Healthy Individuals and Function Is Altered During Inflammation'

Circulating and Tissue-Resident CD4 + T Cells With Reactivity to Intestinal Microbiota Are Abundant in Healthy Individuals and Function Is Altered During Inflammation Academic research paper on "Biological sciences"

CC BY
0
0
Share paper
Academic journal
Gastroenterology
OECD Field of science
Keywords
{"Immune Regulation" / Microbiota / Cytokines / "Tissue-resident Memory T cells"}

Abstract of research paper on Biological sciences, author of scientific article — Ahmed N. Hegazy, Nathaniel R. West, Michael J.T. Stubbington, Emily Wendt, Kim I.M. Suijker, et al.

Background & Aims Interactions between commensal microbes and the immune system are tightly regulated and maintain intestinal homeostasis, but little is known about these interactions in humans. We investigated responses of human CD4+ T cells to the intestinal microbiota. We measured the abundance of T cells in circulation and intestinal tissues that respond to intestinal microbes and determined their clonal diversity. We also assessed their functional phenotypes and effects on intestinal resident cell populations, and studied alterations in microbe-reactive T cells in patients with chronic intestinal inflammation. Methods We collected samples of peripheral blood mononuclear cells and intestinal tissues from healthy individuals (controls, n = 13−30) and patients with inflammatory bowel diseases (n = 119; 59 with ulcerative colitis and 60 with Crohn’s disease). We used 2 independent assays (CD154 detection and carboxy-fluorescein succinimidyl ester dilution assays) and 9 intestinal bacterial species (Escherichia coli, Lactobacillus acidophilus, Bifidobacterium animalis subsp lactis, Faecalibacterium prausnitzii, Bacteroides vulgatus, Roseburia intestinalis, Ruminococcus obeum, Salmonella typhimurium, and Clostridium difficile) to quantify, expand, and characterize microbe-reactive CD4+ T cells. We sequenced T-cell receptor Vβ genes in expanded microbe-reactive T-cell lines to determine their clonal diversity. We examined the effects of microbe-reactive CD4+ T cells on intestinal stromal and epithelial cell lines. Cytokines, chemokines, and gene expression patterns were measured by flow cytometry and quantitative polymerase chain reaction. Results Circulating and gut-resident CD4+ T cells from controls responded to bacteria at frequencies of 40−4000 per million for each bacterial species tested. Microbiota-reactive CD4+ T cells were mainly of a memory phenotype, present in peripheral blood mononuclear cells and intestinal tissue, and had a diverse T-cell receptor Vβ repertoire. These cells were functionally heterogeneous, produced barrier-protective cytokines, and stimulated intestinal stromal and epithelial cells via interleukin 17A, interferon gamma, and tumor necrosis factor. In patients with inflammatory bowel diseases, microbiota-reactive CD4+ T cells were reduced in the blood compared with intestine; T-cell responses that we detected had an increased frequency of interleukin 17A production compared with responses of T cells from blood or intestinal tissues of controls. Conclusions In an analysis of peripheral blood mononuclear cells and intestinal tissues from patients with inflammatory bowel diseases vs controls, we found that reactivity to intestinal bacteria is a normal property of the human CD4+ T-cell repertoire, and does not necessarily indicate disrupted interactions between immune cells and the commensal microbiota. T-cell responses to commensals might support intestinal homeostasis, by producing barrier-protective cytokines and providing a large pool of T cells that react to pathogens.

Academic research paper on topic "Circulating and Tissue-Resident CD4 + T Cells With Reactivity to Intestinal Microbiota Are Abundant in Healthy Individuals and Function Is Altered During Inflammation"

Accepted Manuscript

Circulating and Tissue-resident CD4+ T Cells With Reactivity to Intestinal Microbiota Are Abundant in Healthy Individuals and Function is Altered During Inflammation

Ahmed N. Hegazy, Nathaniel R. West, Michael J.T. Stubbington, Emily Wendt, Kim I.M. Suijker, Angeliki Datsi, Sebastien This, Camille Danne, Suzanne Campion, Sylvia H. Duncan, Benjamin M.J. Owens, Holm H. Uhlig, Andrew McMichael, Andreas Bergthaler, Sarah A. Teichmann, Satish Keshav, Fiona Powrie

PII: S0016-5085(17)35979-6

DOI: 10.1053/j.gastro.2017.07.047

Reference: YGAST 61339

To appear in: Gastroenterology Accepted Date: 25 July 2017

Please cite this article as: Hegazy AN, West NR, Stubbington MJT, Wendt E, Suijker KIM, Datsi A, This S, Danne C, Campion S, Duncan SH, Owens BMJ, Uhlig HH, McMichael A, Oxford IBD Cohort Investigators, Bergthaler A, Teichmann SA, Keshav S, Powrie F, Circulating and Tissue-resident CD4+ T Cells With Reactivity to Intestinal Microbiota Are Abundant in Healthy Individuals and Function is Altered During Inflammation, Gastroenterology (2017), doi: 10.1053/j.gastro.2017.07.047.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Memory CD4+ T cells labelling

■ (CD3+ CD4+ -

CD45RA- )

I Expansion 1 3-7 days^

CFSE dilution

Monocytes CD14+

Incubation with bacterial lysates

S. typhimurium F. prausnitzii

C. difficile

0 102 103 104 105

103 104 105

103 104 105

l.ggsl

S. aureus

0 102 103 104 105

103 104 105

100-1 806040-

E. coli

S. typhimurium

-íííí- 10-

B. animalis

L. acidophilus F. prausnitzii

-íííí- 15- -íííí- 15_

C. difficile

S. aureus

ô.-N O

E. coli B. animalis L. acidophilus

0 103 10* 105

0 103 104 105

0 103 104 105

0 103 104 105

0 103 104 105

I I I I I I

8 ^ 104

- F UJ ■=

O (5 103

crwsfy cñ»W

ÄT <b'

S: 10^

o 103-

Shared clonotypes, TCRVß

Donor 1

Donor 2

Donor 3

E. coli 0 3.9 1.4 0.94 1.1 0.99 0.11 0.33 0 4.4 2 2.1 1 1 0.46 0.13 0 4.5 0.79 0.42 0.76 0.38 0 0.24

. typhimurium 3.9 0 1.2 1.5 1.4 1.5 0.12 0.18 4.4 0 0.97 1.2 0.86 0.36 0.35 0.65 4.5 0 0.6 0.43 0.89 0.58 0.078 0.12

B. animalis 1.4 1.2 0 4.1 4.1 3.7 0.29 0.2 2 0.97 0 B 2.9 3.1 0.48 0.18 0.79 0.6 0 1.2 4.9 2.8 0.4 0.086

L. acidophilus 0.94 1.5 4.1 0 4.7 4.1 0.16 0.11 2.1 1.2 B 0 3.2 0.8 0.2 0.42 0.43 1.2 0 1.9 1.3 0 0

F. prausnitzii 1.1 1.4 4.1 4.7 0 3.4 0.42 0.29 1 0.86 2.9 - 0 1.7 0.41 0.82 0.76 0.89 4.9 1.9 0 1.2 1.1 0

C. difficile 0.99 1.5 3.7 4.1 3.4 0 0.29 0.3 1 0.36 3.1 3.2 1.7 0 0 0 0.38 0.58 2.8 1.3 1.2 0 0 0.084

SEB 0.11 0.12 0.29 0.16 0.42 0.29 0 0.93 0.46 0.35 0.48 0.8 0.41 0 0 0.39 0 0.078 0.4 0 1.1 0 0 0.56

PHA 0.33 0.18 0.2 0.11 0.29 0.3 0.93 0 0.13 0.65 0.18 0.2 0.82 0 0.39 0 0.24 0.12 0.086 0 0 0.084 0.56 0

(%) 18

\i>° Jf 0

Co-culture

Manuscript Number: GASTRO-D-16-01275R1

Title: Circulating and Tissue-resident CD4+ T Cells With Reactivity to Intestinal Microbiota Are Abundant in Healthy Individuals and Function is Altered During Inflammation

Authors: Ahmed N. Hegazy1"2"10, Nathaniel R West1"210, Michael J. T. Stubbington3"4, Emily Wendt1, Kim I. M. Suijker2, Angeliki Datsi1, Sebastien This1, Camille Danne2, Suzanne Campion5, Sylvia H. Duncan6, Benjamin M. J. Owens1, Holm H. Uhlig1"7, Andrew McMichael5, Oxford IBD Cohort Investigators8, Andreas Bergthaler9, Sarah A. Teichmanrr4. Satish Keshav1, Fiona Powrie1"2

Affiliations:

'Translational Gastroenterology Unit, Nuffield Department of Clinical Medicine, Experimental Medicine Division, John Radcliffe Hospital, University of Oxford, UK

2Kennedy Institute of Rheumatology, Nuffield Department of Orthopaedics, Rheumatology and Musculoskeletal Sciences, University of Oxford, UKD

'"European Molecular Biology Laboratory-European Bioinformatics Institute, Hinxton, UK 4Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK 5Nuffield Department of Medicine Research Building, University of Oxford, Oxford, UK 6Microbial Ecology Group, Rowett Institute of Nutrition and Health, University of Aberdeen, UK department of Paediatrics, University of Oxford, Oxford, UK individual investigators are listed in the acknowledgement section

9CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria

10Co-first authors

Grant support: ANH was supported by an EMBO long-term fellowship and a Marie Curie

fellowship. NRW was supported by a CRI Irvington Post-doctoral Fellowship. BMJO was supported by an Oxford-UCB Pharma Postdoctoral Fellowship. MJTS and SAT were supported by ERC grant ThSWITCH and ThDEFINE (260507). SC and AM were supported by the Center for HIV/AIDS Vaccine Immunology and Immunogen Discovery (grant UM1-AI100645). The Rowett Institute of Nutrition and Health receives financial support from the Scottish Government Rural and Environmental Sciences and Analytical Services (SG-RESAS). Foundation Louis Jeantet, Wellcome Trust (Investigator award 095688/Z/11/Z), and ERC (ERC/HN/2013/21) supported FP and this project. HHU is supported by the Crohn's & Colitis Foundation of America (CCFA), The Leona M. and Harry B. Helmsley Charitable Trust. SD receive financial support from the Scottish Government Rural and Environmental Sciences and Analytical Services (RESAS). Abbreviations: Antigen presenting cells (APCs), Brefeldin A (BFA), Carboxyfluorescein succinimidyl ester (CFSE), Central memory (CM), Chemokine ligand (CCL), Chemokine receptor (CCR), Crohn's disease (CD), Effector memory (EM), Fluorescence minus one (FMO), Gastrointestinal tract (GIT), GATA-binding factor-3 (GATA-3), Inflammatory bowel disease (IBD), Interferon-gamma (IFN-g), Interleukin (IL-), Lamina propria mononuclear cells (LPMCs), Lipopolysaccharide (LPS), Magnetic cell separation (MACS), Major histocompatibility complex (MHC), Peripheral blood mononuclear cell (PBMC), Phytohaemagglutinin (PHA), RAR-related orphan receptor gamma t (RORgt), Regulatory T cells (Treg), Staphylococcus enterotoxin B (SEB), T cell receptor (TCR), T helper (Th), T-box-expressed-in-T-cells (T-bet), Tumour necrosis factor alpha (TNF-a), Ulcerative colitis (UC), Violet proliferation dye (VPD).

Corresponding author: Prof. Fiona Powrie, FRS, Kennedy Institute of Rheumatology, University of Oxford, Roosevelt Drive, Headington, Oxford, OX3 7FY, UK Email: Fiona.Powrie@kennedy.ox.ac.uk; Tel: +44 (0)1865 612 659

Disclosures: These authors disclose the following: F.P. has received research support or

consultancy fees from Eli Lilly, Merck, GSK, Janssen, Compugen, UCB, and Medlmmune. S.K. has received consulting fees and research support from ChemoCentryx Inc. and GSK in the past. The remaining authors declare no conflict of interest. HHU has project collaboration with Eli Lilly and UCB Pharma related to this project. Dr Keshav has provided consultancy services for a number of pharmaceutical and healthcare companies including Abbvie, Actavis Allergan, Astra-Zeneca, Boehringer Ingelheim, ChemoCentryx, Dr Falk Pharma, Ferring, Gilead, GSK, Merck, Mitsubishi Tanabe Pharma, Pharmacosmos, Pfizer, Takeda, and Vifor Pharma, and received research support from Abbvie, ChemoCentryx, GSK, and Merck. Transcript Profiling: None Writing Assistance: None

Author Contributions: ANH, NRW designed, performed, and analysed experiments. ANH, NRW, and FP conceived and designed the project, interpreted data, and wrote the manuscript. MJTS analysed TCR sequencing data. EW, KS, AD, ST, SC, BMJO, CD, SHD, AB were involved in acquisition of data, data analysis and interpretation of data. SAT, SK, HHU, AM provided essential materials and were involved in data interpretation and discussions. Oxford IBD Cohort Investigators provided IBD patient samples and ethical approval for the project. The Oxford IBD Cohort Investigators are: Dr. Carolina Arancibia, Dr. Adam Bailey, Dr. Ellie Barnes, Dr. DBeth Bird-Lieberman, Dr. Oliver Brain, Dr. Barbara Braden, Dr. Jane Collier, Dr. James East, Dr. Lucy Howarth, Dr. Satish Keshav, Dr. Paul Klenerman, Dr. Simon Leedham, Dr. Rebecca □ Palmer, Dr. Fiona Powrie, Dr. Astor Rodrigues, Dr. Alison Simmons, Dr. Peter Sullivan, Dr. Simon Travis, Dr.

Abstract (250 words):

Background & Aims: Interactions between commensal microbes and the immune system are tightly regulated and maintain intestinal homeostasis, but little is known about these interactions in humans. We investigated responses of human CD4+ T cells to the intestinal microbiota. We measured the abundance of T cells in circulation and intestinal tissues that respond to intestinal microbes and determined their clonal diversity. We also assessed their functional phenotypes and effects on intestinal resident cell populations, and studied alterations in microbe-reactive T cells in patients with chronic intestinal inflammation.

Methods: We collected samples of peripheral blood mononuclear cells (PBMC) and intestinal tissues from healthy individuals (controls, n=13-30) and patients with inflammatory bowel diseases (IBD, total n=119; 59 with UC and 60 with Crohn's disease). We used 2 independent assays (CD154 detection and carboxy-fluorescein succinimidyl ester dilution assays) and 9 intestinal bacterial species (Escherichia coli, Lactobacillus acidophilus, Bifidobacterium animalis subsp. lactis, Faecalibacterium prausnitzii, Bacteroides vulgatus, Roseburia intestinalis, Ruminococcus obeum, Salmonella typhimurium and Clostridium difficile) to quantify, expand, and characterize microbe-reactive CD4+ T cells. We sequenced T-cell receptor vb genes in expanded microbe-reactive T-cell lines to determine their clonal diversity. We examined the effects of microbe-reactive CD4+ T cells on intestinal stromal and epithelial cell lines. Cytokines, chemokines, and gene expression patterns were measured by flow cytometry and quantitative PCR.

Results: Circulating and gut-resident CD4+ T cells from controls responded to bacteria at frequencies of 40-4000 per million for each bacterial species tested. Microbiota-reactive CD4+ T cells were mainly of a memory phenotype, present in PBMCs and intestinal tissue, and had a diverse T-cell receptor vb repertoire. These cells were functionally heterogeneous, produced barrier protective cytokines, and stimulated intestinal stromal and epithelial cells via interleukin 17A (IL17A), interferon gamma, and tumor necrosis factor. In patients with IBD, microbiota-reactive CD4+ T cells were reduced in the blood compared to intestine; T-cell responses we detected had an increased frequency of IL17A production compared to responses of T cells from blood or intestinal tissues of controls.

Conclusions: In an analysis of PBMC and intestinal tissues from patients with IBD vs controls, we found that reactivity to intestinal bacteria is a normal property of the human CD4+ T-cell repertoire, and does not necessarily indicate disrupted interactions between immune cells and the commensal microbiota. T-cell responses to commensals might support intestinal homeostasis, by producing barrier-protective cytokines and providing a large pool of T cells that react to pathogens.

KEY WORDS: IFNG, TNF, immune regulation; activation

Introduction

Vast numbers of microbes populate the gastrointestinal (GI) tract and contribute to digestion, epithelial barrier integrity, and the development of appropriately educated mucosal immunity1. Intestinal immune responses are tightly regulated to allow protective immunity against pathogens while limiting responses to dietary antigens and innocuous microbes. The 'mucosal firewall' prevents systemic dissemination of microbes by confining microbial antigens to the gut-associated lymphoid tissue (GALT)2. In the GALT, dendritic cells drive regulatory T cell differentiation in response to dietary antigens and commensal bacteria3. Nevertheless, vast numbers of potentially commensal-reactive effector and memory T cells populate intestinal mucosae4. Recent evidence suggests that in mice, tolerance to commensal-derived antigens may be lost during pathogen-induced epithelial damage and subsequent transient exposure to commensals5,6. In humans, circulating memory T cells recognise peptides derived from gut bacteria and can cross-react to pathogens, which may confer immunological advantage during subsequent new infections7,8. While this process may be beneficial during homeostasis, deranged responses to commensals may promote inflammatory conditions such as inflammatory bowel disease (IBD).

IBD (including Crohn's disease (CD) and ulcerative colitis (UC)) results from a prolonged disturbance of gut homeostasis, the precise aetiology of which is uncertain. One hypothesis is that, in genetically susceptible individuals, IBD may be triggered by intestinal dysbiosis that promotes aberrant immune stimulation9. Indeed, in mouse models of colitis, intestinal microbiota promote inflammation in part by stimulating microbiota-reactive CD4+ T cells5,10. Whether this drives IBD in humans, however, remains unknown.

Although CD4+ T cell responses to intestinal bacteria are known to occur in humans11-13, several aspects of this topic are largely uncharacterised, including (a) the frequency of human T cells in the gut and periphery that are reactive to phylogenetically distinct intestinal microbes; (b) the T cell receptor diversity and clonotype sharing of these T cells; (c) the functional phenotype of

gut microbe-reactive T cells and their impact on tissue-resident cell populations; and (d) how microbe-reactive T cells change during chronic intestinal inflammation. To address this knowledge gap, we extensively characterised CD4+ T cell responses to intestinal microbiota in healthy individuals and IBD patients.

Using two independent assays, we observed that for almost all enteric bacteria examined, bacteria-reactive CD4+ T cells were present at a frequency of 40 to 500 per million CD4+ T cells in adult peripheral blood. Bacteria-reactive T cells were also prevalent in the gut mucosa, with prominent enrichment for proteobacteria-reactivity. Microbiota-responsive T cells showed a diverse TCRVb repertoire and potently stimulated inflammatory responses by intestinal epithelial and stromal cells. Intriguingly, T cells from IBD patients displayed a normal spectrum of microbial responses, but expressed high amounts of IL-17A, consistent with increased amounts of Th17-polarising cytokines in inflamed intestinal tissue. Collectively, these data demonstrate that microbiota-reactive CD4+ T cells are prevalent and normal constituents of the human immune system that are functionally altered during IBD pathogenesis.

Materials and Methods

Human Samples and Cell Isolation. Leukoreduction chambers from healthy individuals were obtained from the National Blood Service (Bristol, UK). Peripheral EDTA blood samples were obtained from IBD patients attending the John Radcliffe Hospital Gastroenterology unit or from healthy in-house volunteers. IBD patients (total, n=119; UC, n=59; CD, n=60) diagnosed by endoscopic, histological and radiological criteria were recruited for the study. Healthy volunteers (n=30) without any known underlying acute or chronic pathological condition served as control donors. Demographic and clinical characteristics of IBD patients are summarized in Supplementary Tables 5, 6, and 7. All donors provided informed, written consent. The NHS Research Ethics System provided ethical approval (reference numbers 09/H0606/5 for IBD patients and 11/YH/0020 for controls; OCHRe ref 15/A237 for cord blood samples). For details regarding cell isolation, see Supplemental Experimental Procedures.

CD154-based Detection of Antigen-Specific T Cells. CD154 detection was done as previously described14,15. Briefly, cells were plated at 5x106/cm2 for 7-12h with heat-inactivated bacteria. 5 ^g/ml brefeldin A (BFA, Sigma Aldrich) was added at 2 h. After 8-12 h, cells were harvested and treated as described in the Intracellular Cytokine, CD154 And Transcription Factor Staining section (see below). For MACS enrichment of CD4CD154+ T cells, see Supplemental Experimental Procedures.

Antigen-specific Recall Response (CFSE dilution assay) And T Cell Culture. Memory CD4+ CD45RO+ CD45RA- T cells were enriched from PBMC with untouched memory CD4+ T cell enrichment kit (Miltenyi Biotec), sorted to >97% purity on a FACS ARIA III (BD) using CD45RA and CD45RO expression, and were labelled with CFSE or Violet proliferation dye (VPD, Invitrogen). CD14+ monocytes were isolated from PBMC using anti-CD14 microbeads (Miltenyi Biotec), irradiated (45 Gy) and then pre-incubated for 3 h with bacterial lysates before T-cell co-culture. T cells were co-cultured with the irradiated autologous monocytes at a ratio of 2:1 for 5-7

days. Cells were cultured in RPMI-1640 supplemented with 2 mM glutamine, 1% (v/v) non-essential amino acids, 1% (v/v) sodium pyruvate, penicillin (50 U/ml), streptomycin (50 mg/ml; all from Invitrogen) and 5% (v/v) human serum (National Blood Service, Bristol, UK). CD14+ monocytes were irradiated (45 Gy) and then pre-incubated for 3 h with bacterial lysates before T-cell co-culture. For MHCII blockade, 10 ^g/ml of a pan-HLA class-II blocking antibody (HLA-DR, DP, DQ; (Tu39)) was added 30 minutes before T-cell co-culture. T cell lines were generated by sorting CFSElow ICOShigh CD4+ T cells after seven days of stimulation and expanding them with IL-2 (300 U/ml) and anti-CD3/CD28 beads (beads/T cell ratio, 1:4, Dynals) for 10-14 days. Supernatants were collected from 1x106 CD4+ T cells stimulated for 24h with PMA (5 ng/ml) and ionomycin (500 ng/ml; Sigma).

Flow Cytometry and Cell Sorting. PBMCs and LPMCs were stained according to standard protocols. For details, see Supplemental Experimental Procedures.

Intracellular Cytokine, CD154, And Transcription Factor Staining. For intracellular cytokine staining, cells were stained with fixable viability dye eFluor® 780 (eBioscience) and surface markers, fixed with 2% formaldehyde (Merck), and stained for cytokines in MACS buffer containing 0.05% saponin (Sigma-Aldrich). Transcription factor expression was analysed using the FoxP3 staining buffer set (eBioscience) according to manufacturer's instructions. Stimulation of Intestinal Cell Lines. CCD18Co (non-transformed human colon fibroblasts, ATCC), and LIM1863 (human colon epithelial cells; a kind gift of Dr. Robert Whitehead, Ludwig Institute for Cancer Research) cells were cultured in humidified incubators with 5% CO2 at 37°C in DMEM or RPMI media (Sigma) with 10% FCS (Sigma) and 100 U penicillin/0.1 mg/ml streptomycin. Cells were stimulated with 5% T cell supernatants for 24h. Cytokine neutralization was achieved by supernatant pre-incubation for 1-2h with 10 ^g/ml anti-IL17A (eBio64CAP17), anti-IFN-g (B27), anti-TNF-a (Remicade), and anti-IL22 (IL22JOP).

Statistics. Statistical analyses were performed with GraphPad Prism v6.0 for Macintosh

(GraphPad Software). Statistically significant p values were indicated as follows: ns, not significant; * P<0.05; ** P< 0.01; *** P<0.001; **** P<0.0001. Tests are specified in figure legends.

Results

Healthy adults possess circulating memory CD4+ T cells that are reactive to intestinal microbiota

CD154 (also known as CD40 ligand) is rapidly upregulated by CD4+ T cells following antigen stimulation, irrespective of their differentiation phenotype, MHC alleles, or the precise nature of the antigenic epitope14,15. We therefore used CD154 to detect naive and memory CD4+ T cell responses among peripheral blood mononuclear cells (PBMCs) after stimulation with heat-inactivated bacteria (Figure 1A). Seven aerobic and anaerobic intestinal bacterial species representing the four dominant gut phyla were chosen: Escherichia coli, Lactobacillus acidophilus, Bifidobacterium animalis subsp. lactis, Faecalibacterium prausnitzii, Bacteroides vulgatus, Roseburia intestinalis, and Ruminococcus obeum (Supplementary Figure 1A and Supplementary Table S1). These bacteria are common in the healthy intestine but are altered in relative abundance during inflammation16,17. Furthermore, we analysed responses to Salmonella typhimurium and Clostridium difficile due to their association with IBD18,19. T cell responses to the above bacteria were compared to those against well characterized barrier surface-related microbes that drive robust Th17 responses (Staphylococcus aureus and Candida albicans) or strong Th1 responses (Mycobacterium tuberculosis)20'21. The presence of a large pool of M. tuberculosis -reactive memory Th1 cells in non-exposed individuals has previously been documented. The responses in healthy controls are directed towards non-tuberculous mycobacteria (NTMs) rather than towards MTB20,22,23. The superantigen Staphylococcus enterotoxin B (SEB) was used as a positive stimulation control.

Stimulation with enteric bacteria reproducibly induced detectable numbers of CD4CD154+ T cells in the peripheral blood. CD4+ T cells reactive to S. aureus, C. albicans, and M. tuberculosis were generally more abundant (Figure 1B and Supplementary Figure 1B, C).

Activation markers CD69 and ICOS were upregulated on activated antigen-reactive CD4 CD154+ T cells (Supplementary Figure 1D). Responses were MHCII-dependent

(Supplementary Figure 1E), and LPS failed to induce CD154 expression, confirming that CD154 upregulation was not a consequence of non-specific microbial responses (Figure 1B and Supplementary Figure 1C). Based on CD154+ cell frequencies, we calculated that enteric bacteria-reactive CD4+ T cells were present at precursor frequencies of 40 to 500 cells per 106 circulating CD4+ T cells for almost all enteric bacteria surveyed (Figure 1C and Supplementary Figure 1F).

The newborn gut is primarily colonised with maternal vaginal and faecal bacteria after birth24. To understand whether T cell reactivity to microbes develops after birth, we compared CD154 expression in umbilical cord blood with adult blood after enteric bacteria stimulation. As expected, appreciable responses to microbiota were observed only in adult blood. However, CD4CD154+ T cell frequencies after SEB stimulation were similar between adult and cord blood (Figure 1D and Supplementary Figure 1G).

Human memory T cells downregulate the naïve marker CD45RA and produce cytokines more efficiently than naïve T cells25,26. In healthy individuals, the majority of bacteria-reactive CD4+ T cells had a memory phenotype (over 80% on average), indicating that they had been primed in vivo (Figure 1E, F and Supplementary Figure 2A, B). Microbiota-reactive CD4 CD154CD45RA- T cells expressed high amounts of TNF-a and IL-2 when compared to CD4 CD154CD45RA+ T cells (Figure 1G and Supplementary Figure 2C). Therefore, the circulating pool of memory CD4+ T cells contains numerous microbiota-reactive cells that arise after birth and produce cytokines including TNF-a and IL-2.

Circulating microbiota-reactive CD4+ T cells express surface molecules that permit mucosal trafficking

Memory T cells express numerous adhesion molecules and chemokine receptors to access different tissues under steady-state and inflammatory conditions4,27,28. For example, a4b7 integrin

and CCR9 regulate T cell migration to distinct parts of the gut. Blockade of a4b7 integrin has shown clinical efficacy for treating IBD, whereas CCR9 blockade yielded mixed results29'30. To identify homing receptors expressed by bacteria-reactive CD4+ T cells, we enriched CD4CD154+ T cells using magnetic beads to visualise rare enteric-bacteria-reactive T cells, and analysed them by flow cytometry (Figure 2A). Microbiota-reactive T cells had a central memory phenotype, with over 60% expressing high levels of CCR7 (Figure 2B). Furthermore, 5-10% of CD4+CD154+ T cells expressed the gut-homing surface markers integrin b7 and CCR9 (Figure 2C, D). Relative to total memory CD4+ T cells and CD4CD154- T, enteric bacteria-reactive T cells had high expression of the mucosa-homing receptors CCR4 and CCR6 (above 60%), low expression of CCR10, and comparable expression of CXCR3 and CCR2 (Figure 2D and Supplementary Figure 2D). Microbiota-reactive CD4+ T cells also expressed high amounts of CD161, a marker enriched on Th17 cells (Figure 2D, E). The majority of memory CD4CD154+ T cells co-expressed CCR7, CCR4, CD161, and CCR6 in various combinations, some of which also expressed integrin b7 (Figure 2E, pie chart). Therefore, circulating microbiota-reactive CD4+ T cells are equipped with several homing receptors that promote mucosal access.

When comparing gut microbiota-reactive CD4+ T cells with those reactive to non-enteric organisms (including S. aureus-, M. tuberculosis-, and C. albicans), enteric bacteria-reactive T cells were partially enriched only in CCR4 expression (Figure 2F). Thus, the homing receptor phenotype of enteric bacteria-reactive T cells is consistent with that of T cells reactive to a broad diversity of mucosal microbes.

Microbiota-reactive CD4+ T cells are enriched in gut tissue

The gut harbours over 3x1010 CD4+ T cells, but their specificity is unknown4,5. We therefore estimated the abundance of human microbiota-reactive CD4+ T cells in the gut by examining non-inflamed colon specimens using the CD154 assay (Figure 3A). Lamina propria CD4+ T cells

showed a dominant EM and CM phenotype and expressed both tissue-resident and gut-related markers, with 80% of cells being CD69+ (Supplementary Figure 3A).

We next stimulated lamina propria mononuclear cells (LPMCs) with microbial lysates or SEB. We combined intracellular CD154 detection with TNF-a staining to increase assay sensitivity, as lamina propria CD4+ T cells expressed low amounts of CD154 without stimulation (Supplementary Figure 3B,C). Compared with peripheral blood frequencies of unrelated donors, there were similar frequencies of S. aureus and SEB reactivity, and reduced M. tuberculosis-reactivity in the gut. However, gut CD4+ T cells were enriched in reactivity towards intestinal bacteria and C. albicans (Figure 3B and Supplementary Figure 3D). Bacteria-reactive cells comprised 150-4000 cells per 106 gut-resident memory CD4+ T cells for all enteric bacteria tested. Given that peripheral blood contained 40-500 bacteria-reactive cells per 106 memory CD4+ T cells (for each bacteria tested), this suggests that bacteria-reactive T cells are 3-8 fold more frequent in gut tissue, as compared to those in circulation. The strong enrichment of S. typhimurium and E. coli-reactivity in the gut was confirmed by assessing CD154 and TNF-a expression in CD4+ T cells from donor-matched blood and intestinal tissue (Figure 3C). Since the gut harbours up to 3x1010 memory T cells (versus 5-10x109 in blood)4, many of which are bacteria-reactive, the absolute number of gut-resident microbiota-reactive CD4+ T cells is likely to be at least 10 times greater than that in peripheral blood.

Gut-resident bacteria-reactive (CD154+TNF-a+) T cells produced high amounts of IFN-g, IL-17A, and IL-2, while production of IL-22, GM-CSF, and IL-4 was generally low (Figure 3D and Supplementary Figure 3E,F). Interestingly, lamina propria T cells showed increased IL-17A expression and reduced IFN-g production relative to cells with similar reactivity in peripheral blood (Figure 3D and Supplementary Figure 3E).

Enteric bacteria-reactive CD4+ T cells are clonally diverse

To assess the clonal diversity of circulating bacteria-reactive memory CD4+ T cells, we expanded CFSE-labelled CD4+ T cells using whole bacteria and autologous irradiated monocytes as APCs (Supplementary Figure 4A)21. S. aureus-, M. tuberculosis-, and SEB-reactive T cells served as controls. Antigen-reactive T cells proliferated in an MHCII-dependent manner and were readily detectible after 3-6 days (Figure 4A and Supplementary Figure 4B-D). Proliferating cells expressed several activation markers including ICOS, CD25, and 0X40 (Figure 4A and Supplementary Figure 4B,E,F). Consistent with the CD154 assay, S. aureus, M. tuberculosis, and SEB strongly induced T cell proliferation (Figure 4A,B and Supplementary Figure 3B,C).

Flow cytometry analysis revealed a diverse TCRVb repertoire in bacteria-reactive T cells, similar to polyclonal stimulation with phytohaemagglutinin (PHA) but different to stimulation with SEB, which is known to activate a restricted Vb repertoire (Figure 4C)31. To directly assess the clonal diversity of bacteria-reactive CD4+ T cells, we isolated CFSElow bacteria-reactive memory T cells and assessed TCRVb clonotypes by multiplex PCR and deep sequencing. 150-800 clonotypes were detected for each reactivity (Supplementary Figure 4G). The largest clonal diversity was detected among E. coli- and S. typhimurium- reactive cells, consistent with frequencies observed in the CD154 assay (see Figure 1B,C and Supplementary Figure 1B,F). While closely related species (e.g. E. coli versus S. typhimurium) had 3-8% overlap in T cell clonotypes, little clonotype sharing was observed between T cells reactive to more distantly related bacteria (Supplementary Figure 3H). Indeed, E. coli- and B. animalis-reactive CD4+ T cell lines were strongly restimulated when cultured with autologous monocytes loaded with E. coli or B. animalis lysates, respectively. In contrast, E. coli-reactive T cells responded weakly to the closely related S. typhimurium, while B. animalis-reactive T cells responded weakly to L. acidophilus, F. prausnitzii, and C. difficile (Supplementary Figure 5A). These data confirm the low degree of cross-reactivity predicted from TCRVb sequencing.

Microbiota-reactive memory CD4+ T cells are functionally heterogeneous and produce barrier-promoting cytokines

To functionally characterise circulating microbiota-reactive memory cells, we analysed CFSElow cells using flow cytometry after stimulation with enteric bacteria for 6 days. Enteric microbiota-reactive cells produced Th1- and Th17-related cytokines including IFN-g, IL-17A, and IL-22, but only low amounts of the Th2 cytokine IL-4, comparable to cells reactive towards S. aureus or C. albicans (Figure 4D and Supplementary Figure 5B,C). In contrast, memory T cells reactive towards SEB, M. tuberculosis, influenza vaccine components, or tetanus toxoid showed a polarized Th1 profile with low expression of IL-17A (Figure 4D and Supplementary Figure 5B,C). Boolean gating revealed a high degree of functional heterogeneity in expanded microbiota-reactive memory T cells, with frequent co-expression of IL-17A, IL-22, and IFN-g (Figure 4E). Bacteria-reactive cells co-expressed the transcription factors RORgt and T-bet, which are characteristic of Th17 and Th1 cells, respectively (Figure 4F,G and Supplementary Figure 5D,E). Intriguingly, a subset of CD4+ T cells reactive to F. prausnitzii, L. acidophilus, or B. animalis produced the immunoregulatory cytokine IL-10 in addition to IFN-g and IL-17A (Supplementary Figure 5F). Thus, unlike T cells that are reactive towards M. tuberculosis or vaccine antigens, enteric microbiota-reactive T cells are functionally distinct and produce barrier-promoting and immunoregulatory cytokines.

Microbiota-reactive memory T cells promote intestinal stromal and epithelial cell activation

During periods of epithelial damage and exposure to commensals, activation of microbiota-reactive memory T cells could promote protective immune responses. To assess their tissue-modulating capabilities, cell-free supernatants of microbiota-reactive memory T cells were used to stimulate CCD18Co intestinal myofibroblasts and LIM1863 colonic epithelial cells. CCD18Co and LIM1863 cells were then assessed for expression of various immune response genes that were selected a

priori to represent responses to major T cell-derived cytokines. Both cell types responded by expressing several cytokine and chemokine genes known to be induced by IL-17A (including IL1B, CSF2, IL6, CXCL1, and CXCL8), as well as IFN-g-inducible genes including CXCL9, CXCL10, and CXCL11 (Figure 5A,B)32. Conversely, supernatants from SEB-stimulated memory T cells (which produce little IL-17A) mainly induced IFN-g-dependent genes. Thus, stimulation of non-hematopoietic intestinal cells by microbiota-reactive T cells may promote recruitment and activation of myeloid cell populations to facilitate pathogen control and tissue repair.

We next assessed the effects of individual cytokines in E. coli-reactive T cell supernatants using combinations of neutralizing antibodies. This experiment revealed distinct IFN-g- and IL-17A/TNF-a-dependent groups of response genes in both intestinal epithelial cells and fibroblasts. IFN-g blockade strongly reduced expression of several chemokine genes including CXCL9, CXCL10, CXCL11, CCL2, and CCL7 (IFN-g-dependent module; Figure 5C,D). Intriguingly, single blockade of IL-17A, IL-22, or TNF-a did not affect stromal or epithelial cell activation (Figure 5C,D). However, combined blockade of IL-17A and TNF-a influenced a large number of genes including CSF2, IL1B, TNF, CXCL1, CXCL8, CXCL5, CXCL6, and CCL20 (IL-17A/TNF-a-dependent module). Triple blockade of IFN-g, IL-17A, and TNF-a completely inhibited stromal and epithelial cell activation. IL-22 blockade did not affect cytokine or chemokine production, but attenuated induction of the anti-microbial peptide REG3G in LIM1863 cells. Given that the products of T cell-stimulated stromal and epithelial cells are highly expressed in the inflamed mucosa of IBD patients (Figure 5E and 7D), this signature might reflect the activation of microbiota-reactive T cells following epithelial disruption, a key feature of IBD.

Microbiota-reactive CD4+ T cells in inflamed intestinal tissue show a Th17-skewed phenotype in IBD patients

IBD is thought to arise in part from aberrant adaptive immune responses to microbiota9. Human

CD4+ T cells in IBD have been functionally characterised mainly by polyclonal stimulation - . Therefore, we evaluated microbiota-reactive CD4+ T cell responses in IBD patients using the CD154 detection approach. Circulating microbiota-reactive CD4+ T cell frequencies were decreased in IBD patients compared with healthy donors, which might reflect their selective recruitment to the inflamed gut (Figure 6A and Supplementary Figure 6A). However, intestinal memory CD4+ T cells from IBD patients did not display reciprocally higher frequencies of microbial specificity (Figure 6B and Supplementary Figure 6B). We next calculated the frequency of memory CD4+ T cells in inflamed mucosae using flow cytometry. Memory CD4+ T cells were present at higher frequencies in inflamed tissue from IBD patients compared to tissue from matched non-lesional sites of IBD patients and healthy controls (Figure 6C). These findings were confirmed using a previously published bioinformatics approach known as CIBERSORT in an independent cohort36 (Supplementary Figure 6C). Based on both approaches, memory CD4+ T cells are typically 2-4 fold more frequent in inflamed tissue from IBD patients compared to tissue from healthy controls. Thus, because inflamed tissue contains a higher abundance of memory CD4+ T cells than healthy mucosa, it can be inferred that gut-resident microbiota-reactive CD4+ T cells are similarly enriched in patients with active IBD (Figure 6C, Supplementary Figure 6C).

To evaluate functional alterations in microbiota-reactive CD4+ T cells in IBD, intracellular CD154 detection was combined with cytokine analysis. Compared with healthy controls, circulating microbiota-reactive CD4+ T cells from IBD patients displayed increased IL-17A and IL-2 production, but decreased expression of IFN-g (Figure 7A and Supplementary Figure 6D, E). Interestingly, increased IL-17A production was observed in all enteric bacteria-reactive responses, but not in S. aureus, M. tuberculosis, or SEB responses (Figure 7A and Supplementary Figure 6E,F). These changes were observed in both CD and UC and were independent of disease activity or therapy (Supplementary Figure 6G). However no difference in IL-10 production was observed between healthy donors and IBD patients (Supplementary Figure 6H). IFN-g and IL-17A

co-expression is thought to identify pathogenic CD4+ T cells in mouse colitis models37, so we assessed their co-expression in E. coli-reactive memory CD4+ T cells. Compared with controls, IBD patients displayed significantly increased frequencies of IL-17A+IFN-g- cells and a marginal increase in IL-17AIFN-g+ cells, while the IL-17A-IFN-g+ fraction was significantly reduced (Figure 7B). E. coli-reactive CD4+ T cells from inflamed intestinal tissue showed an increase in IL-17A single producers similar to that seen in peripheral blood (Figure 7C).

Because the Th17-inducing cytokines IL1B, IL6, and IL23A were highly enriched in the inflamed intestinal tissue of IBD patients (Figure 7D), we reasoned that they might promote Th17 polarization of bacteria-reactive T cells. Indeed, treatment of microbiota-reactive CD4+ T cells from healthy donors and IBD patients with IL-1b, IL-6, or IL-23 for one week during stimulation with E. coli, S. typhimurium, L. acidophilus, or B. animalis (CFSE dilution assay) resulted in a 1.5-2-fold increase in IL-17A production (Figure 7E and Supplementary Figure 6I).

Taken together, these experiments demonstrate that circulating and gut-resident microbiota-reactive CD4+ T cells express increased frequencies of IL-17A in IBD. Intestinal tissues from patients with active IBD express gene modules driven by Th1/Th17-derived cytokines, suggesting that bacteria-reactive memory cells could contribute to the tissue response.

Discussion

The gastrointestinal tract harbours a large and diverse population of commensal bacteria, and how the immune system interacts with them is subject to intense investigation. Here we used two different methodologies to characterise microbiota-reactive CD4+ T cell frequencies and phenotypes in the blood and intestinal tissue of healthy individuals and those with IBD. For each bacterial strain tested, the healthy CD4+ T cell repertoire contains reactive cells at a frequency of 40-4000 per million, consistent with other antigen-reactive memory T cells38. Microbiota-reactive CD4+ T cells were mainly of a memory phenotype, present in both blood and gut tissue, had a diverse TCRVb repertoire, and showed little clonotype sharing. Notably, microbiota-reactive CD4+ T cells were functionally heterogeneous in terms of homing receptor expression and effector functions and could stimulate intestinal cells via production of IL-17A, IFN-g, IL-22, and TNF-a. Moreover, microbiota-reactive CD4+ T cells were recruited to sites of inflammation and showed increased IL-17A production in patients with IBD.

Characterizing T cell responses to bacteria is technically challenging due to their complex antigenic make-up. We therefore used the CD154 and CFSE dilution assays, both of which exploit microbial complexity to provide large numbers of antigens. The combination of CFSE dilution and TCRVb sequencing allowed us to quantify clonotype heterogeneity and sharing between different bacteria-reactive T cells. Given the phylogenetic similarity of several bacteria used in this study, the paucity of clonotype sharing was surprising. Nevertheless, enteric bacteria-reactive T cells could be cross-reactive to other antigens not assessed in this study, and may have been primed during immune responses to other targets39. High interclonal and intraclonal functional heterogeneity in human CD4+ T cell responses to microbes and vaccines was recently observed20. However, clonotype sharing between different microbial stimuli has not previously been studied and requires further investigation.

Microbiota-reactive CD4+ T cells showed substantial phenotypic and functional

heterogeneity. The majority of circulating enteric bacteria-reactive CD4+ T cells co-expressed chemokine receptors including CCR4, CCR6, and CCR7, while a smaller fraction expressed the gut-related homing receptors a4b7 and CCR9. These receptors promote access to secondary lymphoid organs and various mucosal tissues, including the intestine4,28. Furthermore, circulating and gut-resident microbiota-reactive T cells displayed both Th17 and Th1 characteristics, and in some cases produced IL-1040. Gut-resident cells showed a clear Th17 bias when compared to circulating populations, which was more pronounced in IBD.

Based on our observations, we can speculate that continuous sampling of luminal antigens by intestinal DCs causes low-level stimulation of gut-resident CD4+ T cells to produce cytokines that support epithelial integrity, barrier function, and intestinal homeostasis41,42. Indeed, cytokine production by commensal-reactive CD4+ T cells might play a more significant role in supporting gut homeostasis than previously thought (Supplementary Figure 7). However, this homeostatic circuit might be disrupted in IBD due to dysbiotic changes and/or perturbed myeloid cell activity, causing inappropriate T cell activation and a pathogenic imbalance of cytokine production9.

While IL-17A is frequently cited as a pathogenic cytokine, it is also critical for promoting mucosal barrier function and protection from pathogens32. Absence of IL-17A was recently shown to increase epithelial injury and compromise barrier function in mouse models of colitis43,44. Indeed, IL-17A is a critical driver of neutrophil recruitment, and its absence could therefore exacerbate mucosal inflammation by facilitating bacterial invasion and dispersal45. Notably, blockade of IL-17A in CD caused disease exacerbation despite being well tolerated and therapeutically effective in psoriasis46. Thus, IL-17A likely plays a key tissue-protective role in humans, suggesting that the increased Th17 polarization of microbiota-reactive T cells in IBD patients could reflect an effort to bolster tissue integrity.

Host-microbial homeostasis depends on minimising contact between microorganisms and mucosal surfaces via the combined action of epithelial cells, mucus, IgA, antimicrobial peptides,

and immune cells1,2. Active immune responses to gut flora have been linked to disease9. However, this concept should be revisited in light of our current findings and the observation that healthy individuals generate antibody responses to commensals47,48. At least two plausible mechanisms could explain the genesis of these microbiota-reactive responses. First, mucosal dendritic cells constantly survey the luminal microenvironment and thereafter migrate to secondary lymphoid tissues to initiate B and T cell responses49,50. Second, during GI infections in mice, immune responses against commensals and pathogens are induced in parallel51. Thus, continuous luminal sampling of intestinal microbiota and periodic epithelial breaches during gastrointestinal infections might provide a plethora of memory T cells with potential reactivity towards newly encountered pathogens7,8. Therefore, contrary to the notion that they promote inflammatory pathology, acquired commensal-reactive T cell responses may be essential to promote barrier function and IL-10 mediated immune regulation, two cornerstones of intestinal homeostasis.

Acknowledgments

We thank Helen Ferry, Jenny Middleton, Sam Bullers, Sebastian Rogatti Granados, Priya Siddhanathi, James Chivenga, Ngonidzashe Charumbira, Jennifer Hollis, Linda Holden, Fiona Goddard, Karen Doig, Nicole Stoesser, Nicole Gordon and Claire Pearson for FACS sorting, technical support, patient sample collection and lab management. We thank Harry Flint, Carolina V. Arancibia-Cárcamo, Emily Thornton, Tobias Schwerd, David Danko, Arnold Han, Mark Davis, M. Hussein Al-Mossawi, Paul Bowness, and all laboratory members for valuable support and discussions. We also thank Thomas Penz from the Biosequencing Facility at CeMM. We acknowledge the Oxford Radcliffe and GI Biobanks and the Oxford IBD cohort study supported by the NIHR Oxford Biomedical Research Centre (grant no. HBRWAE04 Task HB81.G). We thank all volunteers and patients who took part in this study.

References

1. Littman DR, Pamer EG. Role of the Commensal Microbiota in Normal and Pathogenic Host Immune Responses. Cell Host & Microbe 2011;10:311-323.

2. Macpherson AJ, Slack E, Geuking MB, et al. The mucosal firewalls against commensal intestinal microbes. Semin Immunopathol 2009;31:145-149.

3. Honda K, Littman DR. The microbiome in infectious disease and inflammation. Annu Rev Immunol 2012;30:759-795.

4. Farber DL, Yudanin NA, Restifo NP. Human memory T cells: generation, compartmentalization and homeostasis. Nat Rev Immunol 2014;14:24-35.

5. Belkaid Y, Bouladoux N, Hand TW. Effector and memory T cell responses to commensal bacteria. Trends Immunol 2013;34:299-306.

6. Littman DR, Pamer EG. Role of the commensal microbiota in normal and pathogenic host immune responses. Cell Host Microbe 2011;10:311-323.

7. Su LF, Kidd BA, Han A, et al. Virus-specific CD4(+) memory-phenotype T cells are abundant in unexposed adults. Immunity 2013;38:373-383.

8. Campion SL, Brodie TM, Fischer W, et al. Proteome-wide analysis of HIV-specific naive and memory CD4 +T cells in unexposed blood donors. J Exp Med 2014;211:1273-1280.

9. Maloy KJ, Powrie F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature 2011;474:298-306.

10. Cong Y, Brandwein SL, McCabe RP, et al. CD4+ T cells reactive to enteric bacterial antigens in spontaneously colitic C3H/HeJBir mice: increased T helper cell type 1 response and ability to transfer disease. J Exp Med 1998;187:855-864.

11. Duchmann R, Kaiser I, Hermann E, et al. Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel disease (IBD). Clin Exp Immunol 1995;102:448-455.

12. Duchmann R, May E, Heike M, et al. T cell specificity and cross reactivity towards enterobacteria, bacteroides, bifidobacterium, and antigens from resident intestinal flora in humans. Gut 1999;44:812-818.

13. Ergin A, Syrbe U, Scheer R, et al. Impaired peripheral Th1 CD4+ T cell response to Escherichia coli proteins in patients with Crohn's disease and ankylosing spondylitis. J Clin Immunol. 2011;31:998-1009.

14. Chattopadhyay PK, Yu J, Roederer M. A live-cell assay to detect antigen-specific CD4+ T cells with diverse cytokine profiles. Nat Med 2005;11:1113-1117.

15. Frentsch M, Arbach O, Kirchhoff D, et al. Direct access to CD4+ T cells specific for defined antigens according to CD154 expression. Nat Med 2005;11:1118-1124.

16. Duncan SH, Louis P, Flint HJ. Cultivable bacterial diversity from the human colon. Lett Appl Microbiol 2007;44:343-350.

17. Kostic AD, Xavier RJ, Gevers D. The microbiome in inflammatory bowel disease: current status and the future ahead. Gastroenterology 2014;146:1489-1499.

18. Bosca-Watts MM, Tosca J, Anton R, et al. Pathogenesis of Crohn's disease: Bug or no bug. World J Gastrointest Pathophysiol 2015;6:1-12.

19. Gradel KO, Nielsen HL, Schonheyder HC, et al. Increased short- and long-term risk of inflammatory bowel disease after salmonella or campylobacter gastroenteritis. Gastroenterology 2009; 137:495-501.

20. Becattini S, Becattini S, Latorre D, et al. Functional heterogeneity of human memory CD4+ T cell clones primed by pathogens or vaccines. Science 2015;347:400-406.

21. Zielinski CE, Mele F, Aschenbrenner D, et al. Pathogen-induced human TH17 cells produce IFN-y or IL-10 and are regulated by IL-1ß. Nature 2012;484:514-518.

22. Black GF, Weir RE, Chaguluka SD, et al. Gamma Interferon Responses Induced by a Panel of Recombinant and Purified Mycobacterial Antigens in Healthy, Non-Mycobacterium bovis

BCG-Vaccinated Malawian Young Adults. Clin and Vaccine Immunol 2003;10:602-611.

23. Lindestam Arlehamn CS, Paul S, Mele F, et al. Immunological consequences of intragenus conservation of Mycobacterium tuberculosis T-cell epitopes. Proc Natl Acad Sci U S A 2015;112:E147-55.

24. Matamoros S, Gras-Leguen C, Le Vacon F, et al. Development of intestinal microbiota in infants and its impact on health. Trends Microbiol 2013;21:167-173.

25. Appay V, van Lier RAW, Sallusto F, et al. Phenotype and function of human T lymphocyte subsets: consensus and issues. Cytometry A 2008;73:975-983.

26. Mascher B, Schlenke P, Seyfarth M. Expression and kinetics of cytokines determined by intracellular staining using flow cytometry. J Immunol Methods 1999;223:115-121.

27. Moser B, Loetscher P. Lymphocyte traffic control by chemokines. Nat Immunol 2001;2:123-128.

28. Mueller SN, Gebhardt T, Carbone FR, et al. Memory T Cell Subsets, Migration Patterns, and Tissue Residence. Annu Rev Immunol 2013;31:137-161.

29. Keshav S, Wendt E. CCR9 antagonism: potential in the treatment of Inflammatory Bowel Disease. CEG 2015;Volume 8:119-130.

30. Neurath MF. New targets for mucosal healing and therapy in inflammatory bowel diseases. Mucosal immunol 2014;7:6-19.

31. Kappler J, Kotzin B, Herron L, et al. V beta-specific stimulation of human T cells by staphylococcal toxins. Science 1989;244:811-813.

32. Ouyang W, Kolls JK, Zheng Y. The Biological Functions of T Helper 17 Cell Effector Cytokines in Inflammation. Immunity 2008;28:454-467.

33. Annunziato F, Annunziato F, Cosmi L, et al. Phenotypic and functional features of human Th17 cells. J Exp Med 2007;204:1849-1861.

34. Kleinschek MA, Boniface K, Sadekova S, et al. Circulating and gut-resident human Th17

cells express CD161 and promote intestinal inflammation. J Exp Med 2009;206:525-534.

35. Globig A-M, Hennecke N, Martin B, et al. Comprehensive Intestinal T Helper Cell Profiling Reveals Specific Accumulation of IFN-y+IL-17+Coproducing CD4+ T Cells in Active Inflammatory Bowel Disease. Inflamm Bowel Dis 2014;20:2321-2329.

36. Newman AM, Liu CL, Green MR, et al. Robust enumeration of cell subsets from tissue expression profiles. Nat Methods 2015;12:453-457.

37. Shale M, Schiering C, Powrie F. CD4(+) T-cell subsets in intestinal inflammation. Immunol Rev 2013;252:164-182.

38. Bacher P, Scheffold A. New technologies for monitoring human antigen-specific T cells and regulatory T cells by flow-cytometry. Curr Opin in Pharmacol 2015;23:17-24.

39. Mason D. A very high level of crossreactivity is an essential feature of the T-cell receptor. Immunol Today 1998;19:395-404.

40. Sallusto F. Heterogeneity of Human CD4 +T Cells Against Microbes. Annu Rev Immunol 2016;34:317-334.

41. Blaschitz C, Raffatellu M. Th17 cytokines and the gut mucosal barrier. J Clin Immunol 2010;30:196-203.

42. Sonnenberg GF, Fouser LA, Artis D. Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. Nat Immunol 2011;12:383-390.

43. Maxwell JR, Zhang Y, Brown WA, et al. Differential Roles for Interleukin-23 and Interleukin-17 in Intestinal Immunoregulation. Immunity 2015;43:739-750.

44. Lee JS, Tato CM, Joyce-Shaikh B, et al. Interleukin-23-Independent IL-17 Production Regulates Intestinal Epithelial Permeability. Immunity 2015;43:727-738.

45. Smith AM, Rahman FZ, Hayee B, et al. Disordered macrophage cytokine secretion underlies impaired acute inflammation and bacterial clearance in Crohn's disease. J Exp Med 2009;206:1883-1897.

46. Yang J, Sundrud MS, Skepner J, et al. Targeting Th17 cells in autoimmune diseases. Trends Pharmacol Sci 2014;35:493-500.

47. Palm NW, de Zoete MR, Cullen TW, et al. Immunoglobulin A Coating Identifies Colitogenic Bacteria in Inflammatory Bowel Disease. Cell 2014;158:1000-1010.

48. Zeng MY, Cisalpino D, Varadarajan S, et al. Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens. Immunity 2016;44:647-658.

49. Rescigno M, Urbano M, Valzasina B, et al. Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat Immunol 2001;2:361-367.

50. Macpherson AJ. Induction of Protective IgA by Intestinal Dendritic Cells Carrying Commensal Bacteria. Science 2004;303:1662-1665.

51. Hand TW, Santos Dos LM, Bouladoux N, et al. Acute Gastrointestinal Infection Induces Long-Lived Microbiota-Specific T Cell Responses. Science 2012;337:1553-1556.

Author names in bold designate shared co-first authorship

Figure Legends

Figure 1. Healthy adults possess circulating memory CD4+ T cells that are reactive to intestinal microbiota.

PBMCs were stimulated with heat-inactivated bacteria for 8-12h, and bacteria-reactive CD4+ T cells were detected by intracellular CD154 expression.

(A) Experimental setup.

(B) CD154+ frequencies among peripheral CD4+ T cells in adults after short-term stimulation with heat-inactivated bacteria (n=30 independent donors).

(C) Estimated microbiota-reactive cells per million CD4+ T cells in adult blood (n=30). The numbers of microbiota-reactive T cells were calculated based on the frequencies of CD4CD154+ T cells. Background (no microbe stimulation) was subtracted from bacterial stimulations. Significance calculated in relation to LPS stimulation.

(D) Frequencies (± SEM) of CD154+ cells among CD4+ T cells in adult (n=30) or cord blood (n=3) after short-term stimulation with heat-inactivated bacteria.

(E) Expression of CD45RA on CD4CD154+ T cells, showing four representative stimulations of the same donor.

(F) Mean (± SEM) frequencies of memory cells within CD4CD154+ T cells. Each symbol represents an antigen-reactive population from one individual (n=19-30).

(G) Expression of CD45RA, TNF-a, and IL-2 by CD4+CD154+ T cells after short-term PBMC stimulation with bacterial lysates. Statistics: panels B, C, and F, one-way ANOVA with Sidak's multiple comparison test; panel D, Mann-Whitney test.

Figure 2. Circulating microbiota-reactive CD4+ T cells express several surface molecules that promote mucosal trafficking.

CD4 CD154+ T cells were analysed by flow cytometry after magnetic enrichment following

short-term PBMC stimulation with heat-inactivated bacteria.

(A) Experimental setup and enrichment efficiency after stimulation with SEB.

(B) Representative CD45RA and CCR7 expression on enriched CD4+CD154+ T cells. Central memory T cell frequencies are shown (right bar graph). Frequencies (± SEM) of 4 independent experiments are depicted with n=8 independent donors.

(C) Heat map depicting mean frequencies of surface marker and chemokine receptor expression on enriched CD4CD154+ T cells (n=5-8 independent donors).

(D) Surface marker and chemokine receptor expression frequencies among CD4CD154+ T cells after short-term stimulation with B. animalis. Data representative of 5-8 independent donors.

(E) Co-expression of surface molecules with CCR6 after short-term stimulation of CD4CD154+ CD45RA- T cells with B. animalis (left panel). Boolean gating analysis shows each possible combination of CCR7, CCR4, CCR6, and CD161 expression (right panel).

(F) Surface marker and chemokine receptor expression frequencies among total memory CD4+ T cells and CD4CD154+ T cells after short-term stimulation with B. animalis, S. aureus, M. tuberculosis, C. albicans, or SEB. Frequencies (± SEM) of 4 independent experiments are depicted with n=5-8 independent donors. Statistics: panel F, One-way ANOVA with Sidak's multiple comparison test.

Figure 3. Microbiota-reactive CD4+ T cells are enriched in gut tissue

LPMCs were isolated from non-inflamed and tumour-free surgical specimens from colorectal cancer patients.

(A) Experimental setup. LPMCs were stimulated with heat-inactivated bacteria for 8-12h and assessed for intracellular expression of cytokines and CD154.

(B) Estimated microbiota-reactive cells per million CD4+ T cells in adult blood and intestinal tissue from unrelated donors, based on CD154 staining (n=17 for control mucosa; n=25-31 for blood).

(C) Matched LPMCs and PBMCs were stimulated with heat-inactivated E. coli (blue symbols) or S. typhimurium (red symbols), analysed for CD154 expression, and compared with respect to the estimated microbiota-reactive cells per million CD4+ T cells. Connected dots represent matched samples.

(D) Frequencies (±SEM) of IL-17A, IFN-gLand IL-22 production by CD154+TNF-a+ memory CD4+ T cells isolated from LPMCs or PBMCs from unrelated donors after stimulation with heat-inactivated bacteria (n=10-23 donors). Significance calculated between the respective stimulations in control mucosa and peripheral blood. Statistics: panels B and D, Mann-Whitney test; panel C, paired t-test.

Figure 4. Microbiota-reactive memory CD4+ T cells are clonally diverse and functionally heterogeneous

Memory CD4+ T cells were labelled with CFSE or VPD (violet proliferation dye-450) and stimulated with heat-inactivated bacteria in the presence of autologous monocytes.

(A) CFSE profiles and ICOS expression on days 3 and 6 of stimulation in a representative donor.

(B) Percentage of CFSElow CD4+ T cells of each individual donor (n=18).

(C) Pie charts showing TCRVb expression by proliferating VPDlow cells measured by Vb antibody staining on day 7 of stimulation. Average of three independent donors is depicted. TCRVb usage of the different reactivities of three independent donors is summarized in Supplementary Table 2.

(D) Mean (± SEM) cytokine production frequencies of proliferating CFSElow cells and non-activated CFSEhigh cells after PMA/ionomycin stimulation (n=12-13 independent donors).

(E) Boolean gating analysis showing each possible combination of IL-17A, IFN-g, Land IL-22 production by CFSElow proliferating cells. Data from 9 independent donors.

(F, G) RORgt and T-bet expression in proliferating CFSElow cells measured by intracellular staining on day 7 of stimulation. (G) Boolean gating analysis showing each possible combination of RORgt,

T-bet. and GATA-3 production by CFSElow proliferating cells. Data from 3 independent donors. Statistics: panel B, one-way ANOVA with Sidak's multiple comparison test; panel D, one-way ANOVA with Bonlerroni's multiple comparison test.

Figure 5. Microbiota-reactive memory T cells promote intestinal stromal and epithelial cell activation.

Healthy donor memory CD4+ T cells from peripheral blood were labelled with CFSE and stimulated with heat-inactivated bacteria in the presence of autologous monocytes. CD4+CFSElowICOShighcells were FACS-sorted on day 7 and expanded for 10-14 days with anti-CD3/CD28 beads. Expanded cells were stimulated at equal numbers with PMA/ionomycin for 24h to produce conditioned supernatants.

(A, B) Cell-free supernatants from different T cell specificities was used to stimulate CCDI8C0 intestinal myofibroblasts and LIM1863 colon epithelial cells. Gene expression in stimulated cells was measured by qPCR and normalised to control treatment (media containing PMA/ionomycin alone). Results of independent stimulations were pooled together into the following categories: Proteobacteria-reactive T cells (S. typhimurium- and E. co//'-reactive); Actinobacteria-xeaciwe T cells (B. cinimcilis-reactive); Fir micutes-reactive T cells (/■'. prciusnitzii- and L. acidophilus-reactive). Data are from three independent T cell donors.

(C, D) Supernatants from E. coli-reactive CD4+ T cells were used to stimulate CCDI8C0 (C) or LIM1863 (D) cells. Supernatants were pre-treated with one or more cytokine-neutralizing antibodies as indicated. Gene expression was median-normalized, log2 transformed, and plotted as a heat map. Data representative of 2-3 independent experiments.

(E) Q-PCR analysis of mucosal biopsies from the Oxford IBD cohort, categorised by endoscopic assessment of disease activity. Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 5. Statistics: panels A, B, and E, One-way ANOVA with

Sidak's multiple comparison test.

Figure 6. Abundance of circulating and gut-resident enteric bacteria-reactive CD4+ T cells in IBD

(A) PBMCs from healthy donors or IBD patients were stimulated with the indicated heat-inactivated bacteria and analyzed for CD154 expression. Frequencies (± SEM) of CD154+ cells among CD4+ T cells are depicted (n=30-38). Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 6.

(B) LPMCs were isolated from inflamed surgical specimens from IBD patients or non-inflamed and tumour-free surgical specimens from colorectal cancer patients. Isolated LPMCs were stimulated with the indicated heat-inactivated bacteria and analysed for CD154 expression. Frequencies (± SEM) of CD154+ cells among CD4+ T cells are depicted (n=10-20).

(C) LPMCs from endoscopic intestinal biopsies were obtained from healthy controls or matched lesional and non-lesional sites of IBD patients from an independent Oxford cohort (n=12 controls and 17 IBD). Dots represent frequencies of CD45RA-CD4+ memory T cells among total live LPMCs from different donors; connected dots represent matched biopsies. Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 7. Statistics: panels A, B and C, Mann-Whitney test; panel C, one-way ANOVA with Sidak's multiple comparison test.

Figure 7. Microbiota-reactive CD4+ T cells show a Th17-skewed phenotype in IBD patients.

(A-B) PBMCs isolated from healthy donors and IBD patients were stimulated with heat-inactivated bacteria or SEB and analysed for intracellular CD154 and cytokine expression. (A) Frequencies (± SEM) of IL-17A, IFN-g, and IL-22 expression in CD154+TNF-a+ memory CD4+ T cells (n=23-33 independent donors). Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 6.

(B) Frequencies (± SEM) of IL-17A and IFN-g co-expression in CD154+TNF-a+ memory CD4+ T cells after short-term stimulation with heat-inactivated bacteria (n=23-34 independent donors).

(C) LPMCs from inflamed IBD surgical specimens or non-inflamed and tumour-free surgical specimens from colorectal cancer patients were stimulated with heat-inactivated E. coli. Boolean gating shows each possible combination of IL-17A, IFN-g, Land IL-22 production by CD154TNF -a memory CD4+ T cells (n=6 and n=7 independent donors for IBD and controls, respectively).

(D) Q-PCR analysis of IL1B, IL6, and IL23A in intestinal mucosal specimens categorised by endoscopic assessment of disease activity. Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 5.

(E) CD4 CD45RO CD45RA-CD25-CD8- memory CD4+ T cells were isolated from healthy donor blood, labelled with CFSE, and stimulated with autologous monocytes pulsed with B. animalis in the presence or absence of the indicated cytokines. Data represent mean (± SEM) fold changes in IL-17A or IFN-y expression frequencies relative to cells expanded without cytokines. Statistics: panels A, B and C, Mann-Whitney test; panels D and E, one-way ANOVA with Sidak's multiple comparison test.

Firmicufes

Bacteroidetes Proteobacteria Actinobacteria

+ Bacterial lysate

8-16h + BFA

Multicolor Intracellular flow cytometry

—stain—>. (Detection of

surface molecules)

Co 1Ü1 o^ :

ÜL 1n

o : if

^ Ü.Ü1 "!

o ■ Ü.ÜÜ1-

Q Ü.ÜÜÜ1-O :

"1 I I I I I T

**** *** ****** ** ** ** *

v X' <?-'

> lu o °1Ü3-

ra OiÜ2i

£5 — 1 Ü1 J

**** *** ******** ** * *

0.08-, 0.060.040.020

E. coli

SEB S. aureus M. tuberculosis C. albicans

I-, ns 0.15-, ««« 0.15-, «««

' ^ PI 0.10- ■ 0.100.05 H 0.05- I

U 1 J_

0.15-,

■ Adult blood □ Cord blood

E. coli

B. anisalis

Ü 102 1Ü3 1Ü4 1Ü5 F. prausnitzii

Ü 102 1Ü3 1Ü4 1Ü5

Ü 1Ü2 1Ü3 104 1Ü5

CD45RA ICD154+ CD4+ T cells Total CD4+ T cells

1009080-C? 70-^ 60-O 50-

Üj 4Ü 2 3020100

I i i r I I I

~ i i i i

G gated on CD4+CD154+ T cells

!. animalis L. acidophilus F. prausnitzii

3.09 0.99

:|jf 57.7 S 38.2

7.6 2.63

29.2 -V-60.5

6.25 0

43.8 50

32.1 ■:f§f 8.31

25.1 34.5

□□□□□ □□□□□ □□□□□ □□□□□ □□□□□ □□□□□

□ ID

■f-з ч3

(D (Л

•Ö s

С (/> 3

p ÇJO

ffl ffl

a о 3'

•ö ш

g- й'

И|-'Ч Q Q

Imitai

» » a a-ö'

S go a So

CD45RA

CD45RA

CD45RA

m ■■, r'i

ms s ' •"'" ■ г Z ^ 1

(Я о

CCR7+ of CD45RA" CD4 T cells (%) ^

Firmicutem

Bacteroidetes ProteeO&cieria Actinobacteria + Bacterial lysate

8-16h +BFA

Multicolor flow cytometry

(Detection of intracellular cytokines and surface molecules)

E. coli

6000-, 500040003000200010000

B. animalis L. acidophilus

400 n * 1500-,

300- t T

1000200 ■ __

100 H rS 500" I

_!=!. M 0 M H

(0.057)

300 250 200 150 100 50 0

F. prausnitzii B. vulgatus

200- T 200- 1

150- ^B 150- I

100- 100- I

——I——| 50- 50- I

_Q qMFi 0.M

250-, 200150100500

R. intestinalis R. obeum

1600 „ 1400 ' 12001000800600- I

400200-1 | 0 -

40000-, 30000- T 20000- __ 10000- I 0-L^-l--

SEB ns

2500-, 20001500-

S. aureus ns

~r 1000-

1000-, 8006004002000-

2000150010005000

■ Control mucosa (n=17) □ Peripheral blood (n=25-31)

Peripheral blood

Mucosal

/ ^ *

• •

Microbiota-reactive cells /106 CD4+ cells

IL-17A

M. tuberculosis C. albicans

** 2500-,

ns ns ns ns J i ns ns

3020100

908070605040302010-0^

ns 5 ns

■ Control mucosa

□ Peripheral blood

ns « ns ns ns ns ns ns « ns

no microbe

E. coli B. animalis L. acidophilus SEB

6 ■■

E. coli

B. animalis

o ir D

■ TRBV9 ■TRBV20-1 ■TRBV28 «TRBV29-1 BTRBV5-1

□ TRBV5-6 BTRBV5-5 «TRBV4-1.2.3 ÜTRBV4-3 «TRBV12-3.4

□ TRBV3-1 ÜTRBV25-1 BTRBV10-3 «TRBV6-5.6.9 DTRBV6-2

■ TRBV6-6 OTRBV27 ÜTRBV14 ÜTRBV19 DTRBV18

□ TRBV30 ÜTRBV11-2 ÜTRBV2 ÜTRBV13 DUnkown TRBV

E coli B. animalis SEB

L. acidophilus F. prausnitzii

IL-17A + IFN-y + IL-22 +

-- + +-+ - + - + -

E. coli

B. animalis

72.6 I 26.3

0 102 103 10' 105

46.3 0.8

27.2 25.7

17.1 (A 0.37

w 31.5 1 51

0 102 103 104 105

18.6 0.35

w 29.9 51.1

5.8 0.7

15.5 • 78

0 102 103 104 105

9.35 0.5

11.9 78.3

100-, 8060-

8 40^ 5 20 -I

IL-17A

100-, 806040200

50-, 403020100

100-i 80604020025 1 2015-

° O ° _ 1n 0 „ ° 10

o e °

° 8 8 e e

CO CO CO CO CO c c c c c

\x v x

G E. coli B. animalis SEB

RORYt + + + +----T-bet + +--++--GATA-3 + - + - + - + -

ACCEPTED MANUSCRIPT

CXCL10

CXCL11

□ Control treated

■ SEB expanded T cells

■ Proteobacteria-reactive T cells

□ Actinobacteria-reactive T cells I Firmicutes-reactive T cells

CXCL1 CXCL5 CXCL8

s ns 1 5"| ns * 8"| ns ns

CXCL8 CXCL9

CXCL10

CXCL11

alFN-y aIL-22 aIL-17A aTNF-a

CXCL10

CXCL11

1 CCL2

TNF CXCL5 CXCL2 CXCL1 CXCL3 MUC1 CXCL8 IL6

CCD18co

IL-17A-/TNF-a-dependent module |IFN-y-dependent module

CXCL10

CXCL11

20-i 15105-¡1

• W 3B 0-

• ¥ f -5

—s--10-1

86420-■ -2-

o Controls (n=9)

• Active IBD, lesional site (n=30)

• Active IBD, uninvolved site (n=20) o IBD, remission (n=14)

E. coli B. animalis L. acidophilus

0.06n **** 0.03 n **** 0.03 n *** 0.04 M 0.02- M 0.02- ■

0.02- ^ 0.01 - ^T 0.01 - I

0.00^^^-^®- 0.00 l^B—o.ool^B_^B-F. prausnitzii B. vulgatus R. intestinalis

0.015t *** 0.015n *** 0.008n **** 0

L 0.006- 0 0.010- -p

0.004 ^H 0

0.005- I

I ^^ 0.002- ^^ o ....... 0 0

R. obeum

S. aureus M. tuberculosis C. albicans

Uo.U-u:u

■ Control (n=30)

■ IBD (n=38)

E. coli B. animalis L. acidophilus

0. 5-1 ns 0. 04 ns 0 . 03 ns

0.4 0.3 0.2 0.1 0.0

0.01- ■

-o.oo-L^®—^

F. prausnitzii B. vulgatus

R. intestinalis

R. obeum

S. aureus

M. tuberculosis C. albicans

0.020-1 ns 0.25-1 ns

0.20- T

IM " ill

0.10- ■

0.05- I

-L 0.00

■ Control mucosa (n=17-20) [1 Inflamed mucosa (n=10-15)

Hl 40e

= 30 ta

° 20 <

o Controls (n=13)

• Active IBD, lesional site (n=15)

• Active IBD, uninvolved site (n=15)

E. coli

70 IL-17A 100

60- **** 90

50- o °° 70

40- ° A 60

□ M 50

30- al° Sgl 40

20- 30

10- 10

70- IL-17A 100

60- ns 90

50- g0 70

40- 60

30- a 40

20- / 30

M. S 20

10- M Ä 10

™ Ba

E. coli

■ Controls (n=23) □ IBD (n=33)

E. coli

Control mucosa Inflamed mucosa

TNF-a + + + + + + IL-17A + + + + --IFN-y ++--+ + IL-22 + - + - + -

IL-17A+ IFN-y- 60n ****

• 5040-

••* 30-

V — 20-

— • _ ifil

• 50

. 40 it 30

• ••

• s 30-

\ V* 20

is 10 * ^ 0

IL-17A+IFN-y* g0 IL-17A-IFN-y*

• Controls (n

• IBD (n=34)

10-, g-

6420-2-

O Controls (n=9)

• Active IBD, lesional site (n=30)

• Active IBD, uninvolved site (n=20) O IBD, remission (n=14)

10-, g-

6420-2-

5t§ 1

. 0.5-

IL-1 ß -IL-6 -IL-23 -

IL-17A

- - + + - + - + +

ns ns ns ns

--+-+ ---++

L-17A+ IFN-y

L-17A- IFN-y*

L-17A+ IFN-

Supplemental Information

Induction of Local and Systemic CD4+ T-cell Responses to Intestinal Microbes in Healthy Individuals and Alterations in Patients With Inflammatory Bowel Diseases

Ahmed N. Hegazy*, Nathaniel R. West*, Michael J. T. Stubbington, Emily Wendt, Kim Suijker, Angeliki Datsi, Sebastien This, Camille Danne, Suzanne Campion, Sylvia Duncan, Benjamin M. J. Owens, Holm H. Uhlig, Andrew McMichael, Oxford IBD Cohort Investigators, Andreas Bergthaler, Sarah A. Teichmann, Satish Keshav, Fiona Powrie#

*Co-first authors #Corresponding author

Supplemental Figure Legends

Supplementary Figure 1. Bacterial strains used in the study and detection of enteric bacteria-specific memory CD4+ T cells (related to Figure 1)

(A) Bacterial species are listed according to their family and phylum classification. Coloured circles relate the bacteria to their gaseous requirement.

(B) Frequencies of CD154+ cells among peripheral CD4+ T cells in adults after short-term stimulation with heat-inactivated bacteria. Dots represent different donors (n=30).

(C) Representative flow cytometric plots of different stimulations showing CD154 expression against CD4 within CD3+ cells after short-term stimulation with heat-inactivated bacteria. Frequencies of CD154 within CD4+ T cells are depicted.

(D) Representative plot of CD69 and ICOS expression on CD4+CD154+ T cells after short-term stimulation with heat-inactivated S. typhimurium.

(E) PBMCs were stimulated with the indicated heat-inactivated bacteria in presence or absence of MHC-II blocking antibodies and analysed for CD154 expression. Percentage of reduction in CD154+ frequencies after MHCII blockade compared to control treated is depicted. Frequencies (± SEM) of 3 independent experiments is depicted (n=5-6 independent donors).

(F) Estimated microbiota-reactive cells per million CD4+ T cells in adult blood (n=30). The numbers of microbiota-reactive T cells were calculated based on the frequencies of CD4+CD154+ T cells. Background (no microbe stimulation) was subtracted from bacterial stimulations. Significance calculated in relation to LPS stimulation.

(G) Frequencies ± SEM of CD154+ cells among CD4+ T cells in adult (n=30) or cord blood (n=3) after short-term stimulation with heat-inactivated bacteria.

Statistics: panels E and G, Mann-Whitney test; C, and F, panel F, one-way ANOVA with Sidak's multiple comparison test; ns, not significant; * P<0.05; ** P<0.01; *** P<0.001; **** p<0.0001.

Supplementary Figure 2. Detection and characterisation of microbiota-specific memory CD4+ T cells (related to Figure 1 and 2)

(A) Frequencies of CD154+ cells among naïve and memory peripheral CD4+ T cells in adults after short-term stimulation with heat-inactivated bacteria. Dots represent different donors (n=30).

(B) Percentage of memory cells within CD4+CD154+ T cells. Each symbol represents an antigen-reactive population from one individual; the line indicates the mean of experiments performed independently with blood obtained at different times (n=19-30). Significance calculated in relation to total CD4+ T cells.

(C) Percentages of cytokine-expressing cells among memory CD4+CD45RA-CD154+ T cells are shown. Frequencies (± SEM) of 27 independent donors are depicted.

(D) Surface marker and chemokine receptor expression frequencies among CD4+ CD45RA- CD154+ and CD4+ CD45RA- CD154- T cells after short-term stimulation with B. animalis. Frequencies within CD4+ CD45RA- CD154+ or CD4+ CD45RA- CD154- T cells are depicted.

Statistics: panel A, Mann-Whitney tests; panels B, One-way ANOVA with Sidak's multiple comparison test; ns, not significant; * P<0.05; ** P<0.01; *** P<0.001; **** P<0.0001.

Supplementary Figure 3. Detection and characterisation of microbiota-specific CD4+ T cells within gut-resident memory T cells (related to Figure 3)

(A) Representative flow cytometry plots showing CD45RA, Integrin b7, CD69, CCR7, and CD127 expression in gut-resident CD3+CD4+ T cells. Data representative of ten independent

donors.

(B, C) Gating strategy for identification of enteric bacteria-specific memory CD4+ T cells in LPMCs and PBMCs after stimulation with heat-inactivated E. coli in a representative donor. (D) LPMCs were stimulated with heat-inactivated bacteria and analysed for CD154 expression. Estimated gut resident microbiota-reactive cells per million CD4+ T cells compared with adult blood is depicted (n=17 for control mucosa; n=25-31 for blood). (E, F) Cytokine production by CD4+CD154+TNF-a+ T cells after short-term stimulation with the indicated heat-inactivated bacteria. Frequencies (± SEM) of 10-23 independent donors. Significance calculated between the respective stimulations in control mucosa and peripheral blood.

Statistics: panel D, E and F, Mann-Whitney test; ns, not significant; *P<0.05; ** P<0.01; *** P<0.001; **** P<0.0001.

Supplementary Figure 4. Expansion and detection of microbiota-specific memory CD4+ T cells (related to Figure 4)

Total memory CD4+ T cells were isolated, labelled with CFSE and cultured with autologous irradiated monocytes in the presence or absence of the indicated heat-inactivated bacteria and blocking antibodies to MHCII.

(A) Experimental setup.

(B) Shown are the CFSE profiles and ICOS expression on days 3 and 6 of stimulation in a representative donor.

(C) Frequencies (± SEM) of CFSElow proliferating cells after stimulation with S. aureus and M. tuberculosis (n=5-21). Data representative of 5-10 independent experiments. Each dot represents an independent donor.

(D) Frequencies (± SEM) of CFSElow proliferating CD4+ T cells in presence or absence of anti-MHC-II. Data representative of two independent experiments.

(E, F) CFSE profiles and expression of CD25 and 0X40 on day 6 of stimulation in a

representative donor. (F) Geometric mean and frequencies (± SEM) of ICOS, CD25, and 0X40 expression on CFSElowCD4+ T cells on day 6.

(G) Number of unique TCRb clonotypes detected in bacteria-reactive CD4+ T cells. TCRVb sequencing was performed from 3 independent donors. Each circle represents an independent donor. TCRVb usage of the different reactivities of three independent donors is summarized in Supplementary Table 3.

(H) Heat map showing the frequency of shared clonotypes between different bacteria-reactive CD4+ T cell responses. SEB and PHA expanded memory T cells were used as controls. Data from 3 independent donors. The CDR3 sequences are summarized in Supplementary Table 4. Statistics: panels C, D and F, One-way ANOVA with Sidak's multiple comparison test; ns, not significant; * P<0.05; ** P<0.01; *** P<0.001; **** P<0.0001.

Supplementary Figure 5. Cross-reactivity, cytokine production and transcription factor expression by antigen-reactive memory CD4+ T cells (related to Figure 5)

(A) CD154+ memory CD4 T cells from PBMCs were sorted after short-term stimulation with E. coli and B. animalis lysates and expanded them for 10-14 days with CD3/CD28 and IL-2. The E. coli Nissle- and B. animalis-reactive T cell lines were CFSE-labelled and then co-incubated with autologous monocytes loaded with the various bacterial lysates. Frequencies (± SEM) of CFSElow proliferating cells after 5 days of stimulation with the indicated bacteria are shown. Data from 3-6 independent donors.

(B-F) Total memory CD4+ T cells were isolated, labelled with CFSE and cultured with autologous irradiated monocytes in the presence of the indicated heat-inactivated bacteria or antigens.

(B, C) Production of cytokines by proliferating CFSE low cells measured by intracellular staining after PMA/Ionomycin stimulation on day 7 of primary stimulation with monocytes and heat-inactivated bacteria. Frequencies (± SEM) of 3-13 independent donors are depicted. Each dot represents an independent donor.

(D, E) RORyt, T-bet and GATA-3 expression on day 7 of primary stimulation with monocytes and influenza seasonal vaccination or heat-inactivated S. aureus in a representative donor.

(E) Boolean gating analysis showing each possible combination of RORyt T-bet and GATA-3 production by CFSElow proliferating cells. Data generated from 3 independent donors.

(F) Production of IL-10 by expanded CFSElow CD4+ cells after PMA/Ionomycin stimulation. Frequencies (± SEM) and IFN-y / IL-17A co-expression within IL-10+ and IL-10" cells are depicted from 5-8 independent donors.

Statistics: panels A, C, One-way ANOVA with Sidak's multiple comparison test; panel F, Kruskal-Wallis test with Dunn's multiple comparison; ns, not significant; *** P<0.001; **** P<0.0001.

Supplementary Figure 6. Functional characteristics of enteric bacteria-reactive CD4+ T cells in IBD (related to Figure 7)

(A) PBMCs isolated from healthy donors or IBD patients were stimulated with the indicated heat-inactivated bacteria and analysed for CD 154 expression. Frequencies (± SEM) of reactive CD154+ cells among CD4+ T cells in peripheral blood are depicted (n=30-38). Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 6.

(B) LPMCs were isolated from inflamed surgical specimens from IBD patients or non-inflamed and tumour-free surgical specimens from colorectal cancer patients. Isolated LPMCs were stimulated with the indicated heat-inactivated bacteria and analysed for CD154 expression. Frequencies (± SEM) of reactive CD154+ TNF-a+ cells among CD4+ T cells in peripheral blood are depicted (n=10-20).

(C) Microarray analysis of intestinal biopsies obtained at endoscopy (n=6 controls, 24 UC and 37 CD; Gene Expression Omnibus entry GSE16879). The relative abundance of memory CD4+ T cells in control and inflamed IBD tissue was estimated in silico using CIBERSORT

(see Supplementary Methods for details).

(D-F) PBMCs isolated from healthy and IBD patients were stimulated with the indicated heat-inactivated bacteria or SEB and analysed for CD154 expression and intracellular cytokine expression. Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 6.

(D) IL-2 expression in CD154+ TNF-a+ memory CD4+ T cells after stimulation with the indicated heat-inactivated bacteria or SEB. Frequencies (± SEM) of 23-33 independent donors. Each dot represent an independent donor.

(E, F) IL-17A, IFN-g, IL-22, and IL-2 expression in CD154+ TNF-a + memory CD4+ T cells after stimulation with the indicated heat-inactivated bacteria. Each dot represents an independent donor. Demographic and clinical characteristics of IBD patients are summarized in Supplementary Table 6.

(G) IL-17A expression in CD154+ TNF-a + memory CD4+ T cells after stimulation with S. typhimurium. IBD patients were categorised by disease phenotype (UC, CD), disease activity according to clinical notes, and current treatment.

(H) Total memory CD4+ T cells were isolated from healthy controls or IBD patients blood, labelled with CFSE and cultured with autologous irradiated monocytes in the presence of the indicated heat-inactivated bacteria or antigens. Production of IL-10 by expanded CFSElow CD4+ cells after PMA/Ionomycin stimulation on day 7 of stimulation. Frequencies (± SEM) are depicted from 9-11 independent donors.

(I) CD4+CD45RO+CD45RA-CD25-CD8- memory CD4+ T cells were isolated from healthy controls or IBD patients blood, labelled with CFSE, and stimulated with autologous monocytes pulsed with B. animalis in the presence or absence of the indicated cytokines. Data represent mean (± SEM) fold changes in IL-17A or IFN-y expression frequencies relative to cells expanded without cytokines.

Statistics: panels A-E and G-H, Mann-Whitney test; panel F, One-way ANOVA with Sidak's

multiple comparison test; ns, not significant; * P<0.05; ** P<0.01; *** P<0.001; **** P<0.0001.

Supplementary Figure 7. Microbiota-specific memory T cell responses in intestinal homeostasis and inflammation

Microbiota-specific memory CD4+ T cells are abundant in peripheral blood and mucosa. Luminal sampling of intestinal microbiota by dendritic cells and repetitive epithelial breaches after birth might induce CD4+ T cell responses targeted towards intestinal bacteria. Enteric bacteria-specific CD4+ T cells produce barrier-protective cytokines such as IL-17A, IFN-g and IL-22. Furthermore, certain commensal-specific CD4+ T cells also produce IL-10. We speculate that the cytokine production by commensal-specific CD4+ T cells might play a significant role in supporting gut homeostasis and the mutualistic relationship with intestinal microbiota. In inflammation, epithelial break down and leakage leads to increased availability of luminal antigens and bacterial stimuli, which activate the innate system and the expression of Th17 inducing cytokines (IL-1b, IL-6 and IL-23). Recruited microbiota-specific memory CD4+ T cells accumulate in inflamed mucosa and are polarised towards more IL-17A production. Activated memory cells express IL-17A, TNF-a, and IFN-g, which stimulate intestinal cells such as stromal and epithelial cells to express various chemokine ligands and cytokines. This may promote recruitment and activation of myeloid cell populations.

Supplemental Tables

Supplementary Table 1. Table S1. Enteric bacterial species and control species used in the study (related to Figure 1).

Supplementary Table 2. T cell receptor (TCR) VP usage in expanded microbiota-reactive T cells measured by VP antibody panel from Beckman Coulter (related to Figure 3). Supplementary Table 3. T cell receptor (TCR) VP usage in expanded microbiota-reactive T cells using multiplex PCR assay and deep sequencing (related to Figure 3). Supplementary Table 4. CDR3 sequences of microbiota-reactive memory CD4+ T cells (related to Figure 3).

Supplementary Table 5. Clinical characteristics of Oxford cohort patients assessed in this study for gene expression analysis. (related to Figure 5E and 7D).

Supplementary Table 6. Clinical characteristics of Oxford cohort patients assessed in this study for the analysis of microbiota-specific CD4 T cells. (related to Figure 7A, B, and Supplementary 6A-H).

Supplementary Table 7. Clinical characteristics of Oxford cohort patients assessed in this study for cell accumulation in the mucosa. (related to Figure 3B, C and Figure 7C).

Supplemental Experimental Procedures

Human Samples and Cell Isolation. Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque (GE Healthcare Life Sciences) density gradient centrifugation, resuspended in PBS with 2mM EDTA and 0.02% BSA, and further processed. Gut specimens were obtained from patients with IBD undergoing surgery for severe, chronically active, or complicated disease. Control gut specimens from macroscopically healthy areas were collected from colorectal cancer patients as non-inflammatory controls. One intestinal pinch biopsy was obtained from healthy donors (Colorectal cancer screening, or other non-IBD related conditions) or IBD patients during routine endoscopy, from lesional, and non-lesional sites, attending the John Radcliffe Hospital (Oxford, UK). Inflammation status of biopsies was binarized into either inflamed or uninflamed categories based on endoscopic assessment. Further information about the analysed IBD patients can be found in Supplementary Table 5, Supplementary Table 6, and Supplementary Table 7.

LPMCs were isolated as described1. In brief, mucosa was dissected and washed in 1 mM DTT at room temperature for 15 min to remove mucus. Specimens were washed three times with 0.75 mM EDTA at 37°C for 45 min to detach epithelial crypts and digested overnight with 0.1 mg/ml collagenase D (Roche). Cells were centrifuged for 30 min in a Percoll gradient and collected at the 40-60% interface. All solutions were supplemented with antibiotics (penicillin/streptomycin, 40 (ig/ml gentamicin, and 0.025 (xg/ml amphotericin B). Flow Cytometry. Cells were stained with the following monoclonal antibodies as described2: CD4-BV510 (OKT4), CD4 PE-Dazzle (RPA-T4), CD3-PE-CF594 or -BV510 (UCHT1), CD45RA-BV711 (HI100), CD45RO-BV570 (UCHL1), CD161-eF450 (HP3G10), CCR7-PE (G034H7), CCR2-APC (K036C2), CCR6-BV605 (G034E3), CCR9-PE-Cy7 (L053E8), CXCR3-PE/Cy5 (1C6/CXCR3), CCR4-PE-Cy7 (1G1), CCR10-PE (314305), Integrin □ 7-FITC/APC (FIB504), CD69-PE-Cy7 (FN50), IL-2-BV650 (MQ1-17H12), TNF-D-PB (MAbll), CD 154-FITC/PE-Cy5 (24-31), IL-17A BV711 (eBio64DEC17), IL-22-PE-Cy7

(22URTI), IFN-g-AF700 (B27), GM-CSF-APC (BVD2-21C11), IL-4-PE (8D4-8) (eBioscience, Biolegend and Becton Dickinson). FACS panels contained up to 12 fluorochromes. Compensation beads were used for compensations (BDBioscience). TCRVb usage was assessed using the IOTest Beta Mark TCR Vbeta Repertoire Kit (Beckman Coulter). Samples were acquired on FACS LSRFortessa and FACSLSRII (Becton Dickinson); >2x105 memory CD4+ T cells were acquired. Data were analysed with FlowJo (Tree Star) and SPICE. For analysis of cytokine expression by microbiota-specific T cells, a minimum of 20 CD4+ CD154+ TNF-a + T cells was used; donors with lower events were excluded.

CD154 Enrichment of Antigen-specific T Cells. For MACS enrichment of CD4+CD154+ T cells, CD154 Enrichment and Detection Kit was used (Miltenyi Biotec). Briefly, cells were plated at 5x106/cm2 for 7-12 h with heat-inactivated bacteria in the presence of anti-CD40 blocking antibody (HB14) and anti-CD28 stimulation antibody (CD28.6). Anti-CD40 blockade prevents down-regulation of CD154, while CD28 co-stimulation optimizes induction of CD154 expression. For MHCII blockade, 10 ^g/ml of a pan-HLA class-II blocking antibody (HLA-DR, DP, DQ; (Tu39)) was added 30 minutes before bacterial stimulation. Cord and adult blood analysis was performed identically. Antigen-presenting cell (APCs) abundance is similar in cord and adult blood3,4.

Cross Reactivity Assay. CD154+ CD4+ T cells were isolated using MACS enrichment and FACS sorting from total PBMCs after stimulation with E. coli Nissle and B. animalis lysates as described above. CD154+ CD4+ T cells were expanded for 10-14 days with IL-2 and anti-CD3/CD28 beads (beads/T cell ratio, 1:4, Dynals). The expanded T cell lines were washed in IL-2 free medium and incubated for 12h without IL-2 in RPMI-1640 supplemented with 2 mM glutamine, 1% (v/v) non-essential amino acids, 1% (v/v) sodium pyruvate, penicillin (50 U/ml), streptomycin (50 mg/ml; all from Invitrogen) and 5% (v/v) human serum (National Blood Service, Bristol, UK). The expanded T cell lines were labelled with CFSE, and then

were co-incubated with autologous monocytes loaded with various bacterial lysates. T cells were co-cultured with the irradiated autologous monocytes at a ratio of 2:1 for 5-7 days. The CFSE dilution was measured at the end of the culture. Autologous CD14+ monocytes were isolated from PBMC using anti-CD14 microbeads (Miltenyi Biotec) and frozen until the T cell co-culture. Monocytes were thawed down, irradiated (45 Gy) and then pre-incubated for 3 h with bacterial lysates before T-cell co-culture.

Intracellular Cytokine Analysis. For intracellular cytokine staining, cells were restimulated with PMA (5 ng/ml) and ionomycin (500 ng/ml; Sigma) or bacterial lysates. 5 ^g/ml brefeldin A (Sigma-Aldrich) was added at 2 h. After 4-12 h, cells were stained with fixable viability dye eFluor® 780 (eBioscience) and surface markers, fixed with 2% formaldehyde (Merck), and stained for cytokines in buffer containing 0.05% saponin (Sigma-Aldrich). In some assays, cytokine analysis was combined with intracellular CD154 detection as described5,6. Transcription Factors Staining. Transcription factor expression was analysed using the FoxP3 staining buffer set (eBioscience) according to manufacturer's instructions. Briefly, cells were stained with fixable viability dye eFluor® 780 (eBioscience) and surface markers, fixed with 1x Fixation/Permeabilization buffer, followed by antibody staining and washing in 1x permeabilization buffer. Tbet-Pacific Blue (4B10) and GATA-3-Alexa-647 (TWAJ) were from eBioscience. RORgt-PE (Q21-559) was from BDBioscience.

Preparation of Bacterial Lysates. Different bacteria were cultured in their respective optimal media for 16h at 37 °C, washed in sterile PBS and heat-inactivated at 65 °C for 1 hour, followed by three freeze-thaw cycles. Extremely oxygen sensitive bacteria were provided by Sylvia Duncan, University of Abeerden, after heat-inactivation. Suspensions were centrifuged at max speed for 15 min and supernatants collected. Protein concentration was quantified using Nanodrop (Thermo Fisher Scientific). The following bacterial strains were used: Bacteroides vulgatus (Bv 1447), Bifidobacterium animalis subsp. lactis Bi-07, Clostridium difficile (OXF1003, Toxin AB-), E. coli (Nissle 1917), Faecalibacterium

prauznitzii (A2-165), Lactobacillus acidophilus (NCFM), Roseburia intestinalis (M50/1), Ruminococcus obeum (A2-162), Salmonella enterica serovar typhimurium (NCTC 12023), Staphylococcus aureus (NCTC 6571). Further information regarding the bacterial stains is in Supplementary Table 1. Bacterial lysates were titrated in CFSE dilution assay and an optimal concentration was used (5-15 (ig/ml). Tetanus Toxoid (Calbiochem) and influenza seasonal vaccine (OPTAFLU, Novartis) were used at 5 ^g/ml. Heat-killed Mycobacterium tuberculosis (H37Ra) and Candida albicans were from InvivoGen. Ultrapure LPS-EB from E. coli 0111 :B4 (InvivoGen) was used as a stimulation control. SEB was used at 1 mg/ml (Sigma).

RNA Extraction, cDNA Synthesis and qPCR. Tissue was homogenized using a motor with sterile RNase/DNase-free disposable pestles (both VWR) in RLT buffer (QIAGEN). Cells were lysed directly in RLT buffer. RNA was isolated using RNeasy Mini kit (QIAGEN) or Quick-RNATM MiniPrep kit (Zymo Research, Irvine, USA) followed by cDNA preparation using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) with random hexamers. Q-PCR was performed using a CFX96 (Bio-Rad) or ViiA7 384-well real-time PCR system (Applied Biosystems) with TaqMan assays (Life Technologies) and PrecisionPLUS Mastermix (Primerdesign). Expression levels were normalized to a house-keeping (hk) gene (RPLP0) and expressed as 2A-(CTgene-CThk). Heat maps were made using Cluster 3.0 and Java TreeView (Michael Eisen, Stanford University).

CIBERSORT Analysis. To calculate enrichment of cell populations using CIBERSORT7, we analyzed the GSE16879 dataset on default settings. For each sample, relative expression of PTPRC (CD45, representing relative leukocyte content) was calculated separately using median-normalized microarray data. This value was then multiplied by CIBERSORT cell type scores (e.g. proportion of memory CD4+ T cells in the total leukocyte fraction) to estimate cell type enrichment levels. Finally, for cell types of interest, fold differences between IBD and control specimens were calculated to estimate relative cell type abundance

in active IBD lesions versus healthy tissue.

TCRVb Sequencing and Analysis. Memory T cells (3.6x106) were cultured with autologous monocytes pulsed with heat-inactivated bacteria from three healthy donors. Expanded CFSElow ICOS+CD4+ T cells were sorted into DNase/RNase free water with BSA (10 mg/ml) in 96 well plates (100 cells/well) and stored at -80°C. TCRVb sequence analysis was obtained by a series of three nested PCR reactions as described previously8. Reverse transcription and preamplification were performed with a One-Step RT-PCR kit (Qiagen) using multiplex PCR with multiple Vb region primers and a Cb region primer. After the first reaction, an aliquot was used for the second PCR using a set of multiple internally nested TCRVb primers and internally nested Cb region primer with HotStarTaq DNA polymerase kit (Qiagen). In the final PCR reaction, an aliquot of the second PCR was used and amplification was performed using barcoding primers containing the common 23 base sequence (incorporated into the second set of Vb primers) and a third internally nested Cb primer and Illumina Pair-End primers. After the third PCR reaction, each PCR product should have a unique set of barcodes incorporated that specifies plate, row and column and have Illumina Paired-End sequences that enabled sequencing on the Illumina MiSeq platform. The PCR products were combined at equal proportion by volume, run on a 1.2% agarose gel, and a band around 350 to 380 bp was excised and gel purified using a Qiaquick gel extraction kit (Qiagen). Barcoded products were sequenced on the Illumina MiSeq platform.

Sequence reads were trimmed using 'Trim Galore' software (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) with default settings. Reads were demultiplexed using a custom Python script according to the presence of index sequences. A further custom script then split reads from each well according to the presence of primer sequences used in the PCR amplification. These reads were then analysed by MICXR v1.6 (ref to http://www.nature.com/nmeth/journal/v12/n5/full/nmeth.3364.html)

using settings appropriate for the anticipated TCR locus of origin (A or B). MIXCR provided CDR3 sequences along with counts of the number of times each sequence was observed. Detected CDR3 sequences were filtered to exclude those with <10 counts per well. There were 48 wells per donor of SEB-stimulated or PHA-stimulated cells whilst there were 96-wells of bacterially-stimulated cells. Furthermore, some wells did not contain any valid TCR sequences after filtering for low read counts suggesting that amplification or sequencing had failed for those wells. To permit comparisons of the number of TCR sequences between plates with differing numbers of successful wells, counts were scaled to the theoretical maximum of 96 wells.

Supplemental References

1. Geremia A, Arancibia-Carcamo CV, Fleming MPP, et al. IL-23-responsive innate lymphoid cells are increased in inflammatory bowel disease. J Exp Med 2011;208:1127-1133.

2. Brodie T, Brenna E, Sallusto F. 0MIP-018: Chemokine receptor expression on human T helper cells. Cytometry A 2013.

3. Marodi L, Leijh PCJ, Furth RV. Characteristics and Functional Capacities of Human Cord Blood Granulocytes and Monocytes. Pediatr Res 1984;18:1127-1131.

4. Ebba Sohlberg SS-HKBES-E. Cord blood monocyte subsets are similar to adult and show potent peptidoglycan-stimulated cytokine responses. Immunology 2011;133:41.

5. Frentsch M, Arbach O, Kirchhoff D, et al. Direct access to CD4+ T cells specific for defined antigens according to CD154 expression. Nat Med 2005;11:1118-1124.

6. Bacher P, Schink C, Teutschbein J, et al. Antigen-Reactive T Cell Enrichment for Direct, High-Resolution Analysis of the Human Naive and Memory Th Cell Repertoire. The Journal of Immunology 2013;190:3967-3976.

7. Newman AM, Liu CL, Green MR, et al. Robust enumeration of cell subsets from tissue expression profiles. Nat. Methods 2015;12:453-457.

8. Han A, Glanville J, Hansmann L, et al. Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 2014;32:684-692.

Supplementary Table 1. Enteric bacterial species and control species used in the study

Bacterial species Strain Designation Family Phylum Kingdom Phylum abundance Gram stain Growth characteristics (of the species) Changes during IBD on Phylum level Refere nce

Bacteroides vulgatus Bv 1447 Bacteroidaceae Bacteroidetes Bacteria ~20-40% Negative Obligate anaerobe * 1, 2, 3, 4

Bifidobacterium animalis subsp. lactis Bi-07 Bifidobacteriaceae Actinobacteria Bacteria ~1-10% Positive Obligate anaerobe * (at family level) 1, 2, 3, 4

Clostridium difficile 0XF1003, Toxin AB- Clostridiaceae Firmicutes Bacteria ~50-70% Positive Obligate anaerobe * 1, 2, 3, 4

Escherichia coli Nissle 1917 Enterobacteriaceae Proteobacteria Bacteria ~5-15% Negative Facultative anaerobe * 1, 2, 3, 4

Faecalibacterium prauznitzii A2-165) Ruminococcaceae Firmicutes Bacteria ~50-70% Positive Obligate anaerobe * 1, 2, 3, 4

Lactobacillus acidophilus NCFM Lactobacillaceae Firmicutes Bacteria ~50-70% Positive Obligate anaerobe * 1, 2, 3, 4

Roseburia intestinalis M50/1 Lachnospiraceae Firmicutes Bacteria ~50-70% Positive Obligate anaerobe * 1, 2, 3, 4

Ruminococcus obeum A2-162 Lachnospiraceae Firmicutes Bacteria ~50-70% Positive Obligate anaerobe * 1, 2, 3, 4

Salmonella enterica serovar typhimurium NCTC 12023 Enterobacteriaceae Proteobacteria Bacteria ~5-15% Negative Facultative anaerobe * 1, 2, 3, 4

Staphylococcus aureus NCTC 6571 Staphylococcaceae Firmicutes Bacteria ~50-70% Positive Facultative anaerobe not invovled (at family level) 1, 2, 3, 4

Mycobacterium tuberculosis H37Ra Mycobacteriaceae Actinobacteria Bacteria ~1-10% Positive Obligate aerobe not invovled (at family level) 1, 2, 3, 4

Candida albicans Debaryomycetaceae Saccharomycetes (Class) Fungi Facultative anaerobe * 1, 2, 3, 4

References

1. Morgan XC, Tickle TL, Sokol H, et al. Dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment. Genome Biol. 2012;13:R79.

2. Kostic AD, Xavier RJ, Gevers D. The microbiome in inflammatory bowel disease: current status and the future ahead. Gastroenterology 2014;146:1489-1499.

3. Sokol H, Leducq V, Aschard H, et al. Fungal microbiota dysbiosis in IBD. Gut 2016.

4. Gevers D, Kugathasan S, Denson LA, et al. The Treatment-Naive Microbiome in New-Onset Crohn's Disease. Cell Host Microbe 2014;15:382-392.

Supplementary Table 2. T cell receptor (TCR) Vp usage in expanded microbiota-specific T cells measured by Vp antibody panel from Beckman Coulter

(related to Figure 3)

Donors Microbe Vß1 Vß2 Vß3 Vß4 Vß5.1 Vß5.2 Vß5.3 Vß7.1 Vß7.2 Vß8 Vß9 Vß11 Vß12

TRBV9 TRBV21-1 TRBV28 TRBV29-1 TRBV5-1 TRBV5-6 TRBV5-5 TRBV4-1,2,3 TRBV4-3 TRBV12-3,4 TRBV3-1 TRBV25-1 TRBV10-3

Donor A S. typhimurium 1.98 8.34 3.47 1.61 4.97 0.463 0.451 5.69 0.485 7.15 3.55 0.482 0.525

Donor A E. coli 5.32 9.6 3.8 1.2 7.78 1.32 0.393 0.892 1.25 4.25 1.86 0.968 3.85

Donor A B. animalis 1.86 11.1 3.87 0.504 8.59 0.301 0.705 0.888 0.135 1.9 3.03 0.272 0.904

Donor A L. acidophilus 2.06 11.7 4.68 0.744 7.18 0.513 0.239 0.647 0.216 2.4 1.94 0.275 1

Donor A F. prausnitzii 1.39 8.16 2.38 0.682 7.13 0.321 0.368 1.12 0.581 2.2 2.82 0.374 0.333

Donor A C. difficile 0.821 9.46 4.61 1.52 9.56 0.219 0.592 1.43 0 1.54 3.27 0 1.73

Donor A SEB 0.0745 0.0962 25.9 0.418 0.00517 0.446 0.0707 0.0943 0.07 0.165 0.027 0.0528 8.07

Donor A PHA 2.22 13.5 5.99 2.08 1.07 6.21 0.838 0.932 0.673 2.5 3.11 0.44 2.07

Donor B S. typhimurium 3.39 9.76 5.28 2.27 7.64 0.672 0.721 0.569 0.696 5.5 4.63 0.331 0.88

Donor B E. coli 3.52 11.9 4.32 1.96 7.97 0.714 0.921 1.02 1.56 5 4.22 0.184 0.74

Donor B B. animalis 2.36 4.07 7.63 4.29 7.72 0.461 3.41 1.12 1.48 3.23 1.81 0.575 1.13

Donor B L. acidophilus 8.58 11 3.49 4.26 9.74 0.762 1.81 0.499 2.15 4.19 0.955 0.416 0.949

Donor B F. prausnitzii 3.06 5.41 6.07 2.15 7.49 0.535 0.748 0.748 1.77 3.85 1.03 0.416 2.57

Donor B C. difficile 1.95 9.02 2.8 1.46 4.5 0.185 0.781 0.588 0.308 1.44 1.43 0.238 13.3

Donor B SEB 0.226 0.175 29.4 0.939 0.0283 0.434 0.107 0.0555 0.0598 0.274 0.077 0.0443 10

Donor B PHA 0.808 10.1 4.83 0.908 0.698 3.32 0.531 0.363 0.147 1.93 2.64 0.227 1.42

Donor C S. typhimurium 1.52 1.21 4.72 32.9 0.998 0.31 0.0963 0.84 0 9.8 0.357 0.0977 0.13

Donor C E. coli 1.34 1.22 4.53 26.3 1.28 0.181 0.167 0.642 0 9.4 0.337 0.136 0.256

Donor C B. animalis 1.36 1.61 1.58 1.8 1.92 0.378 0.188 1.2 0.0113 1.08 0.286 0.21 0.216

Donor C L. acidophilus 0.816 5.71 1.26 3.29 1.32 0.333 1.18 1.22 0.00834 2.58 0.943 0.261 0.683

Donor C F. prausnitzii 0.498 1.51 0.6 1.73 0.585 0.234 0.109 0.269 0.0247 1.07 0.271 0.382 0.222

Donor C C. difficile 0.471 1.09 0.536 0.778 0.615 0.218 0.145 0.563 0.0046 4.63 0.165 0.208 0.258

Donor C SEB 0.191 0.155 19.9 1.43 0.0354 0.482 0.114 0.0692 0.0188 0.234 0.0615 0.0577 8.98

Donor C PHA 2.01 10.2 5.36 2.43 0.963 6.44 0.958 0.626 0.00905 4.24 2.61 0.732 1.87

Page 1

Supplementary Table 2. T cell receptor (TCR) Vp usage in expanded microbiota-specific T cells measured by Vp antibody panel from Beckman Coulter

Donors Microbe Vß13.1 Vß13.2 Vß13.6 Vß14 Vß16 Vß17 Vß18 Vß20 Vß21.3 Vß22 Vß23 Unkown Vß

TRBV6-5,6,9 TRBV6-2 TRBV6-6 TRBV27 TRBV14 TRBV19 TRBV18 TRBV30 TRBV11-2 TRBV2 TRBV13

Donor A S. typhimurium 1.75 1.24 1.45 2.72 1.78 4.92 0.398 0.862 1.09 2.28 0.079 42.265

Donor A E. coli 2.07 1.73 2.09 3.2 0.731 5.7 0.515 4.25 0.901 5.48 0.267 30.583

Donor A B. animalis 0.727 6.54 0.998 1.89 1.09 7.64 0.197 1.98 1.41 15.5 0.955 27.014

Donor A L. acidophilus 1.07 1.78 0.726 0.627 0.746 14.5 1.29 0.79 1.09 13 0.212 30.575

Donor A F. prausnitzii 1.09 0.556 1.35 1.27 0.896 3.21 0.921 1.39 1.91 19.2 0.463 39.885

Donor A C. difficile 1.09 1.35 1.39 2.07 0.369 2.48 1.13 3.5 1.86 11.9 0.0548 38.0542

Donor A SEB 0.11 5.22 0.333 2.02 0.333 14.6 0.0234 2.73 0.0444 0.354 0.177 38.56553

Donor A PHA 3.16 2.82 1.9 2.95 1.14 4.6 1.55 2.42 2.85 2.26 0.37 32.347

Donor B S. typhimurium 0.912 3.07 3.71 2.06 0.43 5.21 0.335 0.167 3.12 6.83 0.706 31.111

Donor B E. coli 2.47 3.98 2.96 2.71 0.792 5.14 1.41 0.2 3.11 4.82 0.432 27.947

Donor B B. animalis 1.49 4.37 4.08 1.37 0.421 6.43 0.812 0.559 0.677 4.04 0.118 36.347

Donor B L. acidophilus 2.67 2.82 3.02 2.7 0.148 6.01 0.409 0.36 1.2 6.69 0.076 25.096

Donor B F. prausnitzii 1.07 1.17 4.92 6.59 0.972 8.73 0.237 0.917 0.764 14.1 0.115 24.568

Donor B C. difficile 2.93 0.638 8.27 1.82 0.2 3.29 0.548 0.298 2.81 7.49 1.94 31.766

Donor B SEB 0.104 7.76 0.724 2.03 0.424 23 0.0317 0.052 0.0674 0.542 0.788 22.657

Donor B PHA 1.94 2 4.05 1.8 0.716 3.37 1.5 0.0536 2.16 0.869 0.223 53.3964

Donor C S. typhimurium 1.05 0.133 0.81 4.43 0.084 0.942 0.0269 0.228 0.796 4.51 0.0442 33.9669

Donor C E. coli 0.785 0.176 0.878 2.55 0.0657 1.26 0.0797 0.347 0.791 4.57 0.0959 42.6127

Donor C B. animalis 1.05 0.317 0.803 0.52 0.068 2.27 0.222 0.979 0.339 1.3 0.133 80.1597

Donor C L. acidophilus 1.41 0.233 0.415 1.33 0.0705 3 0.193 2.37 0.898 1.06 0.139 69.27716

Donor C F. prausnitzii 0.543 0.52 0.291 1.43 0.0855 3.92 0.0425 1.03 0.33 0.645 0.102 83.5563

Donor C C. difficile 0.327 0.092 0.138 0.482 0.0694 1.61 0.109 0.735 0.161 0.411 0.106 86.078

Donor C SEB 0.206 3.48 0.345 3.34 0.381 19.9 0.0309 4.82 0.0836 1.04 0.257 34.3879

Donor C PHA 3.55 1.7 2.16 3.4 1.09 4.67 1.09 3.14 3.11 1.79 0.487 35.36495

Page 2

Supplementary Table 3. T cell receptor (TCR) Vß usage in expanded microbiota specific T cells using multiplex PCR assay and deep sequencing

(related to Figure 3)

S. typhimurium E. coli B. animalis L. acidophilus F. prausnitzii C. difficile SEB PHA Vb

TRBV9 1.617783985 1.462695991 1.669805399 1.107458038 0.883673765 0.521920668 0.397526502 0.700678783 ['1']

TRBV20-1 10.59124767 11.1543723 9.780288763 10.24398685 8.083441982 9.251043841 0.309187279 8.430041603 ['2']

TRBV28 1.0358473 1.346943071 2.209667294 3.910711196 2.013617268 0.417536534 21.37809187 0.569301511 ['3']

TRBV29-1 5.52839851 5.713985057 5.599497803 6.29866759 5.606258149 7.215553236 0.618374558 4.072695424 ['4']

TRBV5-1 8.216945996 5.819214985 4.959196485 3.4781104 2.491670288 6.3282881 0.530035336 4.510619663 [ 5.1 ]

TRBV5-6 0.442271881 0.904977376 0.69052103 0.19034435 0.8402144 0.339248434 0.044169611 0.131377272 [ 5.2 ]

TRBV5-5 0.453910615 0.904977376 0.69052103 0.19034435 0.8402144 0.339248434 0.044169611 0.131377272 ['53' ]

TRBV4-1 1.0358473 1.062822267 0.715630885 0.103824191 1.115457048 1.957202505 0.088339223 1.401357565 [' 71' ]

TRBV4-2 3.852420857 3.335788698 3.992467043 2.993597508 6.156743445 5.414926931 0.706713781 4.050799212 ['71']

TRBV4-3 3.86405959 3.388403662 4.017576899 2.993597508 6.156743445 5.401878914 0.706713781 4.13838406 [' 7.1' ,' 7.2' ]

TRBV4-3 3.86405959 3.388403662 4.017576899 2.993597508 6.156743445 5.401878914 0.706713781 4.13838406 ['7.1', '7.2']

TRBV12-3 2.420856611 2.462380301 1.820464532 2.422564458 0.86918731 0.978601253 0.132508834 1.22618787 ['8']

TRBV12-4 2.420856611 2.462380301 1.820464532 2.422564458 0.86918731 0.978601253 0.132508834 1.22618787 ['8']

TRBV3-1 0.186219739 0.410396717 0.615191463 0.519120955 0.376647834 0.130480167 0 0 ['9']

TRBV25-1 0.034916201 0.021045985 0.037664783 0 0.014486455 0 0.088339223 0 ['11']

TRBV10-3 0 0.021045985 0 0 0 0 0.088339223 0 ['12']

TRBV6-1 0.477188082 0.820793434 1.858129316 1.69579512 1.839779806 0.247912317 0.618374558 0.262754543 ['13.1']

TRBV6-5 3.526536313 3.893507313 4.268675455 3.928015228 4.389395915 2.518267223 1.192579505 5.517845413 ['13.1']

TRBV6-6 3.479981378 3.809323372 4.18079096 3.8587991 4.244531363 2.466075157 1.192579505 5.386468141 ['13.1', '13.6']

TRBV6-9 0 0 0.012554928 0 0 0.013048017 0 0 ['13.1']

TRBV6-2 0.53538175 0.894454383 1.305712492 1.055545942 0.782268579 0.874217119 7.155477032 0.634990147 ['13.2']

TRBV6-6 3.479981378 3.809323372 4.18079096 3.8587991 4.244531363 2.466075157 1.192579505 5.386468141 ['13.1', '13.6']

TRBV27 0.151303538 0.168367884 0.640301318 0.46720886 0.970592496 0.013048017 4.06360424 0.021896212 ['14']

TRBV14 1.163873371 0.936546354 0.376647834 2.145699948 0.608431117 0.365344468 0.132508834 1.248084081 ['16']

TRBV19 0.034916201 0.031568978 0.062774639 0.034608064 0.173837462 0.013048017 0.574204947 0 ['17']

TRBV18 0.104748603 0.242028833 0.138104206 0.346080637 0.217296827 0.130480167 0 0.065688636 ['18']

TRBV30 4.67877095 4.198674103 4.105461394 6.765876449 4.679125018 6.537056367 29.99116608 6.481278739 ['20']

TRBV11-2 1.175512104 1.11543723 2.071563089 3.374286209 0.796755034 0.495824635 0.265017668 0.372235603 ['21.3']

TRBV2 0.698324022 1.410081027 0.263653484 0.46720886 0.217296827 0.287056367 0.044169611 0 ['22']

TRBV13 0.058193669 0.073660949 0.025109856 0 0.014486455 0.052192067 0 0.021896212 ['23']

TRBV1 0 0 0 0 0 0 0 0 UNK

TRBV7-1 0 0 0 0 0 0 0 0 UNK

TRBV7-2 12.13919926 11.38587814 10.80979284 5.917978889 9.054034478 16.03601253 1.899293286 16.70680972 UNK

TRBV8-1 0 0 0 0 0 0 0 0 UNK

TRBV5-2 0 0 0 0 0 0 0 0 UNK

TRBV6-4 0.034916201 0.168367884 0.025109856 0 0 0 1.01590106 0 UNK

TRBV6-3 0.53538175 0.894454383 1.305712492 1.055545942 0.782268579 0.874217119 7.155477032 0.634990147 UNK

TRBV7-3 4.213221601 3.683047459 4.143126177 4.031839419 4.621179197 2.583507307 1.899293286 3.656667397 UNK

TRBV8-2 0 0 0 0 0 0 0 0 UNK

TRBV5-3 0.244413408 0.199936862 0.050219711 0.017304032 0.014486455 0.03914405 0.309187279 0.043792424 UNK

TRBV10-1 0 0 0 0 0 0 0 0 UNK

TRBV11-1 1.047486034 1.125960223 1.644695543 3.270462018 0.753295669 0.456680585 0.220848057 0.394131815 UNK

TRBV12-1 0 0 0 0 0 0 0 0 UNK

TRBV10-2 0.081471136 0.052614964 0.037664783 0 0.173837462 0 5.344522968 0.153273484 UNK

TRBV12-2 0 0 0 0 0 0 0 0 UNK

TRBV7-4 0.046554935 0.11575292 0.025109856 0.051912096 0.02897291 0.052192067 0.750883392 0.10948106 UNK

TRBV5-4 0.675046555 0.926023361 0.502197112 1.401626579 1.434159061 1.696242171 0.176678445 0.131377272 UNK

TRBV7-5 0 0 0 0 0 0 0 0 UNK

TRBV6-7 0 0 0 0 0 0 0 0 UNK

TRBV7-6 1.745810056 2.230874461 1.694915254 1.12476207 1.941184992 3.444676409 1.369257951 3.590978761 UNK

TRBV5-8 0.675046555 0.947069347 0.527306968 1.540058834 1.463131972 1.761482255 0.176678445 0.131377272 UNK

TRBV6-8 0 0 0 0 0 0 0 0 UNK

TRBV7-8 4.166666667 3.314742713 4.369114878 2.595604776 6.634796465 3.405532359 1.766784452 4.92664769 UNK

TRBV7-7 1.641061453 2.051983584 1.556811048 1.12476207 1.839779806 3.314196242 1.369257951 3.284431793 UNK

TRBV5-7 0.40735568 0.820793434 0.665411174 0.19034435 0.724322758 0.326200418 0.044169611 0.10948106 UNK

TRBV7-9 3.514897579 4.082921183 3.892027621 4.499048278 3.215993047 3.001043841 0.35335689 3.70045982 UNK

TRBV11-3 1.198789572 1.199621172 2.084118016 3.374286209 0.796755034 0.495824635 0.265017668 0.416028027 UNK

TRBV12-5 0.162942272 0.242028833 0.11299435 0.103824191 0 0.03914405 0 0.10948106 UNK

TRBV15 2.118249534 1.125960223 0.351537979 0.692161274 0.622917572 1.200417537 0.35335689 1.707904533 UNK

TRBV16 0.046554935 0.021045985 0 0.899809656 0 0 0 0.043792424 UNK

TRBV17 0 0 0 0 0 0 0 0 UNK

TRBV21-1 0 0 0 0 0 0 0 0 UNK

TRBV22-1 0 0 0 0 0 0 0 0 UNK

TRBV23-1 0 0 0 0 0 0 0 0 UNK

TRBV24-1 0.174581006 0.147321898 0.075329567 0.242256446 0.246269738 0.11743215 3.136042403 0.021896212 UNK

TRBV26 0 0 0 0 0 0 0 0 UNK

Table S3. T cell receptor (TCR) Vp usage in expanded microbiota specific T cells using multiplex PCR assays and deep sequencing

Donor 1

S. typhimurium E. coli B. animalis L. acidophilus F. prausnitzii C. difficile SEB PHA VP

TRBV9 0.730868444 0.879443019 0.414421881 0 1.560348784 0.058309038 0.484848485 0.736196319 ['1']

TRBV20-1 7.09372313 9.967020887 14.46332366 12.77573529 10.9683341 9.329446064 0.242424242 7.668711656 ['2']

TRBV28 0.816852966 0.586295346 3.315375052 11.67279412 2.248737953 0.349854227 26.42424242 0.306748466 ['3']

TRBV29-1 9.200343938 7.108831074 9.241607957 8.180147059 11.70261588 11.31195335 0.242424242 4.846625767 ['4']

TRBV5-1 7.308684437 4.067423965 3.895565686 3.125 1.147315282 6.472303207 0.242424242 3.312883436 ['5.1']

TRBV5-6 0.343938091 0.146573837 0.041442188 0.091911765 0.091785223 0 0 0.061349693 ['5.2']

TRBV5-5 0.343938091 0.146573837 0.041442188 0.091911765 0.091785223 0 0 0.061349693 ['5.3']

TRBV4-1 2.708512468 1.026016856 0.994612516 0 0.045892611 1.224489796 0.121212121 0.736196319 ['7.1']

TRBV4-2 2.235597592 4.873580066 4.517198508 0.275735294 7.847636531 5.131195335 0.848484848 5.153374233 ['7.1']

TRBV4-3 2.235597592 4.910223525 4.558640696 0.275735294 7.847636531 5.131195335 0.848484848 5.214723926 ['7.1', '7.2']

TRBV4-3 2.235597592 4.910223525 4.558640696 0.275735294 7.847636531 5.131195335 0.848484848 5.214723926 ['7.1', '7.2']

TRBV12-3 5.54600172 2.161964089 0.414421881 0.091911765 1.147315282 0.699708455 0.121212121 0.552147239 ['8']

TRBV12-4 5.54600172 2.161964089 0.414421881 0.091911765 1.147315282 0.699708455 0.121212121 0.552147239 ['8']

TRBV3-1 0.042992261 0 0 0.091911765 0 0 0 0 ['9']

TRBV25-1 0 0 0 0 0.045892611 0 0.242424242 0 ['11']

TRBV10-3 0 0 0 0 0 0 0 0 ['12']

TRBV6-1 0.171969046 0.036643459 0.165768753 0.091911765 0.321248279 0.233236152 0.363636364 0 ['13.1']

TRBV6-5 3.740326741 5.313301576 1.367592209 6.433823529 0.413033502 1.982507289 0.484848485 3.926380368 ['13.1']

TRBV6-6 3.740326741 5.240014657 1.367592209 6.617647059 0.36714089 1.982507289 0.484848485 3.803680982 ['13.1', '13.6']

TRBV6-9 0 0 0 0 0 0 0 0 ['13.1']

TRBV6-2 0.085984523 0.916086479 0.704517199 1.654411765 0.183570445 1.10787172 8 0.920245399 ['13.2']

TRBV6-6 3.740326741 5.240014657 1.367592209 6.617647059 0.36714089 1.982507289 0.484848485 3.803680982 ['13.1', '13.6']

TRBV27 0.386930353 0.293147673 1.036054704 0.183823529 2.8453419 0 4 0 ['14']

TRBV14 2.622527945 0.256504214 0.331537505 0.459558824 0.413033502 0 0 0.797546012 ['16']

TRBV19 0 0 0 0 0.045892611 0 0.121212121 0 ['17']

TRBV18 0.085984523 0.109930377 0 0.091911765 0.183570445 0 0 0 ['18']

TRBV30 2.708512468 5.386588494 6.092001658 5.974264706 6.05782469 5.189504373 27.15151515 7.791411043 ['20']

TRBV11-2 0.859845228 0.513008428 1.243265644 0.183823529 1.193207894 0 0.121212121 0.306748466 ['21.3']

TRBV2 0.085984523 0.43972151 0.041442188 0 0.091785223 0 0 0 ['22']

TRBV13 0 0 0 0 0 0 0 0 ['23']

TRBV1 0 0 0 0 0 0 0 0 UNK

TRBV7-1 0 0 0 0 0 0 0 0 UNK

TRBV7-2 14.144454 17.0392085 11.1893908 3.952205882 12.80403855 15.62682216 1.454545455 19.57055215 UNK

TRBV8-1 0 0 0 0 0 0 0 0 UNK

TRBV5-2 0 0 0 0 0 0 0 0 UNK

TRBV6-4 0.085984523 0 0.041442188 0 0 0 2.181818182 0 UNK

TRBV6-3 0.085984523 0.916086479 0.704517199 1.654411765 0.183570445 1.10787172 8 0.920245399 UNK

TRBV7-3 5.331040413 3.187980945 6.506423539 0 4.726938963 0.758017493 0.96969697 3.190184049 UNK

TRBV8-2 0 0 0 0 0 0 0 0 UNK

TRBV5-3 0.085984523 0.43972151 0 0 0 0.116618076 0.242424242 0 UNK

TRBV10-1 0 0 0 0 0 0 0 0 UNK

TRBV11-1 0.816852966 0.513008428 1.160381268 0.183823529 1.147315282 0 0 0.36809816 UNK

TRBV12-1 0 0 0 0 0 0 0 0 UNK

TRBV10-2 0.042992261 0.036643459 0.041442188 0 0.550711335 0 7.636363636 0.306748466 UNK

TRBV12-2 0 0 0 0 0 0 0 0 UNK

TRBV7-4 0.042992261 0 0 0 0 0 1.212121212 0.18404908 UNK

TRBV5-4 0.128976784 0.329791132 0.621632822 0 0.183570445 5.422740525 0.121212121 0 UNK

TRBV7-5 0 0 0 0 0 0 0 0 UNK

TRBV6-7 0 0 0 0 0 0 0 0 UNK

TRBV7-6 1.977644024 0.989373397 3.688354745 4.136029412 1.78981184 3.731778426 0.848484848 4.662576687 UNK

TRBV5-8 0.128976784 0.329791132 0.621632822 0 0.183570445 5.422740525 0.121212121 0 UNK

TRBV6-8 0 0 0 0 0 0 0 0 UNK

TRBV7-8 4.170249355 3.151337486 9.117281392 5.055147059 5.32354291 3.206997085 1.454545455 5.214723926 UNK

TRBV7-7 1.891659501 0.952729938 3.398259428 4.136029412 1.743919229 3.381924198 0.848484848 4.478527607 UNK

TRBV5-7 0.343938091 0.146573837 0.041442188 0.091911765 0.091785223 0 0 0 UNK

TRBV7-9 3.611349957 3.261267864 0.994612516 10.47794118 3.717301514 2.857142857 0.96969697 2.944785276 UNK

TRBV11-3 0.859845228 0.513008428 1.243265644 0.183823529 1.193207894 0 0.121212121 0.36809816 UNK

TRBV12-5 0.042992261 0 0 0 0 0.174927114 0 0.122699387 UNK

TRBV15 1.504729149 1.392451447 0.041442188 0 0 0.174927114 0.121212121 1.840490798 UNK

TRBV16 0 0 0 4.779411765 0 0 0 0 UNK

TRBV17 0 0 0 0 0 0 0 0 UNK

TRBV21-1 0 0 0 0 0 0 0 0 UNK

TRBV22-1 0 0 0 0 0 0 0 0 UNK

TRBV23-1 0 0 0 0 0 0 0 0 UNK

TRBV24-1 0.085984523 0.109930377 0 0 0.137677834 0 1.696969697 0.061349693 UNK

|TRBV26 | 0 0 0 0 0 0 0 0|UNK

Table S3. T cell receptor (TCR) Vp usage in expanded microbiota specific T cells using multiplex PCR assays and deep sequencing

Donor 2

S. typhimurium E. coli B. animalis L. acidophilus F. prausnitzii C. difficile SEB PHA VP

TRBV9 2.232142857 2.699144174 1.598495534 3.249630724 0.166574125 0.30159414 0.295420975 1.194659171 ['1']

TRBV20-1 10.75487013 11.32323897 9.685002351 13.22008863 8.995002776 7.755277897 0.738552437 7.589599438 ['2']

TRBV28 2.353896104 3.324555629 4.37235543 7.311669129 4.664075514 0.258509263 26.44017725 1.475755446 ['3']

TRBV29-1 3.652597403 7.142857143 4.607428303 2.511078287 1.499167129 0.646273158 1.624815362 3.021784961 ['4']

TRBV5-1 11.28246753 5.99078341 5.500705219 5.022156573 7.273736813 4.308487721 0.59084195 5.762473647 ['5.1']

TRBV5-6 0.689935065 1.382488479 2.256699577 0.295420975 2.165463631 0.646273158 0.147710487 0.281096275 ['5.2']

TRBV5-5 0.730519481 1.382488479 2.256699577 0.295420975 2.165463631 0.646273158 0.147710487 0.281096275 ['5.3']

TRBV4-1 0.649350649 0.954575379 1.081335214 0.295420975 2.498611882 1.981904352 0 1.405481377 ['7.1']

TRBV4-2 1.988636364 1.283739302 0.188058298 0.812407681 3.498056635 8.358466178 0.59084195 1.967673928 ['7.1']

TRBV4-3 2.029220779 1.316655695 0.188058298 0.812407681 3.498056635 8.358466178 0.59084195 2.037947997 ['7.1', '7.2']

TRBV4-3 2.029220779 1.316655695 0.188058298 0.812407681 3.498056635 8.358466178 0.59084195 2.037947997 ['7.1', '7.2']

TRBV12-3 0.730519481 1.81040158 2.3977433 4.135893648 1.887840089 2.585092632 0.147710487 3.09205903 ['8']

TRBV12-4 0.730519481 1.81040158 2.3977433 4.135893648 1.887840089 2.585092632 0.147710487 3.09205903 ['8']

TRBV3-1 0.487012987 1.152073733 2.209685002 1.772525849 1.388117712 0.129254632 0 0 ['9']

TRBV25-1 0.081168831 0.032916392 0 0 0 0 0 0 ['11']

TRBV10-3 0 0 0 0 0 0 0.147710487 0 ['12']

TRBV6-1 0.852272727 1.184990125 1.269393512 1.772525849 0.72182121 0.473933649 0.886262925 0.421644413 ['13.1']

TRBV6-5 4.748376623 2.995391705 5.547719793 5.391432792 2.554136591 3.274450668 1.1816839 8.854532677 ['13.1']

TRBV6-6 4.586038961 2.92955892 5.500705219 5.317577548 2.554136591 3.274450668 1.1816839 8.643710471 ['13.1', '13.6']

TRBV6-9 0 0 0 0 0 0 0 0 ['13.1']

TRBV6-2 0.527597403 0.658327847 0.329102022 0.664697194 1.054969461 0.043084877 2.954209749 0.281096275 ['13.2']

TRBV6-6 4.586038961 2.92955892 5.500705219 5.317577548 2.554136591 3.274450668 1.1816839 8.643710471 ['13.1', '13.6']

TRBV27 0.081168831 0.032916392 1.034320639 0.960118168 0.166574125 0 3.397341211 0.070274069 ['14']

TRBV14 0.487012987 0.855826201 0.94029149 2.215657312 1.83231538 0.215424386 0.443131462 1.405481377 ['16']

TRBV19 0 0 0 0.073855244 0 0.043084877 0.295420975 0 ['17']

TRBV18 0.040584416 0.230414747 0.235072873 0.369276219 0.499722376 0.344679018 0 0.210822207 ['18']

TRBV30 4.788961039 4.377880184 2.3977433 5.539143279 2.94280955 8.746230073 30.42836041 3.72452565 ['20']

TRBV11-2 1.866883117 1.217906517 3.667136812 1.550960118 1.166018878 0.430848772 0.147710487 0.562192551 ['21.3']

TRBV2 1.948051948 2.567478604 0.799247767 1.624815362 0.610771793 0.732442913 0 0 ['22']

TRBV13 0.202922078 0.098749177 0 0 0 0 0 0.070274069 ['23']

TRBV1 0 0 0 0 0 0 0 0 UNK

TRBV7-1 0 0 0 0 0 0 0 0 UNK

TRBV7-2 9.699675325 6.978275181 7.663375646 3.249630724 10.77179345 9.392503231 1.920236337 10.11946592 UNK

TRBV8-1 0 0 0 0 0 0 0 0 UNK

TRBV5-2 0 0 0 0 0 0 0 0 UNK

TRBV6-4 0 0 0.047014575 0 0 0 0.443131462 0 UNK

TRBV6-3 0.527597403 0.658327847 0.329102022 0.664697194 1.054969461 0.043084877 2.954209749 0.281096275 UNK

TRBV7-3 3.125 3.982883476 1.645510108 5.612998523 2.387562465 3.619129685 2.658788774 3.935347857 UNK

TRBV8-2 0 0 0 0 0 0 0 0 UNK

TRBV5-3 0.162337662 0.131665569 0.094029149 0.073855244 0.055524708 0 0.59084195 0 UNK

TRBV10-1 0 0 0 0 0 0 0 0 UNK

TRBV11-1 1.542207792 1.11915734 2.162670428 1.1816839 1.054969461 0.344679018 0.147710487 0.562192551 UNK

TRBV12-1 0 0 0 0 0 0 0 0 UNK

TRBV10-2 0.162337662 0.065832785 0 0 0 0 5.169867061 0.070274069 UNK

TRBV12-2 0 0 0 0 0 0 0 0 UNK

TRBV7-4 0.040584416 0.164581962 0.047014575 0.073855244 0 0.129254632 0.59084195 0.070274069 UNK

TRBV5-4 1.176948052 1.481237656 0.470145745 1.698670606 1.665741255 1.206376562 0 0.421644413 UNK

TRBV7-5 0 0 0 0 0 0 0 0 UNK

TRBV6-7 0 0 0 0 0 0 0 0 UNK

TRBV7-6 1.866883117 3.324555629 1.833568406 0.664697194 1.665741255 4.825506247 2.215657312 2.951510892 UNK

TRBV5-8 1.176948052 1.547070441 0.564174894 2.363367799 1.776790672 1.292546316 0 0.421644413 UNK

TRBV6-8 0 0 0 0 0 0 0 0 UNK

TRBV7-8 5.438311688 4.805793285 3.94922426 3.249630724 7.828983898 3.920723826 2.067946824 4.427266339 UNK

TRBV7-7 1.785714286 3.159973667 1.692524683 0.664697194 1.554691838 4.739336493 2.215657312 2.670414617 UNK

TRBV5-7 0.568181818 1.11915734 2.209685002 0.295420975 1.998889506 0.603188281 0.147710487 0.281096275 UNK

TRBV7-9 3.571428571 5.892034233 5.970850964 1.846381093 4.664075514 1.206376562 0 4.567814476 UNK

TRBV11-3 1.948051948 1.316655695 3.667136812 1.550960118 1.166018878 0.430848772 0.147710487 0.562192551 UNK

TRBV12-5 0.324675325 0.032916392 0.047014575 0.443131462 0 0 0 0.210822207 UNK

TRBV15 1.339285714 1.11915734 1.175364363 0.443131462 0.610771793 0.086169754 1.033973412 2.178496135 UNK

TRBV16 0.081168831 0 0 0 0 0 0 0.140548138 UNK

TRBV17 0 0 0 0 0 0 0 0 UNK

TRBV21-1 0 0 0 0 0 0 0 0 UNK

TRBV22-1 0 0 0 0 0 0 0 0 UNK

TRBV23-1 0 0 0 0 0 0 0 0 UNK

TRBV24-1 0.324675325 0.098749177 0.282087447 0.443131462 0 0.387763895 3.397341211 0 UNK

|TRBV26 | 0 0 0 0 0 0 0 0|UNK

Table S3. T cell receptor (TCR) VP usage in expanded microbiota-specific T cells using multiplex PCR assay and deep sequencing

Donor 3

S. typhimurium E. coli B. animalis L. acidophilus F. prausnitzii C. difficile SEB PHA VP

TRBV9 1.762230405 0.883297645 2.598540146 0.599340725 0.821074239 0.882028666 0.393700787 0.198150594 ['1']

TRBV20-1 12.62493425 11.88436831 6.540145985 8.210967935 5.371193979 10.17089305 0 10.03963012 ['2']

TRBV28 0.315623356 0.294432548 0.087591241 0 0.20526856 0.551267916 11.41732283 0 ['3']

TRBV29-1 4.497632825 3.533190578 3.649635037 7.222055739 3.592199795 9.481808159 0.131233596 4.227212682 ['4']

TRBV5-1 6.785902157 6.959314775 5.372262774 2.96673659 0.547382826 7.552370452 0.787401575 4.623513871 ['5.1']

TRBV5-6 0.341925302 1.070663812 0.175182482 0.179802218 0.581594252 0.303197354 0 0.066050198 ['5.2']

TRBV5-5 0.341925302 1.070663812 0.175182482 0.179802218 0.581594252 0.303197354 0 0.066050198 ['5.3']

TRBV4-1 0.263019463 1.177730193 0.291970803 0.059934073 1.060554225 2.287761852 0.131233596 2.113606341 ['7.1']

TRBV4-2 6.049447659 3.881156317 5.98540146 4.764758765 6.534382484 3.665931643 0.656167979 4.821664465 ['7.1']

TRBV4-3 6.049447659 3.961456103 6.01459854 4.764758765 6.534382484 3.638368247 0.656167979 4.953764861 ['7.1','7.2']

TRBV4-3 6.049447659 3.961456103 6.01459854 4.764758765 6.534382484 3.638368247 0.656167979 4.953764861 [' 7.1' ,' 7.2' ]

TRBV12-3 1.604418727 3.211991435 2.452554745 2.48726401 0.034211427 0.082690187 0.131233596 0.198150594 ['8']

TRBV12-4 1.604418727 3.211991435 2.452554745 2.48726401 0.034211427 0.082690187 0.131233596 0.198150594 ['8']

TRBV3-1 0.078905839 0.107066381 0.058394161 0.149835181 0.034211427 0.192943771 0 0 ['9']

TRBV25-1 0.026301946 0.026766595 0.087591241 0 0 0 0 0 ['11']

TRBV10-3 0 0.053533191 0 0 0 0 0.131233596 0 ['12']

TRBV6-1 0.420831142 1.097430407 3.416058394 2.187593647 3.660622648 0.110253583 0.656167979 0.396301189 ['13.1']

TRBV6-5 2.603892688 3.586723769 5.518248175 2.517231046 8.484433801 2.287761852 1.968503937 4.095112285 ['13.1']

TRBV6-6 2.603892688 3.479657388 5.343065693 2.367395865 8.176530961 2.177508269 1.968503937 4.029062087 ['13.1' ,'13.6' ]

TRBV6-9 0 0 0.02919708 0 0 0.027563396 0 0 ['13.1']

TRBV6-2 0.815360337 1.070663812 2.335766423 1.018879233 1.060554225 1.295479603 9.973753281 0.660501982 ['13.2']

TRBV6-6 2.603892688 3.479657388 5.343065693 2.367395865 8.176530961 2.177508269 1.968503937 4.029062087 ['13.1' ,'13.6' ]

TRBV27 0.052603893 0.187366167 0.116788321 0.359604435 0.068422853 0.027563396 4.724409449 0 ['14']

TRBV14 0.710152551 1.498929336 0.058394161 2.667066227 0 0.633958104 0 1.585204756 ['16']

TRBV19 0.078905839 0.080299786 0.145985401 0.029967036 0.376325693 0 1.312335958 0 ['17']

TRBV18 0.157811678 0.347965739 0.175182482 0.419538508 0.068422853 0.055126792 0 0 ['18']

TRBV30 5.812730142 3.185224839 3.766423358 7.521726101 4.721176873 5.760749724 32.67716535 7.661822985 ['20']

TRBV11-2 0.920568122 1.472162741 1.664233577 5.154330237 0.273691413 0.771775083 0.524934383 0.264200793 ['21.3']

TRBV2 0.263019463 1.177730193 0.087591241 0.149835181 0.068422853 0.137816979 0.131233596 0 ['22']

TRBV13 0 0.107066381 0.058394161 0 0.034211427 0.110253583 0 0 ['23']

TRBV1 0 0 0 0 0 0 0 0 UNK

TRBV7-1 0 0 0 0 0 0 0 0 UNK

TRBV7-2 12.49342451 10.84047109 12.49635037 7.641594246 5.200136846 20.47960309 2.362204724 19.81505945 UNK

TRBV8-1 0 0 0 0 0 0 0 0 UNK

TRBV5-2 0 0 0 0 0 0 0 0 UNK

TRBV6-4 0.026301946 0.428265525 0 0 0 0 0.262467192 0 UNK

TRBV6-3 0.815360337 1.070663812 2.335766423 1.018879233 1.060554225 1.295479603 9.973753281 0.660501982 UNK

TRBV7-3 4.234613361 3.800856531 4.02919708 4.704824693 5.918576805 2.783902977 2.230971129 3.896961691 UNK

TRBV8-2 0 0 0 0 0 0 0 0 UNK

TRBV5-3 0.394529195 0.080299786 0.058394161 0 0 0.027563396 0.131233596 0.132100396 UNK

TRBV10-1 0 0 0 0 0 0 0 0 UNK

TRBV11-1 0.867964229 1.579229122 1.664233577 5.1243632 0.273691413 0.744211687 0.524934383 0.264200793 UNK

TRBV12-1 0 0 0 0 0 0 0 0 UNK

TRBV10-2 0.052603893 0.053533191 0.058394161 0 0 0 3.018372703 0.066050198 UNK

TRBV12-2 0 0 0 0 0 0 0 0 UNK

TRBV7-4 0.052603893 0.160599572 0.02919708 0.059934073 0.068422853 0.027563396 0.393700787 0.066050198 UNK

TRBV5-4 0.683850605 0.91006424 0.437956204 1.738088103 2.22374273 0.248070562 0.393700787 0 UNK

TRBV7-5 0 0 0 0 0 0 0 0 UNK

TRBV6-7 0 0 0 0 0 0 0 0 UNK

TRBV7-6 1.525512888 2.248394004 0.204379562 0.329637399 2.22374273 2.425578831 1.181102362 3.038309115 UNK

TRBV5-8 0.683850605 0.91006424 0.437956204 1.708121067 2.22374273 0.33076075 0.393700787 0 UNK

TRBV6-8 0 0 0 0 0 0 0 0 UNK

TRBV7-8 3.340347186 2.221627409 1.284671533 1.528318849 6.87649675 3.169790518 1.837270341 5.085865258 UNK

TRBV7-7 1.394003156 1.953961456 0.175182482 0.329637399 2.086897024 2.37045204 1.181102362 2.575957728 UNK

TRBV5-7 0.341925302 1.070663812 0.145985401 0.179802218 0.410537119 0.303197354 0 0.066050198 UNK

TRBV7-9 3.419253025 3.211991435 4.642335766 3.626011387 1.950051317 4.217199559 0 3.698811096 UNK

TRBV11-3 0.920568122 1.605995717 1.693430657 5.154330237 0.273691413 0.771775083 0.524934383 0.330250991 UNK

TRBV12-5 0.131509732 0.588865096 0.233576642 0 0 0 0 0 UNK

TRBV15 2.998421883 0.936830835 0.058394161 1.018879233 1.094765652 2.398015436 0 1.122853369 UNK

TRBV16 0.052603893 0.053533191 0 0 0 0 0 0 UNK

TRBV17 0 0 0 0 0 0 0 0 UNK

TRBV21-1 0 0 0 0 0 0 0 0 UNK

TRBV22-1 0 0 0 0 0 0 0 0 UNK

TRBV23-1 0 0 0 0 0 0 0 0 UNK

TRBV24-1 0.131509732 0.214132762 0 0.23973629 0.478959973 0 4.461942257 0 UNK

TRBV26 0 0 0 0 0 0 0 0 UNK

Clone count CDR3 AA Seq

CDR3 DNA Seq 22554 CAWRPRAADGMPQYF 7027 CAWEPVEALTDTQYF 5842 CASSFGDSIQETQYF 5596 CAWDTSGQGNEQFF 5367 CAWGDGSNQPQHF 5210 CASSFLRGNTEAFF 4524 CASSQETGHERNIQYF 4454 CASSFEAGRITEAFF 4435 CSASAGLGYNEQFF 4025 CASSLDSGYNEQFF 4016 CASSQEVGPYGYTF 3751 CATSSPGWADTQYF 3581 CAWDPAISDTQYF 3399 CAGQTSGGVGEQFF 3276 CASSQATIPPNEQFF 3081 CATSSWTGSSDEQFF 3001 CASSPFTDEQYF 2750 CSVTGLAGGSYNEQFF 2596 CASSPGLAVQETQYF 2425 CASSQDTGDRGGYTF 2416 CASSYSSGSGGETQYF 2271 CASSHTTSSGFYEQYF 2263 CASSGEAQYF 2239 CASSLASPTEAFF 2162 CASSPLRGGDTQYF 2014 CASSLKAATDLAEAFF 1868 CAWSVGDYGYTF 1822 CASSPWGGGGDTQYF 1757 CASSLASQETQYF 1724 CASSLSLILAGNEQFF 1716 CASSLYVRETQYF 1679 CASSADYGNQPQHF 1636 CAWSIGTAYEQYF 1573 CASSLGGARTEAFF 1539 CAWSAGLLSYEQYF 1526 CSVGTAPTEAFF 1524 CASSGTSGSEQFF 1433 CASSGDTQYF 1430 CASSMGWRTEAFF 1410 CASSPTGTSSSYEQYF 1402 CASATGGDQPQHF 1402 CASSLLTGGAFF 1396 CASSLDWQTADEQFF 1360 CASSPSGGAGTDTQYF 1337 CSARSGTGVGSNQPQHF 1312 CASSPSRYNEQFF 1296 CASSLYLAGASTGELFF 1204 CASSLGLNPSYNEQFF 1199 CAWSLQGSYGYTF

TGTGCCTGGAGACCAAGGGCCGCGGATGGGATGCCGCAGTATTTT

TGTGCCTGGGAGCCAGTGGAGGCACTCACAGATACGCAGTATTTT

TGTGCCAGCAGCTTCGGGGACAGTATCCAAGAGACCCAGTACTTC

TGTGCCTGGGACACTAGCGGGCAGGGCAATGAGCAGTTCTTC

TGTGCCTGGGGGGACGGAAGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTCCTTCGGGGGAACACTGAAGCTTTCTTT

TGCGCCAGCAGCCAAGAGACGGGCCACGAGAGGAACATTCAGTACTTC

TGTGCCAGCAGCTTTGAGGCAGGGCGGATCACTGAAGCTTTCTTT

TGCAGTGCTAGCGCTGGCCTGGGGTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTGGATAGCGGCTACAATGAGCAGTTCTTC

TGCGCCAGCAGCCAAGAGGTCGGGCCGTATGGCTACACCTTC

TGTGCCACCTCTTCACCGGGCTGGGCAGATACGCAGTATTTT

TGTGCCTGGGACCCAGCGATCTCAGATACGCAGTATTTT

TGTGCCGGCCAGACTAGCGGAGGTGTGGGTGAGCAGTTCTTC

TGTGCCAGCAGCCAAGCCACTATCCCTCCCAATGAGCAGTTCTTC

TGTGCCACCAGCAGCTGGACAGGGTCTTCGGATGAGCAGTTCTTC

TGTGCCAGCAGCCCCTTTACGGACGAGCAGTACTTC

TGCAGCGTTACGGGACTAGCGGGAGGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGTCCGGGACTAGCGGTACAAGAGACCCAGTACTTC

TGCGCCAGCAGCCAAGATACAGGGGACCGCGGGGGCTACACCTTC

TGTGCCAGCAGCTACTCTAGCGGGAGCGGTGGAGAGACCCAGTACTTC

TGTGCCAGCAGCCATACGACTAGTAGCGGGTTCTACGAGCAGTACTTC

TGTGCCAGCTCCGGGGAGGCGCAGTATTTT

TGTGCCAGCAGCTTAGCATCCCCCACTGAAGCTTTCTTT

TGTGCCAGCAGCCCGTTACGGGGTGGAGATACGCAGTATTTT

TGTGCCAGCAGCTTAAAGGCAGCGACCGACCTGGCTGAAGCTTTCTTT

TGTGCCTGGAGTGTGGGGGACTATGGCTACACCTTC

TGTGCCAGCAGTCCTTGGGGGGGAGGGGGAGATACGCAGTATTTT

TGTGCCAGCAGCTTGGCTAGCCAAGAGACCCAGTACTTC

TGTGCCAGCAGCTTAAGCCTCATCCTCGCGGGCAATGAGCAGTTCTTC

TGTGCCAGCAGCTTATATGTCCGAGAGACCCAGTACTTC

IGIGCCAGCAGCGCAGACIAIGGCAAICAGCCCCAGCAIIII

TGTGCCTGGAGTATCGGGACAGCTTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGGCGGGGCGAGGACTGAAGCTTTCTTT

TGTGCCTGGAGTGCGGGTCTACTGAGCTACGAGCAGTACTTC

TGCAGCGTTGGAACAGCGCCCACTGAAGCTTTCTTT

TGTGCCAGCAGCGGGACTAGCGGGAGTGAGCAGTTCTTC

TGTGCCAGCTCGGGAGATACGCAGTATTTT

TGTGCCAGCAGCATGGGGTGGAGGACTGAAGCTTTCTTT

TGTGCCAGCAGCCCGACCGGGACGTCGAGCTCCTACGAGCAGTACTTC

TGTGCCAGCGCTACAGGGGGGGATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTATTGACAGGGGGGGCTTTCTTT

TGTGCCAGCAGCTTAGATTGGCAGACCGCGGATGAGCAGTTCTTC

TGTGCTAGCAGCCCATCCGGAGGTGCCGGCACAGATACGCAGTATTTT

TGCAGTGCTAGATCCGGGACAGGGGTCGGGAGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCCCTTCGCGGTACAATGAGCAGTTCTTC

IGCGCCAGCAGCCIIIAIIIAGCGGGAGCGICGACCGGGGAGCIGIIIIII

TGTGCCAGCAGCTTAGGGCTTAATCCCTCCTACAATGAGCAGTTCTTC

TGTGCCTGGAGCCTACAGGGATCCTATGGCTACACCTTC

Clone count CDR3 AA Seq

CDR3 DNA Seq 16040 CASSFGDSIQETQYF 7638 CASSPQTEAFF 6655 CASGVNEQFF 6051 CAWSGTGVRQPQHF 5779 CASSPGGLNTEAFF 5616 CASSLQGTEAFF 4841 CASSFLQGARTEAFF 4396 CASSPGLASYIQYF 4380 CAWNTGRHEQFF 4044 CATSREGGRVMNTEAFF 3608 CASRQGADGYTF 3490 CAWRAEYTEAFF 3353 CASSPGGLAGVNEQFF 3226 CASSWGTGDTDTQYF 3169 CASSPASGSYEQYF 2850 CASSQHRTAGANVLTF 2580 CASRRGGVDSPLHF 2563 CAWTSAARETQYF 2498 CAWSRGGRAFF 2476 CASSSTPTGGGYTF 2453 CATSRYGEHSEAFF 2369 CASMASAGYEQYF 2333 CAWTRTIQETQYF 2271 CSARSGTGVGSNQPQHF 2232 CAWNEQDLAGELFF 2209 CASSPGGGSSYNEQFF 2173 CASSQDWLAGVEQYF 2172 CASSLGRGTEAFF 2161 CASSRWDGQETQYF 2107 CASSEQGGQPQHF 2053 CASSFYIEETQYF 2032 CASSPGLAVQETQYF 2025 CASSRDLATDTQYF 1975 CASSLDSGYNEQFF 1941 CASSFVGGTEAFF 1930 CASSRMRGEETQYF 1892 CAWTGDRSYYEQYF 1879 CAWSVGSDGYTF 1871 CASSLPVNTEAFF 1801 CASSAEWNQPQHF 1765 CASSPTGVGEAFF 1742 CAWNRLGMDTQYF 1739 CASSLTHASGEQYF 1733 CAWRDNLAEKLFF 1675 CASSLVSSGSDTQYF 1605 CAWSVLGPSPQYV 1563 CSVNSPALTGQPQHF

TGTGCCAGCAGCTTCGGGGACAGTATCCAAGAGACCCAGTACTTC

TGTGCCAGCAGCCCCCAGACTGAAGCTTTCTTT

TGTGCCAGCGGGGTCAATGAGCAGTTCTTC

TGTGCCTGGAGTGGGACAGGGGTTCGACAGCCCCAGCATTTT

TGTGCCAGCAGCCCGGGGGGGCTGAACACTGAAGCTTTCTTT

TGCGCCAGCAGCCTCCAGGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCTTTCTACAGGGGGCTCGCACTGAAGCTTTCTTT

TGTGCCAGCAGCCCGGGACTAGCATCGTACATTCAGTACTTC

TGTGCCTGGAACACGGGCCGCCATGAGCAGTTCTTC

TGTGCCACCAGCAGAGAAGGCGGCAGGGTCATGAACACTGAAGCTTTCTTT

TGTGCCAGTCGACAGGGGGCGGATGGCTACACCTTC

TGTGCCTGGAGGGCGGAATACACTGAAGCTTTCTTT

TGTGCCAGCAGCCCGGGGGGACTAGCGGGCGTCAATGAGCAGTTCTTC

TGTGCCAGCAGCTGGGGGACAGGGGACACAGATACGCAGTATTTT

TGTGCCAGCAGCCCAGCAAGCGGGTCCTACGAGCAGTACTTC

TGTGCCAGCAGCCAACACCGGACAGCTGGGGCCAACGTCCTGACTTTC

TGCGCCAGCAGGAGAGGGGGGGTGGATTCACCCCTCCACTTT

TGTGCCTGGACTAGCGCCGCCCGAGAGACCCAGTACTTC

TGTGCCTGGAGTCGGGGGGGCCGAGCTTTCTTT

TGTGCCAGCAGCTCGACACCGACAGGGGGAGGCTACACCTTC

TGTGCCACCAGCAGGTACGGAGAACACTCTGAAGCTTTCTTT

TGTGCCAGCATGGCGTCGGCAGGCTACGAGCAGTACTTC

TGTGCCTGGACCCGGACTATCCAAGAGACCCAGTACTTC

TGCAGTGCTAGATCCGGGACAGGGGTCGGGAGCAATCAGCCCCAGCATTTT

TGTGCCTGGAACGAACAGGATTTAGCCGGGGAGCTGTTTTTT

TGTGCCAGCAGCCCGGGGGGCGGGAGCTCCTACAATGAGCAGTTCTTC

TGCGCCAGCAGCCAAGACTGGCTAGCGGGAGTCGAGCAGTACTTC

TGTGCCAGCAGCTTAGGGAGGGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCCGTTGGGACGGACAAGAGACCCAGTACTTC

TGTGCCAGCAGCGAACAGGGAGGGCAGCCCCAGCATTTT

TGTGCCAGCAGCTTTTACATCGAAGAGACCCAGTACTTC

TGTGCCAGCAGTCCGGGACTAGCGGTACAAGAGACCCAGTACTTC

TGCGCCAGCAGCCGGGACCTAGCAACAGATACGCAGTATTTT

TGTGCCAGCAGCTTGGATAGCGGCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTCGTGGGGGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCCGCATGAGGGGGGAGGAGACCCAGTACTTC

TGTGCCTGGACTGGCGACAGGTCGTACTACGAGCAGTACTTC

TGTGCCTGGAGTGTCGGGTCGGATGGCTACACCTTC

TGTGCCAGCAGCCTTCCCGTGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCGCAGAATGGAATCAGCCCCAGCATTTT

TGTGCCAGCAGCCCGACGGGGGTAGGTGAAGCTTTCTTT

TGTGCCTGGAACCGACTGGGAATGGATACGCAGTATTTT

TGTGCCAGCAGCTTAACGCACGCTAGCGGGGAGCAGTACTTC

TGTGCCTGGAGAGATAACCTTGCGGAAAAACTGTTTTTT

TGTGCCAGCAGCTTGGTCTCTAGCGGGAGCGATACGCAGTATTTT

TGTGCCTGGAGTGTACTCGGGCCGAGTCCCCAGTACGTC

TGCAGTGTTAATAGTCCGGCTTTAACGGGACAGCCCCAGCATTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 33028 CASSASGTGSYEQYF 32838 CASSQAPSGVRPGELFF 22766 CAWTGEGAAGLRNQPQHF 21458 CASSQVGSLIEKLFF 19128 CAWNLYPGLAGTDTQYF 16761 CSVPGVWSYNEQFF 15048 CASSLGGTRLKNEKLFF 11894 CASSLVAGEGEFF 9692 CASSVDVGRSYEQYF 8359 CASSLGLDVETQYF 6894 CASSLWGQQTQYF 6173 CATSFPARHNEQFF 5746 CASSFDSGQGREKYF 5624 CASSPNSLAGVNEQFF 3550 CASSLASGTAGEQFF 3501 CASSFLLNPRDTQYF 3410 CASSHTGTSGTPQYF 3320 CSASFDSGNTIYF 3173 CASTHLSGTYNEQFF 2899 CASSRTVGNGYTF 2664 CASSYTGQGVYGYTF 2417 CASSFGATINYGYTF 2278 CA*QG_NGYTF 2235 CASSLVGNSGNTIYF 2208 CASSLEIGNEQFF 2169 CASSLRHTTGELFF 2146 CASSLGLAGNVRHYNEQFF 2135 CASSSAGEVKEQFF 1987 CASSFDRGNSPLHF 1796 CSVVPASRNTGELFF 1749 CASSISSSYNEQFF 1690 CSAGGLAISTDTQYF 1588 CASASGGANVLTF 1500 CASSIGNYNEQFF 1463 CAWSALGMGETQYF 1455 CAWSGGVGYNSPLHF 1455 CASSPRSDRGDSPLHF 1444 CAWRGASTDTQYF 1442 CASSLRTSGTETQYF 1438 CASSLARWATNEKLFF 1436 CSAGVGRDHGELFF 1415 CASSGGLSSYEQYF 1372 CSAGGGRDTQYF 1237 CASSLPRGHPGELFF 1205 CASRQGTNTGELFF

TGTGCCAGCAGCGCTTCCGGGACAGGGTCCTACGAGCAGTACTTC

TGCGCCAGCAGCCAAGCCCCCTCTGGGGTTAGGCCCGGGGAGCTGTTTTTT

TGTGCCTGGACGGGTGAAGGGGCCGCGGGGTTGCGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCCAAGTCGGAAGTCTAATTGAAAAACTGTTTTTT

TGTGCCTGGAACCTCTACCCGGGACTAGCGGGGACAGATACGCAGTATTTT

TGCAGCGTTCCAGGGGTCTGGTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTGGGGGGGACCAGACTGAAAAATGAAAAACTGTTTTTT

TGTGCCAGCAGCTTAGTCGCGGGAGAGGGGGAGTTCTTC

TGTGCCAGCAGCGTAGACGTCGGGAGGTCCTACGAGCAGTACTTC

TGCGCCAGCAGCTTGGGCTTGGATGTTGAGACCCAGTACTTC

TGTGCCAGCAGCTTGTGGGGGCAACAGACCCAGTACTTC

TGTGCCACCTCGTTTCCAGCGCGCCACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTTGATTCGGGACAAGGACGGGAAAAGTACTTC

TGTGCCAGCAGCCCAAACTCACTAGCGGGAGTCAATGAGCAGTTCTTC

TGTGCCAGCAGCTTGGCGAGCGGGACCGCCGGCGAGCAGTTCTTC

TGTGCCAGCAGCTTCCTCCTCAACCCCCGGGATACGCAGTATTTT

TGTGCCAGCAGCCACACCGGGACTAGCGGGACCCCGCAGTACTTC

TGCAGTGCTAGTTTTGATTCTGGAAACACCATATATTTT

TGTGCCAGCACCCATCTTAGCGGGACCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCAGGACCGTCGGGAATGGCTACACCTTC

TGTGCCAGCAGTTACACCGGACAGGGGGTCTATGGCTACACCTTC

TGTGCCAGCAGCTTCGGAGCCACCATTAACTATGGCTACACCTTC

TGTGCCTGACAGGGTGGAATGGCTACACCTTC

TGTGCCAGCAGCTTAGTTGGAAACTCTGGAAACACCATATATTTT

TGTGCCAGCAGCTTAGAGATCGGGAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAAGACACACCACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCCTAGGACTAGCGGGAAACGTCCGGCATTACAATGAGCAGTTC

TGTGCCAGCAGCTCAGCGGGAGAGGTCAAGGAGCAGTTCTTC

TGTGCCAGCAGCTTCGACAGGGGGAATTCACCCCTCCACTTT

TGCAGCGTTGTCCCGGCCAGCCGGAACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGTATTTCGAGCTCCTACAATGAGCAGTTCTTC

TGCAGTGCCGGGGGACTAGCGATTAGCACAGATACGCAGTATTTT

TGTGCCAGCGCATCAGGAGGGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCATCGGGAACTACAATGAGCAGTTCTTC

TGTGCCTGGAGTGCTCTGGGGATGGGGGAGACCCAGTACTTC

TGTGCCTGGAGTGGGGGGGTCGGCTATAATTCACCCCTCCACTTT

TGTGCCAGCAGCCCGCGCTCGGACAGGGGAGATTCACCCCTCCACTTT

TGTGCCTGGAGAGGGGCTAGCACAGATACGCAGTATTTT

TGTGCCAGCAGCTTAAGGACTAGCGGGACGGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGCCCGATGGGCAACTAATGAAAAACTGTTTTTT

TGCAGTGCTGGGGTAGGGAGGGACCACGGGGAGCTGTTTTTT

TGCGCCAGCAGCGGGGGACTTAGCTCCTACGAGCAGTACTTC

TGCAGTGCTGGGGGGGGAAGAGATACGCAGTATTTT

TGTGCCAGCAGCTTGCCCAGGGGGCATCCCGGGGAGCTGTTTTTT

TGTGCCAGCCGACAGGGAACGAACACCGGGGAGCTGTTTTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 30769 CASSRLAEGRYEQYV 25592 CSAYYTYQETQYF 25497 CAWSLDTQWSGYTF 22391 CSVARDPNAGELFF 17185 CASSLYVGKAFF 16483 CASSLVGNSGNTIYF 16483 CAWSVFPATQETQYF 13440 CAWSRGETQYF 11904 CASSRGTYEQYV 11250 CASSQDWRNTEAFF 10468 CSVEGTSGSYSYNEQFF 9927 CASSPLAQDRRPSLHF 9559 CASSLGWQGRETQYF 9529 CASTPVRVGTEAFF 8373 CAWSQPGSETQYF 7806 CASSSLVVYEQFF 7682 CAWRDETDYGYTF 7380 CASSTDRDAVNFF 7085 CAWGDRGDTEAFF 6503 CATSRVKGRGTEAFF 5636 CASSYVGNLNYGYTF 5460 CASSWRGADTQYF 5291 CASRSSPDETQYF 4367 CASSGIPGAKQFF 4216 CASSQGTSSEQYF 4008 CASSLSNTGELFF 3770 CASSLSLGAGANVLTF 3631 CASSQRGSSYNEQFF 2651 CASSWVGDTQYF 2391 CASSSGQGSYNEQFF 2099 CASSTGVEAFF 2025 CASSHRQGAATNEKLFF 1964 CAWSPSNQPQHF 1955 CASSFRGRDTEAFF 1858 CASRGGLAGVVEQFF 1731 CASSEGQGTQYF 1713 CASSARTSGNYNEQFF 1429 CSVDGLGPYEQYF 1423 CASSLNSGDTQYF 1329 CASSQWDTGELFF 1319 CACPELGQ_GVEGYTF 1083 CSGTWNEQFF 1078 CSARDHQRGQFGEQFF 1059 CASSFEGFEYGYTF 1017 CASSSRVIRQGTNGYTF 973 CASSLVENTEAFF 961 CASSFGGGYGYTF 961 CASSLNAAGVGETQYF 904 CASSLTPGLTDTQYF 796 CASSQGRGYTF 774 CATSEATGLYSGQFF 763 CASSLERTDTQYF

TGTGCCAGCAGTCGACTAGCGGAGGGGAGGTACGAGCAGTACGTC

TGCAGTGCTTATTACACCTACCAAGAGACCCAGTACTTC

TGTGCCTGGAGTTTGGACACCCAGTGGAGCGGCTACACCTTC

IGCAGCGIIGCCCGAGACCCAAAIGCCGGGGAGCIGIIIIII

TGTGCCAGCAGCTTGTACGTTGGGAAAGCTTTCTTT

TGTGCCAGCAGCTTAGTTGGAAACTCTGGAAACACCATATATTTT

TGTGCCTGGAGTGTCTTTCCAGCGACACAAGAGACCCAGTACTTC

TGTGCCTGGAGCAGGGGTGAGACCCAGTACTTC

TGTGCCAGCTCCCGGGGTACCTACGAGCAGTACGTC

TGTGCCAGCAGCCAAGATTGGCGGAACACTGAAGCTTTCTTT

TGCAGCGTTGAAGGGACTAGCGGGAGTTACTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCCCTCTAGCCCAAGACAGACGACCTTCCCTCCACTTT

TGTGCCAGCAGCTTAGGGTGGCAGGGGAGAGAGACCCAGTACTTC

TGTGCCAGCACTCCTGTCAGGGTCGGCACTGAAGCTTTCTTT

TGTGCCTGGAGCCAGCCGGGGTCGGAGACCCAGTACTTC

TGTGCCAGCAGCTCCCTAGTGGTCTATGAGCAGTTCTTC

TGTGCCTGGAGGGATGAGACCGATTATGGCTACACCTTC

TGTGCCAGCAGCACAGACCGGGACGCCGTGAATTTCTTT

TGTGCCTGGGGTGACAGGGGTGACACTGAAGCTTTCTTT

TGTGCCACCAGCAGAGTTAAGGGACGGGGAACTGAAGCTTTCTTT

TGTGCCAGCAGTTACGTGGGAAATCTTAACTATGGCTACACCTTC

TGTGCCAGCAGCTGGAGGGGGGCAGATACGCAGTATTTT

TGCGCCAGCAGGTCCAGTCCTGATGAGACCCAGTACTTC

TGTGCCAGCAGCGGAATTCCGGGCGCGAAGCAGTTCTTC

TGCGCCAGCAGCCAAGGGACTAGCAGCGAGCAGTACTTC

TGTGCCAGCAGCTTAAGCAACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTATCTTTAGGGGCTGGGGCCAACGTCCTGACTTTC

TGCGCCAGCAGCCAAAGGGGGAGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTGGGTTGGGGATACGCAGTATTTT

TGTGCCAGCAGTTCAGGACAGGGTTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCACAGGGGTTGAAGCTTTCTTT

TGTGCCAGCAGCCATCGACAGGGGGCTGCAACTAATGAAAAACTGTTTTTT

TGTGCCTGGAGTCCATCTAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTTAGGGGCAGGGATACTGAAGCTTTCTTT

TGTGCCAGCAGGGGTGGACTAGCGGGAGTTGTTGAGCAGTTCTTC

TGTGCCAGCAGTGAAGGACAGGGGACGCAGTATTTT

TGTGCTAGCAGCGCACGGACTAGCGGGAACTACAATGAGCAGTTCTTC

TGCAGCGTTGACGGTTTAGGGCCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAAACTCGGGAGATACGCAGTATTTT

IGIGCCAGCAGCCAGIGGGACACCGGGGAGCIGIIIIII

TGTGCCTGCCCGGAGCTGGGACAGGGGTGTTGAGGGCTACACCTTC

TGCAGTGGGACGTGGAATGAGCAGTTCTTC

TGCAGTGCTAGAGATCATCAACGTGGACAGTTCGGTGAGCAGTTCTTC

TGCGCCAGCAGCTTCGAGGGGTTCGAATATGGCTACACCTTC

TGTGCCAGCAGCTCGCGAGTAATACGACAGGGAACCAATGGCTACACCTTC

TGTGCCAGCAGCTTGGTAGAGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTTGGGGGAGGCTATGGCTACACCTTC

TGTGCCAGCAGCTTAAATGCAGCGGGAGTGGGCGAGACCCAGTACTTC

TGTGCCAGCAGCCTAACACCGGGGCTCACAGATACGCAGTATTTT

TGTGCCAGCAGCCAGGGTCGTGGCTACACCTTC

TGTGCCACCAGTGAAGCAACGGGACTTTACAGTGGGCAGTTCTTC

TGTGCCAGCAGCTTGGAACGAACAGATACGCAGTATTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 50115 CAWKDLARPADTQYF 37834 CASSFGVTSTDTQYF 36188 CASSQEGGRGSTDTQYF 30465 CASSYGPTGGYGYTF 26893 CSVDPRGAGAGYNEQFF 24874 CASSADRAANYGYTF 11409 CASSWGFRTGNEQFF 9488 CAGEGPRAGTGFDEQFF 8664 CASSHTGTSYTDTQYF 8244 CASSLGEGGPWETQYF 6509 CASSSSSGSSYNEQFF 5638 CASSARDNSGNTIYF 5384 CASSSFSGGSYNEQFF 4594 CASSPRRTGGINYGYTF 4318 CASSATGMVADTQYF 3500 CASSLLGGETQYF 3310 CASSLVPGVVEKLFF 3123 CSARDRRGWSYTF 3015 CSAGGGRDTQYF 2748 CASSQDGADTQYF 2518 CATSSGTGFWEQYF 2396 CAWSLRGLAGYGANVLTF 1797 CSSSVQGEQYF 1794 CASSFYGQGASSGETQYF 1556 CSARSGDRGEKLFF 1538 CASIPGARNTIYF 1536 CAWSVAREIGYTF 1386 CASSQGQTEETQYF 1255 CSAREQGSGTYEQYV 1165 CATSDLTKRARRETQYF 1117 CASSGGQGVGGYTF 1097 CASSYSGDTIYF 1095 CASRRTLGPNEQFF 1013 CASSLVGNSGNTIYF 925 CASSHRQGAATNEKLFF 794 CASSLMGSKETQYF 766 CASSYRNHNEQFF 745 CAWSVDRFQPQHF 695 CSARGGGDSPLHF 661 CASGPPRSDTQYF 650 CASSTDGNQPQHF 591 CASSLGKFAVDQPQHF 554 CSAASDEKLFF 507 CSGGVGYTF 504 CASSIGQGHTEAFF

TGTGCCTGGAAGGATCTAGCAAGGCCGGCAGATACGCAGTATTTT

TGTGCCAGCAGCTTCGGGGTAACTAGCACAGATACGCAGTATTTT

TGCGCCAGCAGCCAAGAGGGGGGCCGGGGGAGCACAGATACGCAGTATTTT

TGTGCCAGCAGTTACGGACCGACAGGGGGTTATGGCTACACCTTC

TGCAGCGTTGATCCACGAGGAGCGGGAGCGGGGTACAATGAGCAGTTCTTC

TGTGCCAGCAGCGCGGACAGGGCGGCTAACTATGGCTACACCTTC

TGTGCCAGCAGTTGGGGGTTTCGGACTGGCAATGAGCAGTTCTTC

TGTGCCGGCGAGGGACCTAGAGCCGGGACAGGGTTCGATGAGCAGTTCTTC

TGTGCCAGCAGCCATACCGGGACTAGCTACACAGATACGCAGTATTTT

TGCGCCAGCAGCCTGGGGGAGGGAGGGCCCTGGGAGACCCAGTACTTC

TGTGCCAGCAGCTCGTCTAGCGGGTCTTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGTGCCCGGGACAACTCTGGAAACACCATATATTTT

TGTGCCAGCAGTTCCTTTAGCGGGGGGTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCCCCAGGAGGACAGGGGGGATCAACTATGGCTACACCTTC

TGTGCCAGCAGCGCGACAGGGATGGTGGCAGATACGCAGTATTTT

TGTGCCAGCAGCTTATTAGGCGGAGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGTGCCAGGGGTGGTTGAAAAACTGTTTTTT

TGCAGTGCTAGAGATCGCAGGGGATGGTCCTACACCTTC

TGCAGTGCTGGGGGGGGAAGAGATACGCAGTATTTT

TGCGCCAGCAGCCAAGATGGCGCAGATACGCAGTATTTT

TGTGCCACCAGCTCCGGGACAGGGTTTTGGGAGCAGTACTTC

TGTGCCTGGAGTCTCCGCGGACTAGCGGGATATGGGGCCAACGTCCTGACTTTC

TGCAGCAGTTCAGTCCAGGGGGAGCAGTACTTC

TGTGCCAGCAGCTTCTATGGACAGGGGGCGTCCAGTGGAGAGACCCAGTACTTC

TGCAGTGCTAGATCGGGGGACAGGGGTGAAAAACTGTTTTTT

TGTGCCAGCATTCCGGGGGCGAGAAACACCATATATTTT

TGTGCCTGGAGTGTCGCCAGGGAGATCGGCTACACCTTC

TGTGCCAGCAGCCAGGGACAGACTGAAGAGACCCAGTACTTC

TGCAGTGCGCGAGAGCAAGGTAGCGGGACCTACGAGCAGTACGTC

TGTGCCACCAGTGATTTAACGAAGCGGGCCCGACGGGAGACCCAGTACTTC

TGTGCCAGCAGCGGCGGACAGGGGGTAGGAGGCTACACCTTC

TGTGCCAGCAGTTACTCTGGGGACACCATATATTTT

TGTGCCAGCAGACGGACACTGGGGCCCAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGTTGGAAACTCTGGAAACACCATATATTTT

TGTGCCAGCAGCCATCGACAGGGGGCTGCAACTAATGAAAAACTGTTTTTT

TGTGCCAGCAGCTTAATGGGCAGTAAAGAGACCCAGTACTTC

TGTGCCAGCAGTTACAGGAATCACAATGAGCAGTTCTTC

TGTGCCTGGAGTGTAGACCGGTTTCAGCCCCAGCATTTT

TGCAGTGCTAGAGGAGGGGGGGATTCACCCCTCCACTTT

TGTGCCAGCGGGCCCCCCCGTAGCGATACGCAGTATTTT

TGTGCCAGCAGCACGGACGGGAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAGGGAAGTTTGCAGTGGACCAGCCCCAGCATTTT

TGCAGTGCTGCCAGTGACGAAAAACTGTTTTTT

TGCAGTGGAGGGGTAGGCTACACCTTC

TGTGCCAGCAGTATAGGGCAGGGGCACACTGAAGCTTTCTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 36495 CAWSVLWLHQEETQYF 33746 CAQEKGRGGTDTQYF 29258 CASSPGPRGEQFF 25715 CASSSPRRQETQYF 17695 CATSRDPGSSYEQYF 15472 CASSGGTGSNYGYTF 15266 CSVGTANQPQHF 11870 CSARQQLNQPQHF 11755 CASSDHPGQGISYEQYV 9062 CASSAGTGAFQYF 8965 CASSLTGRDTEAFF 8587 CASSLGVGNYEQYF 7695 CASSQRPGPWGLTF 7323 CASSQVGDQPQHF 7103 CAWSKRPHTDTQYF 6747 CASSLAPGTGNEKLFF 5783 CASSRAGRGNTEAFF 5265 CSVGQGRTEAFF 5121 CSARDIGDSGIYSNQPQHF 4853 CASSQGTSGSLTGELFF 4464 CASTLEGAQETQYF 4456 CASSLGSGSSGANVLTF 4346 CASSLVAVGSTDTQYF 3906 CSVVLSGNEKLFF 3867 CASSEGNTEAFF 3534 CASSFGGDYGYTF 3377 CASSILADTQYF 3312 CASSYAGLANEQFF 3103 CAWSRGFQETQYF 3050 CASSFEGGTDTQYF 2614 CSARGQAPYQETQYF 2501 CASGDFGGPDTQYF 2491 CASSIGLADNEQFF 2376 CSVVGLAGEQFF 2168 CASSQDPGSPLTDTQYF 2135 CASSSHWDRGQFF 2129 CASSPGTSGIGNEQFF 1986 CASSSVGLAGAEQFF 1835 CASSLSSSRQYF 1547 CASSDIGTEAFF 1501 CASSLRSGWGPLNSPLHF 1486 CASSLDIQGVGGEQFF 1465 CASSQDPRETQYF 1449 CASSEVAGEGETQYF 1449 CASSLIPGLSEQFF 1443 CASSPQRDLEPQHF 1408 CAWSAGTANEKLFF

TGTGCCTGGAGTGTACTGTGGCTTCACCAAGAAGAGACCCAGTACTTC

TGTGCCCAGGAGAAGGGAAGGGGCGGCACAGATACGCAGTATTTT

TGTGCTAGCAGCCCCGGGCCCAGGGGTGAGCAGTTCTTC

TGTGCCAGCAGCTCCCCGCGAAGGCAAGAGACCCAGTACTTC

TGTGCCACCAGCAGAGATCCAGGGAGCTCCTACGAGCAGTACTTC

TGTGCCAGCAGCGGAGGGACAGGGTCCAACTATGGCTACACCTTC

TGCAGCGTTGGGACAGCCAATCAGCCCCAGCATTTT

TGCAGTGCTAGACAACAGCTTAATCAGCCCCAGCATTTT

TGTGCCAGCAGCGATCACCCGGGACAGGGAATTTCCTACGAGCAGTACGTC

TGTGCCAGCAGCGCCGGGACAGGGGCGTTTCAGTACTTC

TGTGCCAGCAGCTTAACTGGGCGGGACACTGAAGCTTTCTTT

TGTGCCAGCAGTCTAGGGGTAGGGAACTACGAGCAGTACTTC

TGCGCCAGCAGCCAGAGGCCGGGACCCTGGGGTCTCACCTTC

TGTGCCAGCAGCCAAGTGGGCGATCAGCCCCAGCATTTT

TGTGCCTGGAGTAAGCGGCCGCACACAGATACGCAGTATTTT

TGTGCCAGCAGCCTCGCCCCCGGGACAGGGAATGAAAAACTGTTTTTT

TGTGCCAGCAGCCGTGCTGGGAGGGGAAACACTGAAGCTTTCTTT

TGCAGCGTTGGCCAGGGGAGGACTGAAGCTTTCTTT

TGCAGTGCTAGAGATATAGGGGACAGCGGAATTTATAGCAATCAGCCCCAGCATTTT

IGCGCCAGCAGCCAAGGGACIAGCGGGAGIIIAACCGGGGAGCIGIIIIII

TGTGCCAGCACCTTGGAGGGGGCGCAGGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGGATCAGGGAGCTCTGGGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCTTAGTCGCCGTAGGTAGCACAGATACGCAGTATTTT

IGCAGCGIIGIACICICGGGGAAIGAAAAACIGIIIIII

TGTGCCAGCAGTGAGGGGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTCGGGGGGGACTATGGCTACACCTTC

IGIGCCAGCAGCAICCIGGCGGAIACGCAGIAIIII

TGTGCCAGCAGCTATGCGGGACTAGCGAATGAGCAGTTCTTC

TGTGCCTGGAGTCGAGGGTTCCAAGAGACCCAGTACTTC

TGCGCCAGCAGCTTTGAGGGAGGCACAGATACGCAGTATTTT

TGCAGTGCTAGGGGACAGGCCCCGTACCAAGAGACCCAGTACTTC

IGIGCCAGCGGGGAIIIIGGAGGGCCAGAIACGCAGIAIIII

TGTGCCAGCAGCATCGGACTAGCGGACAATGAGCAGTTCTTC

TGCAGCGTTGTAGGGCTAGCCGGCGAGCAGTTCTTC

TGCGCCAGCAGCCAAGATCCCGGGAGCCCTCTCACAGATACGCAGTATTTT

TGTGCCAGCAGTTCCCATTGGGACCGCGGGCAGTTCTTC

TGTGCCAGCAGCCCCGGGACTAGCGGGATCGGCAATGAGCAGTTCTTC

TGTGCCAGCAGCTCCGTGGGACTAGCGGGAGCCGAGCAGTTCTTC

TGTGCCAGCAGCTTAAGTTCTAGCCGGCAGTATTTT

TGTGCCAGCAGCGACATCGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCTTGAGATCCGGTTGGGGCCCCCTTAATTCACCCCTCCACTTT

TGTGCTAGCAGCTTAGATATCCAGGGGGTAGGGGGTGAGCAGTTCTTC

TGTGCCAGCAGCCAAGATCCCAGGGAGACCCAGTACTTC

TGTGCCAGCAGCGAAGTAGCGGGAGAGGGCGAGACCCAGTACTTC

TGTGCCAGCAGCTTAATCCCGGGACTAAGTGAGCAGTTCTTC

TGTGCCAGCAGCCCCCAGCGGGACCTTGAGCCCCAGCATTTT

IGIGCCIGGAGIGCCGGGACAGCIAAIGAAAAACIGIIIIII

Clone count CDR3 AA Seq

CDR3 DNA Seq 5713 CAWSGQNIQYF 2426 CAGRETQYF 2229 CAWSVQGAYGYTF 2138 CASSLMVWGYLPSLLF 1858 CAWSRSGTSGNEQFF 1827 CAWESGGNTEAFF 1769 CAWSEGLQLSTDTQYF 1666 CASSPNRPYEQYV 1636 CAWSVAVNYGYTF 1520 CAWSIGQGNTEAFF 1441 CAWTAPQGGVINQPQHF 1381 CAWSERVTQPQHF 1316 CAWSVQLDYEQYF 1255 CAWSPSNTQYF 1229 CAWAKGGRSTDTQYF 1202 CAGGRMNTEAFF 1164 CASSPGLAGGIYEQYV 1146 CACMTGGLATEAFF 1120 CASSLVSWSEQYF 1069 CASSLPD_SNQPQHF 1020 CAWSTGGGLGYTF 1011 CAWSVLAGSNEQFF 992 CAWSEGQGSGYTF 917 CAWQSGVAGANSYNEQFF 900 CAGGRGNQPQHF 856 CAWNRGGDGGTDTQYF 851 CASSQDWTSGPYSYNEQFF 807 CAWRPTGGRDQPQHF 790 CAWRTGTNYGYTF 776 CAWSPRSESQYF 767 CASRGQTNTEAFF 745 CAWGSAYGYTF 721 CSVRDRRNSPLHF 694 CAWMRQTNTEAFF 686 CAWSSGQHNQPQHF 662 CASNPGLAPYEQYF 654 CAWTTLMENTIYF 651 CATREEVEKLFF 611 CAWSSGREKLFF 606 CASRRVTGRSNEQFF 604 CAWNRGRQNIQYF 560 CAWSVGGVVNTEAFF 549 CAWRSDNSNQPQHF 542 CAWSVGLSGELFF 537 CAWSAGTSTDTQYF 531 CAWSVQGGNTGELFF 519 CASSLAV_QDGRYTF

TGTGCCTGGAGTGGCCAAAACATTCAGTACTTC

TGTGCCGGCAGAGAGACCCAGTACTTC

TGTGCCTGGAGTGTTCAGGGGGCGTATGGCTACACCTTC

TGTGCCAGCAGCTTAATGGTATGGGGATATCTTCCCTCGTTGCTCTTC

TGTGCCTGGAGTCGATCCGGGACTAGCGGCAATGAGCAGTTCTTC

TGTGCCTGGGAGTCTGGAGGGAACACTGAAGCTTTCTTT

TGTGCCTGGAGCGAGGGACTCCAGCTGAGCACAGATACGCAGTATTTT

TGTGCCAGCAGCCCAAATCGCCCCTACGAGCAGTACGTC

TGTGCCTGGAGTGTAGCCGTTAACTATGGCTACACCTTC

TGTGCCTGGAGTATCGGACAGGGAAACACTGAAGCTTTCTTT

IGIGCCIGGACGGCCCCCCAGGGIGGGGIGAICAAICAGCCCCAGCAIIII

IGIGCCIGGAGIGAAAGGGIIACICAGCCCCAGCAIIII

TGTGCCTGGAGTGTTCAACTGGACTACGAGCAGTACTTC

IGIGCCIGGAGCCCCICCAAIACGCAGIAIIII

TGTGCCTGGGCGAAGGGCGGACGCAGCACAGATACGCAGTATTTT

TGTGCCGGGGGGCGGATGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCCCCGGACTAGCGGGAGGGATATACGAGCAGTACGTC

TGTGCCTGTATGACAGGGGGCTTGGCCACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGTGTCCTGGTCCGAGCAGTACTTC

TGTGCCAGCAGCTTGCCGGATTAGCAATCAGCCCCAGCATTTT

TGTGCCTGGAGTACGGGAGGGGGGCTTGGCTACACCTTC

TGTGCCTGGAGTGTACTAGCGGGATCGAATGAGCAGTTCTTC

TGTGCCTGGAGTGAGGGGCAGGGCAGCGGCTACACCTTC

TGTGCCTGGCAGTCCGGGGTAGCGGGAGCAAACTCCTACAATGAGCAGTTCTTC

IGIGCCGGCGGGAGGGGIAAICAGCCCCAGCAIIII

IGIGCCIGGAACAGGGGCGGGGAIGGGGGCACAGAIACGCAGIAIIII

TGCGCCAGCAGCCAAGATTGGACTAGCGGGCCGTACTCCTACAATGAGCAGTTCTTC

TGTGCCTGGAGACCGACAGGGGGCCGAGATCAGCCCCAGCATTTT

TGTGCCTGGCGGACAGGGACCAACTATGGCTACACCTTC

TGTGCCTGGAGTCCCCGAAGCGAGTCCCAGTACTTC

TGTGCCAGCCGGGGACAAACGAACACTGAAGCTTTCTTT

TGTGCCTGGGGCAGTGCTTATGGCTACACCTTC

TGCAGCGTACGGGACAGGCGGAATTCACCCCTCCACTTT

TGTGCCTGGATGCGACAGACGAACACTGAAGCTTTCTTT

TGTGCCTGGAGTTCGGGACAGCACAATCAGCCCCAGCATTTT

TGTGCCAGCAATCCGGGACTTGCCCCCTACGAGCAGTACTTC

TGTGCCTGGACCACCCTGATGGAAAACACCATATATTTT

TGTGCCACCAGGGAGGAAGTCGAAAAACTGTTTTTT

IGIGCCIGGAGCAGCGGGAGGGAGAAACIGIIIIII

TGTGCCAGCAGACGGGTGACAGGGAGGAGCAATGAGCAGTTCTTC

TGTGCCTGGAACCGGGGCCGGCAAAACATTCAGTACTTC

TGTGCCTGGAGTGTGGGGGGCGTGGTGAACACTGAAGCTTTCTTT

TGTGCCTGGAGATCGGATAATAGCAATCAGCCCCAGCATTTT

IGIGCCIGGAGIGIIGGACIGICAGGGGAGCIGIIIIII

IGIGCCIGGAGIGCGGGGACIAGCACAGAIACGCAGIAIIII

IGIGCCIGGAGIGIACAGGGGGGIAAIACCGGGGAGCIGIIIIII

TGTGCCAGCAGCTTAGCGGTGGCAGGACGGCCGCTACACCTTC

Clone count CDR3 AA Seq

CDR3 DNA Seq 1975 CASREGSGTDTQYF 1670 CASSKGTANQPQHF 1380 CACVGQIYNEQFF 1157 CAWSAGANTEAFF 1027 CAWSAGARSTDTQYF 982 CAWAKGGRSTDTQYF 954 CARTGGPGSTGYTF 942 CAWSGDRVETQYF 930 CAWSGQNIQYF 843 CAWNEAAGNQPQHF 822 CASSLATDSAEAFF 818 CASSLGPSGSVGEQFF 813 CAGVGGTEAFF 809 CASSQGGGREPQHF 795 CASSPGRGSGTDTQYF 768 CACDSGIAYNEQFF 737 CAWSVRSPDTQYF 713 CAWSVQQNTEAFF 643 CASSFRTVASYEQYF 638 CAWKLQGSYNEQFF 634 CASSRPGQMNYGYTF 598 CASSLGGRESVYEQYF 569 CAWDKPGGNYNEQFF 561 CAAGTYTYEQYF 561 CASSRDLSGETQYF 544 CAWTGFGNNEQFF 541 CAWDSGRWEQYF 535 CASSLSGGQETQYF 519 CAWRDQGANYGYTF 516 CASSLGAGTEAFF 509 CASSLNGQRETQYF 505 CAWSVGTANTEAFF 501 CASSQKVILATSTDTQYF 486 CASSYWGGETQYF 473 CASSQDYVETQYF 466 CAWGSGDTQYF 451 CAWSWGGYGYTF 445 CASSFAATATEAFF 440 CASSLGADTEAFF 432 CASSSPGQGDEQYF 429 CASSPFFVGLEMETQYF 413 CAWSSYLNTQYF 408 CAWSTRGTLQETQYF 404 CASSPVTWTNSPLHF 397 CASSQRAGAAYEQYV 394 CAWTEGGPSGAFF 393 CASRPGLASWAGELFF 393 CASSQLGRDTEAFF 392 CGGDTGVENTEAFF 385 CAWSTGTVSYGYTF 385 CASSKGAGGTGELFF

TGTGCCAGCAGAGAGGGGTCTGGCACAGATACGCAGTATTTT

TGTGCCAGCAGCAAGGGGACAGCAAATCAGCCCCAGCATTTT

TGTGCCTGTGTGGGACAGATTTACAATGAGCAGTTCTTC

TGTGCCTGGAGTGCGGGGGCGAACACTGAAGCTTTCTTT

TGTGCCTGGAGTGCGGGTGCCAGAAGCACAGATACGCAGTATTTT

TGTGCCTGGGCGAAGGGCGGACGCAGCACAGATACGCAGTATTTT

TGTGCCCGGACAGGGGGCCCGGGGTCAACGGGCTACACCTTC

TGTGCCTGGAGTGGAGACAGGGTGGAGACCCAGTACTTC

TGTGCCTGGAGTGGCCAAAACATTCAGTACTTC

TGTGCCTGGAACGAGGCGGCAGGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAGCGACCGACAGCGCTGAAGCTTTCTTT

TGTGCCAGCAGCCTCGGTCCTAGCGGGAGTGTTGGGGAGCAGTTCTTC

TGTGCCGGGGTAGGGGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCCAAGGGGGGGGCCGCGAGCCCCAGCATTTT

TGTGCCAGCAGCCCAGGAAGGGGGTCCGGCACAGATACGCAGTATTTT

TGTGCCTGTGATAGCGGGATCGCCTACAATGAGCAGTTCTTC

TGTGCCTGGAGTGTACGGTCCCCAGATACGCAGTATTTT

TGTGCCTGGAGTGTACAGCAGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTCAGGACAGTCGCATCCTACGAGCAGTACTTC

TGTGCCTGGAAACTCCAGGGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCCGCCCGGGACAGATGAACTATGGCTACACCTTC

TGTGCCAGCAGCTTAGGGGGCAGGGAATCTGTCTACGAGCAGTACTTC

TGTGCCTGGGACAAACCAGGGGGAAACTACAATGAGCAGTTCTTC

TGTGCGGCCGGGACTTACACCTACGAGCAGTACTTC

TGTGCCAGCAGCCGGGACCTTTCCGGGGAGACCCAGTACTTC

TGTGCCTGGACGGGTTTCGGTAACAATGAGCAGTTCTTC

TGTGCCTGGGACAGCGGCAGGTGGGAGCAGTACTTC

TGTGCCAGCAGCTTGAGCGGAGGCCAAGAGACCCAGTACTTC

TGTGCCTGGAGGGATCAGGGGGCTAACTATGGCTACACCTTC

TGTGCCAGCAGCTTAGGGGCAGGGACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAAACGGGCAGCGGGAGACCCAGTACTTC

TGTGCCTGGAGTGTAGGGACAGCGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCCAAAAAGTGATCCTAGCTACTAGCACAGATACGCAGTATTTT

TGCGCCAGCAGCTATTGGGGGGGCGAGACCCAGTACTTC

TGCGCCAGCAGCCAAGATTATGTGGAGACCCAGTACTTC

TGTGCCTGGGGGAGTGGGGATACGCAGTATTTT

TGTGCCTGGTCATGGGGTGGCTATGGCTACACCTTC

TGTGCCAGCAGCTTCGCGGCAACGGCTACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGGGGCAGACACTGAAGCTTTCTTT

TGTGCCAGCAGCTCACCGGGACAGGGCGACGAGCAGTACTTC

TGCGCCAGCAGCCCTTTTTTTGTGGGACTAGAGATGGAGACCCAGTACTTC

TGTGCCTGGAGTTCCTATCTGAATACGCAGTATTTT

TGTGCCTGGAGTACCCGTGGGACTCTCCAAGAGACCCAGTACTTC

TGTGCCAGCAGCCCGGTGACTTGGACCAATTCACCCCTCCACTTT

TGTGCCAGCAGCCAACGCGCGGGAGCCGCCTACGAGCAGTACGTC

TGTGCCTGGACCGAGGGGGGGCCCTCAGGAGCTTTCTTT

TGTGCCAGCAGGCCGGGACTAGCGTCCTGGGCCGGGGAGCTGTTTTTT

TGTGCCAGCAGCCAACTGGGAAGGGACACTGAAGCTTTCTTT

TGTGGGGGGGACACAGGAGTAGAGAACACTGAAGCTTTCTTT

TGTGCCTGGAGTACCGGGACAGTTTCCTATGGCTACACCTTC

TGTGCTAGCAGCAAAGGGGCCGGGGGCACCGGGGAGCTGTTTTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 19802 CASSIGGGQSEQYF 6613 CASSPGSYNSPLHF 4686 CSAGPQALAGNEQFF 4057 CASSSSIAGDGANEQFF 3238 CASSTMHGLQETQYF 2883 CAWSGDDQPQHF 2455 CASSPPSGNYEQYF 2429 CASSLAEPGTDTQYF 2383 CAWSREFEQYF 2363 CASSLVGGSSTDTQYF 1823 CAWSVGASETQYF 1801 CASTQAGTSGSQWYF 1722 CASSQDRGTGAKAWGYTF 1680 CASSLDGYGYTF 1639 CATSRGRENTEAFF 1591 CASSPGLSTGELFF 1562 CASSLDVYTEAFF 1544 CAWGMGFYEQYF 1494 CASSRGLSSYEQYF 1492 CASSLAGSYNSPLHF 1453 CASSFEGRWGEQYF 1441 CAWSLALSNQPQHF 1386 CASSNFPGPDNEQFF 1339 CASSTSGAFTGELFF 1335 CASSPGGALETQYF 1293 CAWSVGLATDEQYF 1274 CASSKYEVQYF 1265 CASSSGQVTYEQYF 1230 CSAERQNTEAFF 1211 CASSEGQASWEQYF 1109 CASTIPNSPQYF 1100 CASSQSTGLITDTQYF 1070 CAWPWGERYEQYF 1023 CAWSGSSHEQYF 1023 CASSTGASDTQYF 983 CASSSQGRYNEQFF 973 CASSLGDTQYF 954 CAWNTGARGYTF 945 CASSQDGGASDTQYF 914 CASSRGGALETQYF 905 CASSLEGLPQHF 898 CAWSGNR_NQPQHF 870 CASSPPARNAYEQYF 853 CASSYHGLAQETQYF 847 CAWRPDRASSPLHF 832 CASSLDRGTEAFF 830 CAWDRGLETQYF 823 CAWSPGLAGLTDTQYF 817 CASSETTVNTEAFF 805 CASSSPTSLQETQYF 797 CAWSVPPGTEYADTQYF 794 CASSQEGQNYGYTF 793 CASSFAGGGTDTQYF

TGTGCCAGCAGTATAGGGGGAGGGCAGTCCGAGCAGTACTTC

TGTGCCAGCAGCCCGGGCTCCTATAATTCACCCCTCCACTTT

TGCAGTGCTGGCCCTCAGGCACTAGCGGGTAATGAGCAGTTCTTC

TGCGCCAGCAGCTCCTCCATAGCGGGAGATGGTGCGAATGAGCAGTTCTTC

TGTGCCAGCAGCACAATGCACGGACTGCAAGAGACCCAGTACTTC

IGIGCCIGGAGCGGGGAIGAICAGCCCCAGCAIIII

TGTGCCAGCAGCCCCCCTAGCGGGAACTACGAGCAGTACTTC

IGIGCCAGCAGCCIAGCGGAGCCCGGCACAGAIACGCAGIAIIII

TGTGCCTGGAGTCGGGAGTTCGAGCAGTACTTC

IGIGCCAGCAGCIIAGIIGGCGGIICIAGCACAGAIACGCAGIAIIII

TGTGCCTGGAGTGTGGGGGCCTCAGAGACCCAGTACTTC

TGTGCCAGCACGCAAGCCGGGACTAGCGGGTCCCAATGGTACTTC

TGTGCCAGCAGCCAAGATCGGGGGACAGGGGCCAAGGCTTGGGGCTACACCTTC

TGCGCCAGCAGCTTGGATGGGTATGGCTACACCTTC

TGTGCCACCAGCAGAGGCCGGGAAAACACTGAAGCTTTCTTT

TGTGCCAGCAGCCCGGGACTCAGCACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTGGACGTCTACACTGAAGCTTTCTTT

TGTGCCTGGGGGATGGGGTTCTACGAGCAGTACTTC

TGTGCCAGCAGCAGGGGGCTGAGCTCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGCAGGCTCCTATAATTCACCCCTCCACTTT

TGTGCCAGCAGCTTCGAGGGGCGATGGGGCGAGCAGTACTTC

TGTGCCTGGAGTCTTGCTCTTAGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCAATTTCCCGGGACCGGACAATGAGCAGTTCTTC

TGTGCCAGCAGTACTAGCGGAGCTTTCACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCCCGGGGGGGGCGCTGGAGACCCAGTACTTC

TGTGCCTGGAGTGTCGGACTAGCCACGGACGAGCAGTACTTC

TGTGCCAGCAGCAAATATGAGGTGCAGTACTTC

TGTGCCAGCAGCTCAGGACAGGTGACCTACGAGCAGTACTTC

TGCAGCGCAGAACGACAGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCGAGGGACAGGCGTCCTGGGAGCAGTACTTC

TGTGCCAGCACCATCCCAAACAGTCCCCAGTACTTC

IGIGCCAGCAGCCAAICIACGGGACICAICACAGAIACGCAGIAIIII

TGTGCCTGGCCGTGGGGGGAAAGGTACGAGCAGTACTTC

TGTGCCTGGAGCGGGAGCTCCCACGAGCAGTACTTC

IGIGCCAGCAGCACCGGGGCGICAGAIACGCAGIAIIII

TGTGCCAGCAGTTCCCAGGGACGCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGGGGATACGCAGTATTTT

TGTGCCTGGAATACAGGGGCGAGGGGCTACACCTTC

IGCGCCAGCAGCCAAGAIGGGGGAGCIICAGAIACGCAGIAIIII

TGTGCCAGCAGCCGGGGGGGGGCATTGGAGACCCAGTACTTC

IGIGCCAGCAGCIIAGAGGGACIACCCCAGCAIIII

IGIGCCIGGAGCGGAAACAGGGAAICAGCCCCAGCAIIII

TGTGCCAGCAGCCCACCAGCTAGAAACGCCTACGAGCAGTACTTC

TGTGCCAGCAGTTACCATGGACTAGCCCAAGAGACCCAGTACTTC

TGTGCCTGGCGCCCCGACAGGGCCAGTTCACCCCTCCACTTT

TGCGCCAGCAGCTTGGACAGGGGGACTGAAGCTTTCTTT

TGTGCCTGGGACAGGGGCCTGGAGACCCAGTACTTC

TGTGCCTGGAGTCCGGGACTAGCGGGACTCACAGATACGCAGTATTTT

TGTGCCAGCAGCGAGACGACGGTGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTCCCCCACTAGCTTACAAGAGACCCAGTACTTC

IGIGCCIGGAGIGIACCCCCCGGGACCGAGIAIGCAGAIACGCAGIAIIII

TGTGCCAGCAGCCAAGAAGGGCAGAACTATGGCTACACCTTC

IGCGCCAGCAGCIIIGCGGGAGGCGGCACAGAIACGCAGIAIIII

Clone count CDR3 AA Seq

CDR3 DNA Seq

TGTGCCAGCAGCCCGGGCTCCTATAATTCACCCCTCCACTTT 4530 CASSPGSYNSPLHF

TGTGCCAGCAGCCCCCGCTTTCGCTACACCTTC 4500 CASSPRFRYTF

TGTGCCAGCAGCCCTGGTGGGACTTTATACGAGCAGTACTTC 3591 CASSPGGTLYEQYF

TGCAGTGCTTCCGGGACTAGCGGGCGCAGCTACGAGCAGTACTTC 3217 CSASGTSGRSYEQYF

TGTGCCAGCAGCTTAGAGCTGGACTATGGCTACACCTTC 3184 CASSLELDYGYTF

TGTGCCAGCAGCCGGGGGCCTTATAATTCACCCCTCCACTTT 3082 CASSRGPYNSPLHF

TGTGCCAGCAGCTTAGGGCAGGGCCATGGCTACACCTTC 3015 CASSLGQGHGYTF

TGTGCCAGCAGCCGACAACAGCCTGGCACCGGGGAGCTGTTTTTT 2898 CASSRQQPGTGELFF

TGTGCCCGGGGGGTCTACCCGAACACCGGGGAGCTGTTTTTT 2779 CARGVYPNTGELFF

TGTGCCAGCAGCGATACCGGGACTAGCGGGATGCCCTACGAGCAGTACTTC 2674 CASSDTGTSGMPYEQYF

TGTGCCAGCAGCCCCATGCGCACAGATACGCAGTATTTT 2601 CASSPMRTDTQYF

TGTGCCAGCAGGACGGCCTCCCAAGAGACCCAGTACTTC 2576 CASRTASQETQYF

TGTGCCAGCAGCTTAGTTGGCGGTTCTAGCACAGATACGCAGTATTTT 2343 CASSLVGGSSTDTQYF

TGTGCCACCAGCAGAGGAATATACGACACTGAAGCTTTCTTT 2296 CATSRGIYDTEAFF

TGTGCCAGCAGCTACAACATGAACACTGAAGCTTTCTTT 2280 CASSYNMNTEAFF

TGTGCCAGCACTCGGGGGTTAAGGGCTGAAGCTTTCTTT 2143 CASTRGLRAEAFF

TGTGCCTGTCAGGGACAGAGCTACAATGAGCAGTTCTTC 2071 CACQGQSYNEQFF

TGCGCCAGCAGCTTTGCGGGAGCTGGGACAGATACGCAGTATTTT 1980 CASSFAGAGTDTQYF

TGTGCCAGCAGCCCGACAGGCACTGGGGCCAACGTCCTGACTTTC 1797 CASSPTGTGANVLTF

TGTGCCAGCAGCCCCCCCACTAGCGGGCCTCACAATGAGCAGTTCTTC 1761 CASSPPTSGPHNEQFF

TGTGCCTGGTCGGAGAGGCCAACTGACAATGAGCAGTTCTTC 1733 CAWSERPTDNEQFF

TGTGCCAGCAGCTCCGGGACAGGGGGAGGAGAAGCTTTCTTT 1711 CASSSGTGGGEAFF

TGTGCCTGGGGAACGACAGGGTCCCATGGCTACACCTTC 1674 CAWGTTGSHGYTF

TGCAGCGTTGAAGGGCTAGCGGGAGGGCCTCGAGAGACCCAGTACTTC 1659 CSVEGLAGGPRETQYF

TGTGCCTGGTCTCCCTCCGGGTCCCCTTATGGCTACACCTTC 1650 CAWSPSGSPYGYTF

TGTGCCTGGAGCGGAGCCGGGCTCAATCAGCCCCAGCATTTT 1604 CAWSGAGLNQPQHF

TGTGCCAGCAGCCGGACGGTCGCGGGAGGACCCACAGATACGCAGTATTTT 1483 CASSRTVAGGPTDTQYF

TGTGCCTGGAGCCCTACCCCCGGTGGCTACACCTTC 1453 CAWSPTPGGYTF

TGTGCCTGGAGTACTTTTACAGGGGGAAGCACTGAAGCTTTCTTT 1300 CAWSTFTGGSTEAFF

TGTGCCACCAGCAGAGATAGGAGACAGGGGGTAGAGCAGTTCTTC 1253 CATSRDRRQGVEQFF

TGCGCCAGCAGCTTTGCGGGAGGCGGCACAGATACGCAGTATTTT 1166 CASSFAGGGTDTQYF

TGTGCCACCAGCAGAAATGTGGCAGAGACCCAGTACTTC 1118 CATSRNVAETQYF

TGTGCCAGCAGCCCCTACCAAGAGACCCAGTACTTC 1102 CASSPYQETQYF

TGTGCCTGGAGCTCCTCTGCGAACACAGATACGCAGTATTTT 1089 CAWSSSANTDTQYF

TGTGCCAGCAGTCCAACCCTTAAATCCTACGAGCAGTACTTC 1082 CASSPTLKSYEQYF

TGTGCCAGCAGCCCGGGACTCAGCACCGGGGAGCTGTTTTTT 1005 CASSPGLSTGELFF

TGTGCCAGCAGCTGGGGTTGGACAGGCAATGAGCAGTTCTTC 987 CASSWGWTGNEQFF

TGTGCCAGCAGCAAATATGAGGTGCAGTACTTC 976 CASSKYEVQYF

TGTGCCAGCAGCTTATTCGCTAGCGGGAGCACAGATACGCAGTATTTT 941 CASSLFASGSTDTQYF

TGTGCCAGCAGCTCCCAAGGCGGGTCCAACACCGGGGAGCTGTTTTTT 941 CASSSQGGSNTGELFF

TGCAGCGTGGGTGAGGCCGCTAATCAGCCCCAGCATTTT 940 CSVGEAANQPQHF

TGTGCCAGCAGCTTATCGGCTAGCGGGCATACCGGGGAGCTGTTTTTT 917 CASSLSASGHTGELFF

TGTGCCAGCAGCACCGGACAGTGGGGCTACACCTTC 913 CASSTGQWGYTF

TGTGCCAGCAGCTTAGCAGGGCTGTACAATGAGCAGTTCTTC 875 CASSLAGLYNEQFF

TGTGCCTGGAGTCGACAGGGAAACGAGCAGTACTTC 837 CAWSRQGNEQYF

TGTGCCAGCAGCCAAGTTTGGGGACAGGGTCGGTTCTTC 835 CASSQVWGQGRFF

Clone count CDR3 AA Seq

CDR3 DNA Seq 33006 CASSRSSAPGDSEKLFF 16214 CSVGSPITYEQYF 14121 CASSFDRGSPLHF 11011 CAWRVGTPNTEAFF 9585 CASSLQAGYTGELFF 6010 CSGKRESDNEQFF 5129 CASSDEPGVYGYTF 5061 CASSSPRANRRSGYTF 4748 CASSLWGQGSQPQHF 4288 CASQPGYGYTF 3584 CATSREGLAGGTDTQYF 3247 CASSLRADSYNEQFF 2931 CASSRTRQHSPLHF 2865 CASSLGPAGAKETQYF 2806 CASSLEILLGGIETQYF 2526 CASCPGTGSSPLHF 2379 CASSRTSGRSDTQYF 2235 CASSYSPPANEQFF 2020 CASSFGGGGYTF 1864 CASSPRTSLDIQYF 1785 CAWRSGTPPVELFF 1684 CAWRVGTPNTEAFF 1602 CASSQGQHHGYTF 1465 CASSSLTGNTEAFF 1387 CATSREGLAGGTDTQYF 1355 CSAGREQDNEQFF 1303 CASTLLDRGEQFF 1298 CASSFGFF 1261 CASSLSDRGHEQYF 1193 CASSLGGGTEAFF 1054 CASSLIRVRGLETQYF 1004 CASSLYRGGEAFF 984 CASRSGLAGDVHTQYF 943 CSASLSGRDAGEQFF 930 CASRTSAHGDEQYF 904 CASSQARNPRRFF 840 CAYDRGPNQPQHF 801 CASSFSRFEQYF 775 CASTLLRSTDTQYF 744 CASSLAPNPNNEQFF 726 CASVRDRGRSGANVLTF 725 CAWRLDRRNYGYTF 722 CASSLTSAGEQFF 704 CSARNIRTGGLRAYEQYF 691 CASSSGTADYFHF

TGTGCCAGCAGCCGATCTTCGGCCCCAGGGGACAGCGAAAAACTGTTTTTT

TGCAGCGTTGGCAGCCCCATTACCTACGAGCAGTACTTC

TGTGCCAGCAGCTTCGACAGGGGTTCACCCCTCCACTTT

TGTGCCTGGAGAGTTGGGACACCGAACACTGAAGCTTTCTTT

TGCGCCAGCAGCTTGCAGGCCGGCTACACCGGGGAGCTGTTTTTT

TGCAGTGGGAAACGGGAGTCCGACAATGAGCAGTTCTTC

TGTGCCAGCAGCGATGAGCCAGGGGTCTATGGCTACACCTTC

TGTGCCAGCAGCTCCCCTAGGGCTAACAGGAGGTCGGGCTACACCTTC

TGTGCCAGCAGCTTGTGGGGACAGGGGAGTCAGCCCCAGCATTTT

TGTGCCAGCCAGCCCGGCTATGGCTACACCTTC

TGTGCCACCAGCAGAGAGGGACTAGCGGGAGGCACAGATACGCAGTATTTT

TGTGCCAGCAGCTTAAGAGCGGACTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCCGAACACGTCAGCATTCACCCCTCCACTTT

TGTGCCAGCAGCTTAGGGCCCGCGGGAGCCAAAGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGAGATCTTACTAGGGGGTATCGAGACCCAGTACTTC

TGTGCCAGCTGCCCCGGGACAGGGAGCTCACCCCTCCACTTT

TGCGCCAGCAGCCGTACTAGCGGGAGATCCGATACGCAGTATTTT

TGTGCCAGCAGTTACTCCCCGCCAGCCAATGAGCAGTTCTTC

TGTGCCAGCAGCTTCGGGGGCGGTGGCTACACCTTC

TGTGCCAGCAGCCCACGGACTAGCCTTGACATTCAGTACTTC

TGTGCCTGGAGGTCAGGGACACCCCCGGTAGAGCTGTTTTTT

TGTGCCTGGAGGGTAGGGACACCGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCCAAGGACAGCACCATGGCTACACCTTC

TGTGCCAGCAGCTCCCTGACAGGTAACACTGAAGCTTTCTTT

TGTGCCACCAGCAGAGAGGGACTAGCGGGAGGGACAGATACGCAGTATTTT

TGCAGTGCTGGGCGGGAGCAGGATAATGAGCAGTTCTTC

TGTGCCAGCACCCTCCTAGACCGGGGTGAGCAGTTCTTC

TGTGCCAGCAGCTTCGGGTTCTTC

TGTGCCAGCAGCTTAAGTGACAGGGGACACGAGCAGTACTTC

TGTGCCAGCAGCCTTGGTGGAGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAATTAGAGTCAGGGGATTGGAGACCCAGTACTTC

TGTGCCAGCAGTTTATATCGGGGAGGTGAAGCTTTCTTT

TGCGCCAGCAGATCGGGACTAGCGGGAGATGTGCATACGCAGTATTTT

TGCAGTGCTAGCCTTAGCGGGAGAGATGCGGGTGAGCAGTTCTTC

TGTGCCAGCAGAACCTCCGCCCACGGGGACGAGCAGTACTTC

TGCGCCAGCAGCCAAGCCAGGAACCCACGTCGGTTCTTC

TGTGCCTATGACCGGGGTCCTAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTTAGCAGGTTCGAGCAGTACTTC

TGTGCCAGCACCTTGTTGAGGAGCACAGATACGCAGTATTTT

TGCGCCAGCAGCTTGGCACCGAACCCTAACAATGAGCAGTTCTTC

TGTGCCAGTGTCCGGGACAGGGGACGTTCTGGGGCCAACGTCCTGACTTTC

TGTGCCTGGAGGTTGGACAGGCGAAACTATGGCTACACCTTC

TGTGCCAGCAGCTTAACGTCGGCGGGAGAGCAGTTCTTC

TGCAGTGCTAGAAATATTCGGACAGGGGGCCTCCGAGCCTACGAGCAGTACTTC

TGTGCCAGCAGCTCCGGGACAGCCGACTATTTTCATTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 28532 CASSRQWNTEAFF 18973 CSARDWSGRTDTQYF 9961 CAWSVLDTHGYTF 9880 CAWNRAFDEQYF 7706 CASSQGQGYGYTF 7146 CASSLDLLAKNIQYF 5909 CASSTLTSGNQEQFF 4891 CASSYRGGEAFF 4848 CASSGLAPSSYNEQFF 3685 CASIQAGLVQETQYF 2775 CSVGSPITYEQYF 2417 CASGQRGNEKLFF 2183 CASSADGGRMTSYNEQFF 2061 CASSLRTSGNTQYF 1756 CASSTWTDQPQHF 1671 CAL_FF 1670 CASSFSSTDTQYF 1491 CASSQGSTAGQPQHF 1398 CASTPRRRNTGELFF 1258 CAWSLGRNQPQHF 1200 CASSARQGENTEAFF 1171 CASCPGTGSSPLHF 1125 CASRLTRPTPYEQYF 1122 CASSSDRVAPLHF 1104 CSARGTPASTDTQYF 1079 CAWGGLAGEGTQYF 1061 CASSFIVTGGGNEQFF 1003 CSVGEGWGRYGYTF 1003 CASRGGTGSNTEAFF 995 CASSYGAPVSYEQYF 940 CASSLTGGLTRSGANVLTF 925 CAWSANGKYNEQFF 913 CATSSRRGGWESNTEAFF 912 CATSLGQGRYTF 888 CASSDQPNTEAFF 866 CASSSRLGEQYF 850 CAWRPRGFGYEQYF 823 CASSVAQTGEQFF 809 CASSLHGNEKLFF 805 CASSLDIRSYEQYF 800 CASIPSGRSYEQYF 792 CASGSAGNQPQHF 785 CSASVLAHISVQFF 772 CASSFAYGYTF 740 CASSLSGAGSFDTQYF

TGTGCCAGCAGCCGTCAGTGGAACACTGAAGCTTTCTTT

TGCAGTGCTAGAGATTGGAGCGGAAGAACAGATACGCAGTATTTT

TGTGCCTGGAGTGTACTGGACACACATGGCTACACCTTC

TGTGCCTGGAACCGGGCCTTCGACGAGCAGTACTTC

TGTGCCAGCAGCCAAGGACAGGGATACGGCTACACCTTC

TGTGCCAGCAGCTTGGACTTATTAGCCAAAAACATTCAGTACTTC

TGCGCCAGCAGCACTCTGACTAGCGGGAATCAGGAGCAGTTCTTC

TGTGCCAGCAGTTACCGAGGCGGAGAAGCTTTCTTT

TGTGCCAGCAGCGGACTAGCACCTAGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGTATCCAAGCCGGACTAGTTCAAGAGACCCAGTACTTC

TGCAGCGTTGGCAGCCCCATTACCTACGAGCAGTACTTC

TGTGCCAGCGGACAGCGTGGGAATGAAAAACTGTTTTTT

TGTGCCAGCAGCGCCGACGGCGGGCGCATGACCTCCTACAATGAGCAGTTCTTC

TGCGCCAGCAGCTTGCGGACTAGTGGCAATACGCAGTATTTT

TGTGCCAGCAGCACTTGGACAGATCAGCCCCAGCATTTT

TGTGCCTTGGGTTTTTC

TGTGCCAGCAGCTTTTCTAGCACAGATACGCAGTATTTT

TGTGCCAGCAGCCAGGGCAGTACTGCTGGCCAGCCCCAGCATTTT

TGTGCCAGCACCCCGCGAAGGCGGAACACCGGGGAGCTGTTTTTT

TGTGCCTGGAGTTTGGGGCGGAATCAGCCCCAGCATTTT

TGTGCCAGCAGCGCCCGACAGGGGGAGAACACTGAAGCTTTCTTT

TGTGCCAGCTGCCCCGGGACAGGGAGCTCACCCCTCCACTTT

TGTGCCAGCAGACTCACCAGACCTACGCCCTACGAGCAGTACTTC

TGTGCCAGCAGTTCTGACAGGGTTGCACCCCTCCACTTT

TGCAGTGCTAGAGGGACGCCGGCCTCCACAGATACGCAGTATTTT

TGTGCCTGGGGGGGACTAGCGGGAGAGGGGACCCAGTACTTC

TGCGCCAGCAGCTTTATTGTAACGGGAGGAGGGAATGAGCAGTTCTTC

TGCAGCGTTGGTGAAGGGTGGGGTCGCTATGGCTACACCTTC

TGTGCCAGCCGTGGGGGGACAGGGTCAAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTATGGAGCGCCAGTGTCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTGACAGGGGGACTAACGCGCTCTGGGGCCAACGTCCTGACT

TGTGCCTGGAGTGCAAACGGGAAATACAATGAGCAGTTCTTC

TGTGCCACCAGCAGCCGTCGGGGGGGCTGGGAATCGAACACTGAAGCTTTCTTT

TGTGCCACCTCCCTGGGACAGGGACGTTACACCTTC

TGTGCCAGCAGCGACCAACCGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTCTCGCCTCGGCGAGCAGTACTTC

TGTGCCTGGAGGCCTCGGGGGTTCGGGTACGAGCAGTACTTC

TGTGCCAGCAGCGTAGCCCAGACGGGTGAGCAGTTCTTC

TGTGCCAGCAGTTTACACGGGAATGAAAAACTGTTTTTT

TGTGCCAGCAGCTTAGATATCCGATCCTACGAGCAGTACTTC

TGTGCCAGCATTCCTAGCGGGAGGTCCTACGAGCAGTACTTC

TGTGCCAGCGGTTCCGCTGGCAATCAGCCCCAGCATTTT

TGCAGTGCTAGTGTCCTAGCGCACATATCTGTGCAGTTCTTC

TGTGCCAGCAGCTTCGCATATGGCTACACCTTC

TGTGCCAGCAGCTTATCCGGGGCGGGATCTTTCGACACGCAGTATTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 12343 CASSRDRTNGYTF 11145 CASSLVSEQYF 5901 CASSFSRTSGSKRDTQYF 5516 CAWNPDGDGYTF 4140 CAWSGGISGNTIYF 4103 CASRQTGTGTGELFF 3850 CASSRPGLAQYF 3410 CASSLFPRGTQYF 3123 CASRTGQGGTDTQYF 2965 CASSFGEGYNEQFF 2892 CASSLEILLGGIETQYF 2087 CASSFSGSSPDTQYF 2072 CAWSEGSGSVDTQYF 2068 CASSLARGRGAFF 2013 CASSLATFTGELFF 1838 CASSTSGSYEQYF 1814 CASSLGVARNQPQHF 1749 CASSQELSFDTQYF 1638 CASSLGPNQPQHF 1553 CASSLGGQGFKPQHF 1495 CASSLGSTDTQYF 1471 CASSQDRRAGLDEQYF 1235 CASSQGQGPDSPLHF 1210 CASTSPRTGGNEQYF 1185 CASSLNGGKGNQPQHF 1161 CANLD*WFPDTQYF 1068 CSASLGFSSYGYTF 1054 CSARAGIGSNQPQHF 1052 CASSLTGQGPQFF 992 CASSHLLAGYEQYF 958 CASSAGQGPYEQYF 937 CSVGGKEGRWTEAFF 867 CASSDRGGGFF 845 CASSSSTGVQVAFF 838 CASSLRTGILPETQYF 835 CASSHSPSERETQYF 811 CASSYGQGGTDTQYF 700 CSALDRGLRETQYF 700 CASSYRQGDYEQYF 681 CARGTAPTDTQYF 653 CASSSQDRAGVRGEQFF 624 CASSLNPSGTYTDTQYF 604 CTSSRDRTNGYTF 601 CSARGTVFNTEAFF 571 CAWSGERSAEAFF

TGCGCCAGCAGCCGGGACAGAACTAATGGCTACACCTTC

TGTGCCAGCAGCTTAGTAAGCGAGCAGTACTTC

TGTGCCAGCAGCTTCTCCCGGACTAGCGGGAGTAAACGAGATACGCAGTATTTT

TGTGCCTGGAACCCGGACGGAGATGGCTACACCTTC

TGTGCCTGGAGTGGTGGGATCTCTGGAAACACCATATATTTT

TGTGCCAGCAGGCAGACCGGGACAGGGACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCCGGCCGGGACTGGCGCAGTATTTT

TGTGCCAGCAGCTTATTTCCGCGGGGGACCCAGTACTTC

TGTGCCAGCAGGACGGGACAGGGGGGCACAGATACGCAGTATTTT

TGTGCCAGCAGCTTTGGGGAGGGGTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGAGATCTTACTAGGGGGTATCGAGACCCAGTACTTC

TGTGCCAGCAGCTTCAGCGGGAGCAGCCCAGATACGCAGTATTTT

TGTGCCTGGAGTGAAGGTAGCGGGAGCGTTGATACGCAGTATTTT

TGTGCCAGCAGCTTAGCAAGGGGTCGGGGAGCTTTCTTT

TGTGCCAGCAGCTTAGCAACCTTCACCGGGGAGCTGTTTTTT

TGTGCCAGCTCGACTAGCGGGAGTTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGGTGTGGCTCGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCCAAGAGCTCAGCTTCGATACGCAGTATTTT

TGTGCCAGCAGCTTAGGCCCCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAGGCGGACAGGGATTTAAGCCCCAGCATTTT

TGTGCCAGCAGCTTAGGAAGCACAGATACGCAGTATTTT

TGTGCCAGCAGCCAAGACCGCCGAGCGGGGTTAGACGAGCAGTACTTC

TGCGCCAGCAGCCAAGGACAGGGGCCGGATTCACCCCTCCACTTT

TGTGCCAGCACCTCCCCCCGGACAGGGGGTAACGAGCAGTACTTC

TGTGCCAGCAGCTTGAACGGGGGAAAAGGGAATCAGCCCCAGCATTTT

TGTGCCAACCTTGACTAATGGTTTCCAGATACGCAGTATTTT

TGCAGTGCTAGTTTGGGGTTTTCCAGCTATGGCTACACCTTC

TGCAGTGCTAGGGCAGGGATCGGGAGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAACGGGACAGGGGCCCCAGTTCTTC

TGCGCCAGCAGCCACCTACTAGCGGGCTACGAGCAGTACTTC

TGTGCCAGCAGCGCCGGACAGGGCCCCTACGAGCAGTACTTC

TGCAGCGTTGGTGGCAAGGAGGGACGGTGGACTGAAGCTTTCTTT

TGTGCCAGCAGCGATCGAGGGGGCGGGTTCTTC

TGTGCCAGCAGCTCCTCTACCGGGGTACAGGTAGCTTTCTTT

TGTGCCAGCAGCCTACGGACAGGGATCCTCCCGGAGACCCAGTACTTC

TGCGCCAGCAGCCATAGTCCTAGCGAGAGGGAGACCCAGTACTTC

TGTGCCAGCAGTTACGGACAGGGAGGAACAGATACGCAGTATTTT

TGCAGTGCTTTGGACAGGGGGCTTCGAGAGACCCAGTACTTC

TGTGCCAGCAGTTACAGACAGGGAGACTACGAGCAGTACTTC

TGTGCCAGAGGGACGGCTCCCACAGATACGCAGTATTTT

TGTGCCAGCAGTTCCCAGGACCGAGCGGGGGTTCGGGGTGAGCAGTTCTTC

TGTGCCAGCAGCTTAAATCCTAGCGGGACATACACAGATACGCAGTATTTT

TGCACCAGCAGCCGGGACAGAACTAATGGCTACACCTTC

TGCAGTGCTAGAGGGACAGTGTTTAACACTGAAGCTTTCTTT

TGTGCCTGGAGTGGTGAGAGGAGTGCTGAAGCTTTCTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 61638 CASSLDGGRNNEQFF 25157 CASSSPPTGVYEQYF 13979 CAWRIGSGANVLTF 12753 CASSQETSGRRDTQYF 9797 CASSLRQGRNEKLFF 8664 CASSPSNSYEQYF 5454 CAWSTGSLNEQYF 4830 CASSLTEGMNTEAFF 4359 CSALGNEQFF 3789 CAWSFSTAGGYTF 3344 CAWRSGRIITPLHF 3327 CASSLGGRYEQYF 3103 CAWSEGTHYEQYF 2728 CASSLAYRINSGANVLTF 2710 CAWSSQWTGQFF 2620 CASSLDRSREQYF 2592 CAWSSETTGRGEKLFF 2301 CASSTTAPGEQYF 2159 CAWRRLAATVTQYF 2097 CASSLGQGGGYTF 1915 CASSQSYSEKAYF 1816 CASSLAGGYGYTF 1414 CAWSVGLISYEQYF 1383 CACRQGWADTQYF 1321 CASSLVASTYEQYF 1030 CAWSGPTGSGGYTF 956 CASSLDSGKQYF 855 CASSSGGSYNEQFF 841 CASSFLPQETQYF 830 CASSQAPGNEQFF 763 CASSLGGSSDTQYF 762 CASSYTGYNSPLHF 727 CASSYGGSNYGYTF 702 CACSTFNTGELFF 676 CASSLYDRGGEQFF 622 CASRTSAHGDEQYF 528 CASSLPTDPEKLFF 511 CASSDPQEPQFF 506 CASSTSGFYEQYF 455 CAWSPLAANVLTF 449 CASSQDEGGGSRQDTQYF 406 CASGRGGSSYNEQFF 385 CASSLVGGTGELFF 368 CASSSPRRYNEQFF 365 CASSLRTSGNTQYF

TGTGCTAGCAGCTTAGATGGGGGCCGGAACAATGAGCAGTTCTTC

TGTGCCAGCAGCTCCCCCCCGACAGGGGTCTACGAGCAGTACTTC

TGTGCCTGGAGGATCGGTTCTGGGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCCAAGAGACTAGCGGGAGAAGAGATACGCAGTATTTT

TGTGCCAGCAGCCTTCGACAGGGGCGGAATGAAAAACTGTTTTTT

TGTGCCAGCAGCCCTAGCAACTCCTACGAGCAGTACTTC

TGTGCCTGGAGTACAGGGAGTCTCAACGAGCAGTACTTC

TGCGCCAGCAGCTTGACGGAGGGGATGAACACTGAAGCTTTCTTT

TGCAGTGCCCTAGGCAATGAGCAGTTCTTC

TGTGCCTGGAGTTTTTCGACGGCGGGAGGCTACACCTTC

TGTGCCTGGAGGTCGGGACGAATAATCACACCCCTCCACTTT

TGTGCCAGCAGCTTAGGGGGAAGATACGAGCAGTACTTC

TGTGCCTGGAGTGAAGGGACCCACTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGCCTACAGGATAAACTCTGGGGCCAACGTCCTGACTTTC

TGTGCCTGGAGTTCCCAGTGGACCGGGCAGTTCTTC

TGTGCCAGCAGCCTTGACCGCTCGAGGGAGCAGTACTTC

TGTGCCTGGAGTTCCGAAACGACAGGGAGGGGTGAAAAACTGTTTTTT

TGTGCCAGCAGCACAACAGCACCCGGCGAGCAGTACTTC

TGTGCCTGGAGGAGACTAGCCGCCACCGTTACGCAGTATTTT

TGTGCCAGCAGCTTGGGACAGGGAGGAGGCTACACCTTC

TGCGCCAGCAGCCAAAGTTACTCCGAGAAAGCGTACTTC

TGTGCCAGCAGTTTAGCGGGGGGCTATGGCTACACCTTC

TGTGCCTGGAGTGTAGGGCTGATCTCCTACGAGCAGTACTTC

TGTGCCTGCCGACAGGGTTGGGCAGATACGCAGTATTTT

TGTGCCAGCAGCTTAGTGGCGTCTACCTACGAGCAGTACTTC

TGTGCCTGGAGTGGCCCCACAGGGAGCGGTGGCTACACCTTC

TGTGCCAGCAGCCTAGACTCAGGGAAGCAGTATTTT

TGTGCCAGCAGTTCGGGGGGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTTTTGCCACAAGAGACCCAGTACTTC

TGCGCCAGCAGCCAAGCCCCGGGGAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGGAGGGAGCTCAGATACGCAGTATTTT

TGTGCCAGCAGTTATACAGGCTATAATTCACCCCTCCACTTT

TGTGCCAGCAGTTACGGCGGTTCTAACTATGGCTACACCTTC

TGTGCCTGCTCGACTTTTAACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTATATGACAGGGGAGGCGAGCAGTTCTTC

TGTGCCAGCAGAACCTCCGCCCACGGGGACGAGCAGTACTTC

TGTGCCAGCAGCTTGCCCACGGATCCTGAAAAACTGTTTTTT

TGTGCCAGCAGTGACCCCCAAGAGCCCCAGTTCTTC

TGTGCCAGCAGTACTAGCGGCTTTTACGAGCAGTACTTC

TGTGCCTGGAGTCCTTTAGCGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCCAAGATGAGGGCGGCGGGAGTAGACAAGATACGCAGTATT

TGTGCCAGCGGCCGCGGGGGGAGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGTCGGTGGCACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTCCCCTCGACGTTACAATGAGCAGTTCTTC

TGCGCCAGCAGCTTGCGGACTAGTGGCAATACGCAGTATTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 2797 CAWRRLRGNTEAFF 2135 CAWSVRRAADEFF 1934 CAWSAGPAGKLFF 1839 CAWSVLAGGQPQHF 1800 CASSLASGQMNTEAFF 1623 CAWSVGLGPYSNQPQHF 1526 CALIREGRETQYF 1503 CAWSGRTVYGYTF 1257 CAWQTGGRFQPQHF 1008 CAWTSGNSGNTIYF 992 CAWRNAGTSGDNEQFF 988 CAWSVRSTDTQYF 975 CALRRGGGGYTF 940 CAWSPRRADTQYF 933 CAWSYGYEQYF 906 CAWSKDRSYEQYF 877 CAWSEGLTYEQYF 862 CAWSAGYGYTF 855 CASSPKGRE_ASAYNEQFF 855 CAWSVRTGTGQPQHF 832 CAWSRNRGTSGYTF 824 CAWRGDSGAYEQYF 823 CASSPRKW*RSRWPPLHF 794 CASSPSWT_RKNTEAFF 776 CAWTGTGVGYTF 765 CAWSWQLGGYTF 751 CACTRAESYNSPLHF 740 CAWSEAINYGYTF 735 CAWSSAMDTQYF 723 CAWRELAGRSYNEQFF 717 CAGGGDCTEAFF 705 CAWSRGTAKNSPLHF 677 CAWNPDYRYGYTF 661 CASSQLASETQYF 643 CAWSDGRPNQPQHF 642 CASRDRVYGYTF 638 CAWSLGGTYNSPLHF 627 CAWSRSDSLLTEAFF 622 CAWSTDWVQYF 621 CAYVRTGVYEQYF 620 CAWELQRNTEAFF 607 CARKPDRAGCNQPQHF 600 CAWSVPGIGNYGYTF 592 CAGGGRLQETQYF 580 CAWSGEANVLTF

TGTGCCTGGAGAAGGCTCAGGGGGAACACTGAAGCTTTCTTT

TGTGCCTGGAGCGTCCGGCGAGCGGCGGATGAGTTCTTC

TGTGCCTGGAGCGCCGGGCCCGCTGGAAAACTGTTTTTT

TGTGCCTGGAGTGTACTGGCGGGGGGTCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAGCATCGGGACAGATGAACACTGAAGCTTTCTTT

TGTGCCTGGAGTGTTGGGTTAGGCCCCTATAGCAATCAGCCCCAGCATTTT

TGTGCCCTTATAAGGGAGGGCCGTGAGACCCAGTACTTC

TGTGCCTGGAGTGGCCGGACAGTCTATGGCTACACCTTC

TGTGCCTGGCAAACTGGGGGCAGGTTTCAGCCCCAGCATTTT

TGTGCCTGGACGAGCGGCAACTCTGGAAACACCATATATTTT

TGTGCCTGGAGAAACGCCGGGACTAGCGGGGACAATGAGCAGTTCTTC

TGTGCCTGGAGTGTAAGAAGCACAGATACGCAGTATTTT

TGTGCCTTACGTCGGGGAGGCGGCGGCTACACCTTC

TGTGCCTGGAGTCCGCGGAGGGCCGATACGCAGTATTTT

TGTGCCTGGAGTTACGGTTACGAGCAGTACTTC

TGTGCCTGGAGTAAAGATCGCTCCTACGAGCAGTACTTC

TGTGCCTGGAGTGAGGGGCTTACCTACGAGCAGTACTTC

TGTGCCTGGAGTGCGGGGTATGGCTACACCTTC

TGTGCCAGCAGCCCTAAGGGGCGGGAGGGCCAGCGCCTACAATGAGCAGTTCTTC

TGTGCCTGGAGTGTTCGGACAGGGACAGGTCAGCCCCAGCATTTT

TGTGCCTGGAGTCGGAACAGGGGGACCTCAGGCTACACCTTC

TGTGCCTGGAGGGGGGACAGTGGGGCCTACGAGCAGTACTTC

TGTGCCAGCAGCCCCCGGAAATGGTGACGTTCAAGGTGGCCACCCCTCCACTTT

TGTGCCAGCAGCCCCTCCTGGACCCCAGAAAAAACACTGAAGCTTTCTTT

TGTGCCTGGACCGGGACAGGGGTAGGCTACACCTTC

TGTGCCTGGAGTTGGCAGCTGGGCGGCTACACCTTC

TGTGCCTGCACACGAGCGGAATCCTATAATTCACCCCTCCACTTT

TGTGCCTGGAGTGAAGCGATTAACTATGGCTACACCTTC

TGTGCCTGGAGTTCGGCTATGGATACGCAGTATTTT

TGTGCCTGGAGGGAACTAGCGGGAAGAAGCTATAATGAGCAGTTCTTC

TGTGCCGGCGGAGGGGATTGCACTGAAGCTTTCTTT

TGTGCCTGGAGCAGGGGGACAGCGAAGAATTCACCCCTCCACTTT

TGTGCCTGGAATCCCGACTACCGCTATGGCTACACCTTC

TGCGCCAGCAGCCAACTCGCCAGTGAGACCCAGTACTTC

TGTGCCTGGAGTGATGGGCGCCCCAATCAGCCCCAGCATTTT

TGTGCCAGCCGGGACAGGGTATATGGCTACACCTTC

TGTGCCTGGAGTTTGGGAGGGACCTATAATTCACCCCTCCACTTT

TGTGCCTGGAGTAGGTCAGATTCACTGTTGACTGAAGCTTTCTTT

TGTGCCTGGAGTACCGACTGGGTGCAGTACTTC

TGTGCCTACGTGCGGACAGGGGTCTACGAGCAGTACTTC

TGTGCCTGGGAACTACAGAGGAACACTGAAGCTTTCTTT

TGTGCCCGGAAACCAGACAGGGCAGGGTGCAATCAGCCCCAGCATTTT

TGTGCCTGGAGTGTCCCAGGGATTGGGAACTATGGCTACACCTTC

TGTGCCGGAGGGGGCAGACTCCAAGAGACCCAGTACTTC

TGTGCCTGGTCGGGTGAGGCCAACGTCCTGACTTTC

Clone count CDR3 AA Seq

CDR3 DNA Seq 7459 CASYYQGATEAFF 1003 CASSLSGGAGELFF 797 CALIPGQGDEKLFF 656 CAWSVYAAETQYF 635 CASSNGWEQFF 531 CASSPRNNEQFF 508 CASSKLAGGVGNEQFF 495 CASSLGQGSGANVLTF 456 CAWSVRLRNEQFF 424 CASSFGQSGGYTF 405 CAWIGQNYGYTF 401 CATSSRDTERGYTF 400 CASHFRNTEAFF 386 CASSLGLSNQPQHF 385 CAWSWGSKDQPQHF 382 CASSLPSVGNYGYTF 379 CASSDGGHRGRQPQHF 376 CASSQDPNQPQHF 372 CASSPRTGNQPQHF 363 CASSSTGTSGRRDQYF 356 CASSLKKTQYF 355 CASSSQQGYNEQFF 352 CASSQDRSSGRVDEQFF 351 CASASDRVGTEAFF 346 CAWSYARGIMNTEAFF 329 CASSLGLVAEAFF 326 CAWRLQGPGELFF 321 CASSWREDASNQPQHF 309 CASSLGQGSTGELFF 299 CAWTQGSYYGYTF 297 CASSADSAVSYGYTF 293 CASRLQGATEAFF 290 CASSLGTGYSPLHF 289 CASSSWSSRGRDEQYF 289 CAGGVATGEQFF 284 CAWTDGGTEAFF 283 CASSLGLNTEAFF 278 CAWSVRERDTQYF 277 CASSLTTSGPNTGELFF 275 CASSLDGSGANVLTF 272 CASSQSSPYEQYF 266 CASSLGAGRHSPLHF 264 CASSLTGGLTRSGANVLTF 262 CATSRDYGSDQVGEQYF 257 CASSFQGQETQYF 257 CASSLTAEGEAFF

TGTGCCAGTTATTATCAGGGGGCGACTGAAGCTTTCTTT

TGTGCCAGCAGTTTGAGCGGGGGAGCCGGGGAGCTGTTTTTT

TGTGCCTTAATTCCGGGACAGGGGGATGAAAAACTGTTTTTT

TGTGCCTGGAGTGTGTATGCGGCAGAGACCCAGTACTTC

TGTGCCAGCAGCAACGGCTGGGAGCAGTTCTTC

TGTGCCAGCAGCCCAAGAAACAATGAGCAGTTCTTC

TGTGCCAGCAGCAAACTAGCGGGAGGGGTAGGCAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGGACAGGGCTCTGGGGCCAACGTCCTGACTTTC

TGTGCCTGGAGTGTACGGCTCAGGAATGAGCAGTTCTTC

TGTGCCAGCAGCTTCGGACAGTCAGGTGGCTACACCTTC

TGTGCCTGGATCGGACAGAACTATGGCTACACCTTC

TGTGCCACCAGCAGCCGGGACACGGAACGGGGCTACACCTTC

TGTGCCAGCCACTTCAGGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGGGCTGAGCAATCAGCCCCAGCATTTT

TGTGCCTGGAGTTGGGGTAGTAAGGATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTACCCTCGGTGGGTAACTATGGCTACACCTTC

TGTGCCAGCAGCGACGGGGGCCACAGGGGGCGTCAGCCCCAGCATTTT

TGTGCCAGCAGCCAAGATCCCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCCCGCGGACAGGGAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTCGACCGGGACTAGCGGGAGGAGGGACCAGTACTTC

TGTGCCAGCAGCTTAAAAAAGACCCAGTACTTC

TGTGCCAGCAGCTCTCAGCAGGGGTACAATGAGCAGTTCTTC

TGCGCCAGCAGCCAAGATCGGTCTAGCGGGAGGGTCGATGAGCAGTTCTTC

TGTGCCAGCGCCTCGGATAGGGTAGGCACTGAAGCTTTCTTT

TGTGCCTGGAGTTACGCGCGGGGGATCATGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGGGCTGGTGGCTGAAGCTTTCTTT

TGTGCCTGGAGACTACAGGGACCCGGGGAGCTGTTTTTT

IGIGCCAGCAGCIGGCGGGAGGACGCAICCAAICAGCCCCAGCAIIII

TGTGCCAGCAGCTTGGGACAGGGGTCGACCGGGGAGCTGTTTTTT

TGTGCCTGGACACAAGGCTCCTACTATGGCTACACCTTC

TGTGCCAGCAGCGCAGACAGTGCCGTTAGCTATGGCTACACCTTC

TGTGCCAGCAGGCTACAGGGGGCCACTGAAGCTTTCTTT

TGTGCCAGCAGCTTGGGGACAGGGTATTCACCCCTCCACTTT

TGTGCCAGCAGCTCTTGGAGCTCGAGGGGCAGGGACGAGCAGTACTTC

TGTGCTGGGGGAGTAGCGACGGGTGAGCAGTTCTTC

TGTGCCTGGACCGACGGAGGGACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGGTCTCAACACTGAAGCTTTCTTT

TGTGCCTGGAGTGTCCGGGAAAGAGATACGCAGTATTTT

TGTGCTAGCAGTCTAACAACTAGCGGGCCCAACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTAGACGGCTCTGGGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCCAATCTTCCCCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGGGGCAGGGAGGCATTCACCCCTCCACTTT

TGTGCCAGCAGCTTGACAGGGGGACTAACGCGCTCTGGGGCCAACGTCCTGACTTTC

TGTGCCACCAGCAGAGATTACGGTTCGGACCAGGTGGGCGAGCAGTACTTC

TGTGCTAGCAGCTTTCAGGGGCAAGAGACCCAGTACTTC

TGTGCCAGCAGCTTAACGGCCGAGGGGGAAGCTTTCTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 23724 CASSPLAGVGYNEQFF 19583 CASSLRRQRGDTQYF 12924 CSVLRDPNSYEQYF 10982 CAWSAGPYEQYF 7151 CASSTFGGGYTF 5211 CASRRSGRGYTGELFF 4553 CASSLGRFNQPQHF 3477 CSVHRDPNSHEQFF 3476 CASSQGGGVLDTQYF 3181 CASSLTGEPAYEQYF 3074 CASSLRDAGYGYTF 2845 CASSLISGRAGRTGELFF 2719 CASSLQSPSMNTEAFF 2662 CASSYSRQGAFEAFF 2474 CAWSLGDYQPQHF 2228 CASSLRGGRQNTEAFF 1895 CASSLLLAQYF 1605 CASSRPRGDSSYEQYF 1604 CALEGGAVGTQYF 1587 CASRRTGEGNQPQHF 1412 CASSLTSGTSYEQYF 1307 CARQGEGPDTQYF 1305 CASSQDWAGRGHGYTF 1269 CASSSTGTNTEAFF 1260 CASSLAQGPHEQYF 1257 CASSLTGTGGANVLTF 1178 CASSFTGAMNTEAFF 1163 CASSLEAGGPQYF 1127 CASSLIGYEQYF 1074 CSAAPGSGGGETQYF 1026 CASSTHLWETQYF 1026 CASSLAVGRQGNEQFF 1007 CATTPGQGARGYTF 1004 CASSLGLRSGRDNEQFF 977 CASSQRPQGANEKLFF 932 CASSQRSADYTGELFF 915 CASSLVAGKETQYF 883 CASSLGGNTEAFF 873 CAWSPGWNIQYF 870 CSATPTGVAGKLFF 806 CSVSTGGQPQHF 741 CSAREGYNEKLFF 735 CASSQDRVGSYNEQFF 712 CASSQTSSGSTDTQYF 697 CATSSEPLGEQYF

TGTGCCAGCAGCCCCCTAGCGGGAGTAGGTTACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTGCGGCGGCAGCGAGGAGATACGCAGTATTTT

TGCAGCGTACTCCGGGACCCTAATTCCTACGAGCAGTACTTC

TGTGCCTGGAGCGCCGGGCCCTACGAGCAGTACTTC

TGTGCCAGCAGCACGTTTGGGGGAGGCTACACCTTC

TGTGCCAGCAGGCGAAGCGGGCGGGGATACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTAGGCAGATTCAATCAGCCCCAGCATTTT

TGCAGCGTACACCGGGACCCGAACTCCCATGAGCAGTTCTTC

TGTGCCAGCAGCCAGGGTGGGGGAGTGCTTGATACGCAGTATTTT

TGTGCCAGCAGCTTAACGGGGGAGCCCGCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAAGGGACGCCGGGTATGGCTACACCTTC

TGCGCCAGCAGCCTAATTAGCGGGAGGGCCGGAAGAACCGGGGAGCTGTTTT

TGTGCCAGCAGCTTACAAAGCCCCTCAATGAACACTGAAGCTTTCTTT

TGTGCCAGCAGTTACTCGCGACAGGGGGCTTTTGAAGCTTTCTTT

TGTGCCTGGAGTCTCGGAGACTATCAGCCCCAGCATTTT

TGTGCCAGCAGCCTTAGGGGGGGACGGCAGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCCTTCTATTGGCCCAGTACTTC

TGTGCCAGCAGCCGACCCCGAGGTGACTCCTCCTACGAGCAGTACTTC

TGTGCCCTGGAGGGGGGGGCAGTAGGGACCCAGTACTTC

TGCGCCAGCAGGAGGACAGGGGAAGGCAATCAGCCCCAGCATTTT

TGCGCCAGCAGCCTGACGTCCGGGACCTCCTACGAGCAGTACTTC

TGTGCCCGCCAGGGGGAAGGCCCAGATACGCAGTATTTT

TGCGCCAGCAGCCAAGATTGGGCAGGGAGAGGTCATGGCTACACCTTC

TGCGCCAGCAGCTCGACAGGGACGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGCACAGGGTCCCCACGAGCAGTACTTC

TGCGCCAGCAGCTTGACAGGCACTGGAGGGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCTTTACAGGAGCAATGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGAGGCGGGGGGTCCCCAGTACTTC

TGTGCCAGCAGCTTAATCGGGTACGAGCAGTACTTC

TGCAGTGCCGCCCCCGGGTCGGGAGGAGGGGAGACCCAGTACTTC

TGTGCCAGCAGCACCCACCTGTGGGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGCTGTCGGACGACAGGGGAATGAGCAGTTCTTC

TGTGCCACCACACCGGGACAGGGGGCGCGCGGCTACACCTTC

TGTGCCAGCAGCTTAGGGCTGAGGAGCGGGAGGGACAATGAGCAGTTCTTC

TGTGCCAGCAGCCAACGTCCTCAGGGAGCTAATGAAAAACTGTTTTTT

TGTGCCAGCAGCCAAAGATCAGCGGATTACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTAGTTGCGGGAAAAGAGACCCAGTACTTC

TGTGCCAGCAGCCTAGGGGGGAACACTGAAGCTTTCTTT

TGTGCCTGGAGTCCCGGGTGGAACATTCAGTACTTC

TGCAGTGCTACACCCACCGGGGTCGCTGGTAAACTGTTTTTT

TGCAGCGTTTCGACAGGGGGCCAGCCCCAGCATTTT

TGCAGTGCTAGAGAAGGGTATAATGAAAAACTGTTTTTT

TGCGCCAGCAGCCAAGATAGAGTGGGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCCAAACATCTAGCGGTTCTACAGATACGCAGTATTTT

TGTGCCACCAGCAGTGAGCCGTTGGGCGAGCAGTACTTC

Clone count CDR3 AA Seq

CDR3 DNA Seq

TGTGCCAGCAGTTACTCGCGACAGGGGGCTTTTGAAGCTTTCTTT 33215 CASSYSRQGAFEAFF

TGTGCCAGCAGCTTAAAGGGGCGACTAGCGGGAGGGCGGGAGCAGTTCTTC 9603 CASSLKGRLAGGREQFF

TGCGCCAGCAGGGCCCAGGGGCAGGGGAATGAGCAGTTCTTC 7217 CASRAQGQGNEQFF

TGTGCCAGCAGCCTGGGGACAGGCCAAGAGACCCAGTACTTC 4168 CASSLGTGQETQYF

TGTGCCTCCGAGAGGGGTCAGGGAAACATTCAGTACTTC 4025 CASERGQGNIQYF

TGTGCCAGCAGCTTAGCTTACAATCAGCCCCAGCATTTT 3651 CASSLAYNQPQHF

TGTGCCAGCAGCGTGGGACAGGGGGAAGGCTACACCTTC 3272 CASSVGQGEGYTF

TGCAGCGTACTCCGGGACCCTAATTCCTACGAGCAGTACTTC 3244 CSVLRDPNSYEQYF

IGIGCCICIGCGACIAGCGGGIICCCAGAIACGCAGIAIIII 2871 CASATSGFPDTQYF

TGTGCCCGCCAGGGGGAAGGCCCAGATACGCAGTATTTT 2801 CARQGEGPDTQYF

TGCGCCAGCAGCCAAGGTACCGCGAGCTCCTACAATGAGCAGTTCTTC 2693 CASSQGTASSYNEQFF

IGIGCCAGCAGCIIAGICGGAGIICAGIIIAAIGAAAAACIGIIIIII 2506 CASSLVGVQFNEKLFF

IGIGCCAGCAGCIICCGAAIAACCGGGGAGCIGIIIIII 2426 CASSFRITGELFF

TGTGCCTGGAGTGTACTCGACGGGGGGAGAAATGGCTACACCTTC 2302 CAWSVLDGGRNGYTF

TGTGCCAGCAGCTTATTTGGGACAGGGGACAATCAGCCCCAGCATTTT 2011 CASSLFGTGDNQPQHF

TGTGCCTGGAGTGTACGCCAGGGGGACGAGCAGTACTTC 2004 CAWSVRQGDEQYF

TGTGCCAGCAGCTTTTCGGGACAGGGACCCTATGGCTACACCTTC 1815 CASSFSGQGPYGYTF

TGTGCCTGGAGTGTACGCGTTAGAGAGACCCAGTACTTC 1772 CAWSVRVRETQYF

TGTGCCTGGAGTCGGCAGGGAGATGGCTACACCTTC 1723 CAWSRQGDGYTF

TGCAGCGTACACCGGGACCCGAACTCCCATGAGCAGTTCTTC 1637 CSVHRDPNSHEQFF

TGTGCCAGCAGCTTAGTGGGGGACAGGGCTTACGAGCAGTACTTC 1600 CASSLVGDRAYEQYF

TGTGCCAGCAGCTTCACCGCCACGGGGTCCCAGTACTTC 1490 CASSFTATGSQYF

IGIGCCAGCAGCIACCCGGGACIIIACACCGGGGAGCIGIIIIII 1462 CASSYPGLYTGELFF

TGTGCCTGGAGCGCCGGGCCCTACGAGCAGTACTTC 1453 CAWSAGPYEQYF

TGTGCCAGCAGCCTGTGGTCCCACCAAGAGACCCAGTACTTC 1442 CASSLWSHQETQYF

TGTGCCAGCAGCTTAACTGGACAGGGACATAGTGGCTACACCTTC 1346 CASSLTGQGHSGYTF

TGTGCCAGCTCACCGGGACTAGCGGGAGGTGGAGAGACCCAGTACTTC 1344 CASSPGLAGGGETQYF

TGTGCCGTCGGCGGTTTAGCCTCCTACAATGAGCAGTTCTTC 1326 CAVGGLASYNEQFF

TGTGCCAGCAGCTTAGAGGCGGGACGCACAGATACGCAGTATTTT 1247 CASSLEAGRTDTQYF

TGCGCCAGCAGCCGGGACCGACAGGGAGAGACGGATGAGCAGTTCTTC 1240 CASSRDRQGETDEQFF

TGTGCCAGCAGCTTAGTTGCGGGAAAAGAGACCCAGTACTTC 1192 CASSLVAGKETQYF

IGIGCCIGGAGIGCCCAAAIIICGGGICAGCCCCAGCAIIII 1171 CAWSAQISGQPQHF

TGTGCCAGCAGCCCCCAGACAGGGACGAGCAATCAGCCCCAGCATTTT 1059 CASSPQTGTSNQPQHF

TGTGCCACCAGCAGAGCCCCGGACGGACCCTACGAGCAGTACTTC 1037 CATSRAPDGPYEQYF

TGCAGCGTAGCCGGGACAGGGGCCGAGACCCAGTACTTC 990 CSVAGTGAETQYF

TGCGCCAGCAGCCAAGGGGGGTCCACTGCTTTCTTT 979 CASSQGGSTAFF

TGTGCCAGCAGCCCATACAGGATTCGGACGAACACCGGGGAGCTGTTTTTT 890 CASSPYRIRTNTGELFF

TGTGCCTGGAGTGTAGCGGGAGAGACCCAGTACTTC 853 CAWSVAGETQYF

TGTGCCAGCAGCCGCCAGACAGGGCGGAACACTGAAGCTTTCTTT 799 CASSRQTGRNTEAFF

TGTGCCAGCAGCTTAGTCCGATCTGGAAACACCATATATTTT 766 CASSLVRSGNTIYF

TGCAGCTCAGCTCGGGACACAGATACGCAGTATTTT 759 CSSARDTDTQYF

TGCAGCCCCCTGGCTAAAGAGACCCAGTACTTC 755 CSPLAKETQYF

TGTGCCAGCAGCTTAACCCCGTTAGGGGGAGGCACAGATACGCAGTATTTT 730 CASSLTPLGGGTDTQYF

TGTGCCAGCAGCCGACCCCGAGGTGACTCCTCCTACGAGCAGTACTTC 713 CASSRPRGDSSYEQYF

TGTGCCAGCAGCCCCGGGGGAGCGGGATTTCGGGAGACCCAGTACTTC 707 CASSPGGAGFRETQYF

TGCAGTGCTAGGGACAACATGAACACTGAAGCTTTCTTT 707 CSARDNMNTEAFF

TGTGCCAGCAGCTTAGTACCTAGCGGGAACTCCTACGAGCAGTACTTC 705 CASSLVPSGNSYEQYF

Clone count CDR3 AA Seq

CDR3 DNA Seq 22581 CAWGGLAGEGTQYF 18305 CSASGRRYNEQFF 14208 CASSAGQGPYEQYF 12246 CASSSRLGEQYF 9508 CASTLTAAGGGTDTQYF 6217 CASSPLTGGMTEAFF 5813 CSAPTSSTDTQYF 5129 CASSQDLNPTNEKLFF 4446 CSASLDNLKYGYTF 4055 CASRPSSAGGSGNTIYF 3904 CAWNAGGINTEAFF 3171 CASSSPSSGITDTQYF 2912 CASSSYSGKNTGELFF 2741 CASSLDPGTGGYGYTF 2710 CASTWGGNTDTQYF 2503 CSVHRDPNSHEQFF 2341 CASSGGQVSRHEQYF 2006 CSARVPPNTEAFF 1791 RASSLGLADNEQFF 1658 CASSLGTGAFYGYTF 1554 CSATTHSRQGYTEAFF 1512 CSVLRDPNSYEQYF 1430 CASSLSGETQYF 1258 CASSSRTGLLQTQYF 1247 CAWSVTSSPPFNYGYTF 1206 CASSQDRGGSYNEQFF 1168 CASSGGTSGSLGEQFF 1092 CASSSWGTSGNTIYF 846 CAGRPGGYLSTEAFF 759 CASSHRSGTGYEQYF 725 CSARGGSTEAFF 619 CASRGAYEQYF 611 CASSLTQGSQQYF 578 CASSLVGALNTEAFF 555 CASSLTVNYGYTF 511 CASSPLREKGGELFF 438 CASSPSGQGSYEQYF 432 CASSWKKESIEETQYF 397 CASSDRERAPQHF 394 CASSSGQGRPQHF 389 CASSLGVGFTNEQFF 338 CASSPDREWEQYF 333 CACPSGSQGYGYTF 327 CASSPRLGTYEQYF 309 CSVGGPEQPQHF

TGTGCCTGGGGGGGACTAGCGGGAGAGGGGACCCAGTACTTC

TGCAGCGCTAGCGGGAGGCGCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCGCCGGACAGGGCCCCTACGAGCAGTACTTC

TGTGCCAGCAGCTCTCGCCTCGGCGAGCAGTACTTC

TGCGCCAGCACCTTAACGGCCGCGGGAGGAGGCACAGATACGCAGTATTTT

TGTGCCAGCAGCCCCTTGACAGGGGGGATGACTGAAGCTTTCTTT

TGCAGTGCCCCGACTAGCAGCACAGATACGCAGTATTTT

TGCGCCAGCAGCCAAGATCTCAACCCAACTAATGAAAAACTGTTTTTT

TGCAGTGCTAGTTTGGATAATCTAAAATATGGCTACACCTTC

TGTGCCAGCAGACCTTCGTCCGCAGGGGGATCTGGAAACACCATATATTTT

TGTGCCTGGAACGCAGGGGGCATAAACACTGAAGCTTTCTTT

TGCGCCAGCAGCTCTCCGTCTAGCGGGATAACGGATACGCAGTATTTT

TGTGCCAGCAGCTCCTATAGCGGGAAGAACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTAGACCCCGGGACAGGAGGCTATGGCTACACCTTC

TGTGCCAGCACTTGGGGAGGAAACACAGATACGCAGTATTTT

TGCAGCGTACACCGGGACCCGAACTCCCATGAGCAGTTCTTC

TGTGCCAGCAGTGGCGGACAGGTATCGCGCCACGAGCAGTACTTC

TGCAGTGCTAGAGTTCCCCCGAACACTGAAGCTTTCTTT

CGTGCCAGCAGCTTAGGACTAGCGGACAATGAGCAGTTCTTC

TGTGCCAGCAGCCTTGGGACAGGGGCGTTCTATGGCTACACCTTC

TGCAGTGCTACCACCCACAGTAGACAGGGTTACACTGAAGCTTTCTTT

TGCAGCGTACTCCGGGACCCTAATTCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTATCGGGGGAGACCCAGTACTTC

TGTGCCAGCAGCTCCCGGACAGGGCTTTTACAGACCCAGTACTTC

TGTGCCTGGAGTGTAACGTCGTCCCCTCCTTTTAACTATGGCTACACCTTC

TGCGCCAGCAGCCAAGATCGGGGAGGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCGGGGGGACTAGCGGGAGTTTGGGTGAGCAGTTCTTC

TGTGCCAGCAGCTCATGGGGGACCTCTGGAAACACCATATATTTT

TGTGCCGGCAGGCCAGGGGGTTACTTGAGCACTGAAGCTTTCTTT

TGTGCCAGCAGCCACCGGAGCGGGACCGGTTACGAGCAGTACTTC

TGCAGTGCTAGGGGGGGGTCCACTGAAGCTTTCTTT

TGTGCCAGCAGGGGGGCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAACACAGGGGTCACAGCAGTACTTC

TGTGCCAGCAGCTTAGTGGGGGCACTGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTGACAGTTAACTATGGCTACACCTTC

TGTGCCAGCAGCCCTTTACGGGAGAAAGGCGGGGAGCTGTTTTTT

TGTGCCAGCAGCCCATCGGGACAGGGGTCCTACGAGCAGTACTTC

TGTGCCAGCAGTTGGAAGAAAGAGTCAATTGAAGAGACCCAGTACTTC

TGTGCCAGCAGCGACAGGGAAAGGGCGCCCCAGCATTTT

TGTGCCAGCAGCTCGGGACAGGGGAGGCCCCAGCATTTT

TGTGCCAGCAGCTTAGGAGTGGGATTCACAAATGAGCAGTTCTTC

TGTGCCAGCAGTCCAGACAGGGAATGGGAGCAGTACTTC

TGTGCCTGCCCCTCCGGGTCGCAAGGCTATGGCTACACCTTC

TGTGCCAGCAGCCCCCGCCTGGGCACCTACGAGCAGTACTTC

TGCAGCGTTGGAGGTCCTGAACAGCCCCAGCATTTT

Clone count CDR3 AA Seq

CDR3 DNA Seq 28173 CAWNPGVVTDTQYF 27297 CSARRGDTEAFF 17916 CASSLVGALNTEAFF 9190 CASTLYGTGGYGYTF 8937 CSVHRDPNSHEQFF 7799 CASSFTGAMNTEAFF 7085 CASTRTSDTQYF 6352 CASSLDPGTGGYGYTF 4778 CASSYRGPVSETQYF 4232 CASSPSGGTEAFF 3976 CASSSGQGVTGELFF 3044 CSARAPWGGDTQYF 2092 CASTLTAAGGGTDTQYF 1540 CAWSVRYEQYF 1278 CASSSRVGQGSQPQHF 1264 CSATTGGSQVNGYTF 1106 CASSASVAGVYEQYF 897 CASTARGNYGYTF 736 CSVLRDPNSYEQYF 718 CASSLG_AETQYF 614 CSVLKDPNYNEQFF 531 CAWSGSNQPQHF 443 CASSRDRGDQPQHF 261 CASSDWSYTF 204 CACQVAGGLGHDEQFF 201 CASSNLGGPRSEQFF 167 CASSLYRNTGELFF 144 CASGSRGVATNEKLFF 144 CSARDGGTGFSPLHF 132 CSARVGGAWGGYTF 112 CASSPRTGTSGRRMEETQYF 111 CAARGSDTQYF 104 CASSLTAHASNQPQHF 93 CSVGRDPNTGELFF 88 CASSQP_PVQYF 84 CASSALGAGASDTQYF 50 CASRWASTDTQYF 42 CASSQDGRQGGTEAFF 41 CASSSPSGSGYNEQFF 35 CSASSYREQYF 30 CSAPGQGNQPQHF 30 CASSLGLAGDYEQYF 30 CASSLARTG_RKQYNEQFF 29 CASSLVLQEAPYF 28 CSARESLSYEQYF 28 CASIAHQGGGQYF

TGTGCCTGGAATCCTGGTGTAGTTACAGATACGCAGTATTTT

TGCAGTGCTAGAAGGGGCGACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGTGGGGGCACTGAACACTGAAGCTTTCTTT

TGTGCCAGCACTTTATACGGGACAGGGGGCTATGGCTACACCTTC

TGCAGCGTACACCGGGACCCGAACTCCCATGAGCAGTTCTTC

TGTGCCAGCAGCTTTACAGGAGCAATGAACACTGAAGCTTTCTTT

TGTGCCAGCACCAGGACTAGCGATACGCAGTATTTT

TGTGCCAGCAGCTTAGACCCCGGGACAGGAGGCTATGGCTACACCTTC

TGTGCCAGCAGTTACAGGGGGCCGGTTAGCGAGACCCAGTACTTC

TGTGCCAGCAGCCCTAGTGGAGGCACTGAAGCTTTCTTT

TGTGCCAGCAGTTCAGGACAGGGGGTTACCGGGGAGCTGTTTTTT

TGCAGTGCTAGAGCCCCGTGGGGGGGAGATACGCAGTATTTT

TGCGCCAGCACCTTAACGGCCGCGGGAGGAGGCACAGATACGCAGTATTTT

TGTGCCTGGAGTGTACGATACGAGCAGTACTTC

TGTGCCAGCAGCTCCCGGGTGGGACAGGGCAGTCAGCCCCAGCATTTT

TGCAGTGCTACGACAGGGGGCTCGCAGGTTAATGGCTACACCTTC

TGTGCCAGCAGCGCTAGCGTAGCGGGGGTATACGAGCAGTACTTC

TGTGCCAGCACCGCTCGAGGGAACTATGGCTACACCTTC

TGCAGCGTACTCCGGGACCCTAATTCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGGAGGGCAGAGACCCAGTACTTC

TGCAGCGTTTTAAAGGACCCAAACTACAATGAGCAGTTCTTC

TGTGCCTGGAGTGGATCCAATCAGCCCCAGCATTTT

TGTGCCAGCAGTCGGGACAGGGGGGATCAGCCCCAGCATTTT

TGTGCCAGCAGTGACTGGTCCTACACCTTC

TGTGCCTGCCAAGTCGCGGGAGGTTTAGGTCATGATGAGCAGTTCTTC

TGTGCCAGCAGCAATCTCGGGGGCCCCAGAAGCGAGCAGTTCTTC

TGTGCCAGCAGCCTATACAGGAACACCGGGGAGCTGTTTTTT

TGTGCCAGCGGGAGCAGGGGAGTTGCAACTAATGAAAAACTGTTTTTT

TGCAGTGCTAGAGATGGGGGGACAGGGTTTTCACCCCTCCACTTT

TGCAGTGCTAGAGTGGGCGGAGCTTGGGGTGGCTACACCTTC

TGTGCCAGCAGCCCCAGAACCGGGACTAGCGGGAGAAGAATGGAAGAGACCCAGTA

TGTGCCGCGAGGGGGAGTGATACGCAGTATTTT

TGTGCCAGCAGTTTAACGGCCCATGCTAGCAATCAGCCCCAGCATTTT

TGCAGCGTTGGAAGGGACCCGAACACCGGGGAGCTGTTTTTT

TGCGCCAGCAGCCAGCCTTGCCAGTGCAGTACTTC

TGTGCCAGCAGCGCGTTAGGTGCGGGAGCTTCAGATACGCAGTATTTT

TGTGCCAGCAGATGGGCTAGCACAGATACGCAGTATTTT

TGTGCCAGCAGCCAAGATGGTCGGCAGGGGGGCACTGAAGCTTTCTTT

TGTGCCAGCAGTTCCCCTAGCGGGAGTGGATACAATGAGCAGTTCTTC

TGCAGTGCTAGTTCATACCGCGAGCAGTACTTC

TGCAGTGCTCCGGGACAGGGAAATCAGCCCCAGCATTTT

TGTGCCAGCAGCCTAGGACTAGCGGGAGATTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGCTCGCACCGGACTAGGAAACAATACAATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGTTCTCCAAGAGGCCCCTTATTTT

TGCAGTGCTAGAGAGAGCTTATCCTACGAGCAGTACTTC

TGTGCCAGCATTGCCCACCAAGGCGGAGGGCAGTACTTC

Clone count CDR3 AA Seq

CDR3 DNA Seq 16754 CSARGTGGARDYTEAFF 13946 CASSPQGAIEQYF 12405 CASSQRREGIYEQYF 11075 CAWSVQGNYGYTF 9891 CAWRDRTGGRSNQPQHF 9331 CASSSYSGKNTGELFF 6818 CSVHRDPNSHEQFF 5603 CASSPKGGSGANVLTF 5304 CSVLRDPNSYEQYF 4166 CASSGPGTGETQYF 3082 CAWSGGWYEQYF 2902 CSGGQGNYGYTF 2838 CASKSQGGETQYF 2275 CASSSSPNEGYGYTF 2197 CASSQDSREKLFF 1948 CSVGRDPNTGELFF 1892 CASSQERGLPYEQYF 1832 CASSLALSGKGQETQYF 1822 CASSLRDAGYGYTF 1739 CASRFSGANVLTF 1649 CASTRGPEAFF 1539 CASQNQAAKVETQYF 1425 CSAGGDRGFRGGTEAFF 1312 CASSLDSNTGELFF 1248 CAWAAGTALYEQYF 1238 CASSQDLPGTGYYAEQFF 1156 CASSRTSGNGEQYF 1095 CASSFTGAMNTEAFF 1019 CASRGGGANVLTF 995 CASSLGQGGQPQHF 959 CASSPSSGRVNTGELFF 835 CASSSDPSSSDTQYF 769 CASSHTGPGEQYF 749 CASSFLAGTVRGEQYF 730 CASSLGQGLAKNIQYF 576 CASSLSRLAGGSNTGELFF 570 CASSLDPGTGGYGYTF 552 CAWSRQGASKKLFF 547 CASRDAGGGAYNEQFF 531 CASTRDRGRWEQYF 529 CASSQGSGGFYGYTF 487 CASSYSNTGSYEQYF 441 CASSLAGEAFF 402 CASSLFTDTQYF 392 CASSLFQDTGELFF

TGCAGTGCTAGAGGCACCGGTGGCGCCAGGGATTACACTGAAGCTTTCTTT

TGTGCCAGCAGCCCCCAGGGGGCTATCGAGCAGTACTTC

TGTGCCAGCAGCCAAAGGCGGGAGGGGATCTACGAGCAGTACTTC

TGTGCCTGGAGTGTACAGGGGAACTATGGCTACACCTTC

TGTGCCTGGAGGGACCGGACAGGGGGCCGTAGCAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTCCTATAGCGGGAAGAACACCGGGGAGCTGTTTTTT

TGCAGCGTACACCGGGACCCGAACTCCCATGAGCAGTTCTTC

TGTGCCAGCAGCCCAAAAGGGGGTTCCGGGGCCAACGTCCTGACTTTC

TGCAGCGTACTCCGGGACCCTAATTCCTACGAGCAGTACTTC

TGTGCCAGCAGCGGGCCCGGGACCGGGGAGACCCAGTACTTC

TGTGCCTGGAGTGGGGGGTGGTACGAGCAGTACTTC

TGCAGCGGGGGACAGGGGAACTATGGCTACACCTTC

TGTGCCAGCAAATCACAGGGAGGGGAGACCCAGTACTTC

TGTGCCAGCAGCTCATCGCCCAACGAGGGGTATGGCTACACCTTC

TGCGCCAGCAGCCAAGACTCCAGGGAAAAACTGTTTTTT

TGCAGCGTTGGACGGGACCCGAACACCGGGGAGCTGTTTTTT

TGCGCCAGCAGCCAAGAACGGGGGCTGCCCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGCGCTTAGCGGGAAGGGTCAAGAGACCCAGTACTTC

TGTGCCAGCAGCTTAAGGGACGCCGGGTATGGCTACACCTTC

TGTGCCAGCAGATTCTCTGGGGCCAACGTCCTGACTTTC

TGTGCCAGCACCCGAGGCCCTGAAGCTTTCTTT

TGTGCCAGCCAAAATCAGGCGGCGAAGGTTGAGACCCAGTACTTC

TGCAGTGCTGGGGGGGACAGGGGGTTTAGAGGTGGCACTGAAGCTTTCTTT

TGTGCCAGCAGCCTAGACTCAAACACCGGGGAGCTGTTTTTT

TGTGCCTGGGCGGCGGGGACAGCTTTGTACGAGCAGTACTTC

TGCGCCAGCAGCCAAGATCTTCCCGGGACAGGGTATTACGCTGAGCAGTTCTTC

TGTGCCAGCAGTCGGACTAGCGGGAACGGCGAGCAGTACTTC

TGTGCCAGCAGCTTTACAGGAGCAATGAACACTGAAGCTTTCTTT

TGTGCCAGCAGGGGAGGTGGGGCCAACGTCCTGACTTTC

TGTGCCAGCAGCTTAGGACAGGGAGGTCAGCCCCAGCATTTT

TGTGCCAGCAGCCCAAGTAGCGGGAGAGTGAACACCGGGGAGCTGTTTTTT

TGCGCCAGCAGTTCGGACCCTTCCTCCTCAGATACGCAGTATTTT

TGTGCCAGCAGCCACACGGGTCCGGGGGAGCAGTACTTC

TGTGCCAGCAGCTTCCTAGCGGGTACCGTTAGGGGCGAGCAGTACTTC

TGTGCCAGCAGCTTAGGACAGGGACTAGCCAAAAACATTCAGTACTTC

TGTGCCAGCAGCCTCTCGAGGCTAGCGGGAGGGAGTAACACCGGGGAGCTGTTTTT

TGTGCCAGCAGCTTAGACCCCGGGACAGGAGGCTATGGCTACACCTTC

TGTGCCTGGAGTCGGCAGGGGGCGAGTAAGAAACTGTTTTTT

TGTGCCAGCAGGGATGCGGGGGGTGGGGCTTACAATGAGCAGTTCTTC

TGTGCCAGCACCCGGGACAGGGGGCGGTGGGAGCAGTACTTC

TGCGCCAGCAGCCAAGGGAGCGGTGGATTTTATGGCTACACCTTC

TGTGCCAGCAGCTACTCCAATACAGGGAGCTACGAGCAGTACTTC

TGTGCCAGCAGCTTAGCAGGTGAAGCTTTCTTT

TGTGCCAGCAGCTTATTCACAGATACGCAGTATTTT

TGTGCCAGCAGCTTATTTCAGGACACCGGGGAGCTGTTTTTT

Clone count

CDR3 AA Seq

CDR3 DNA Seq

TGTGCCAGCAGCTTGATGTGGGAGCAGTACTTC

TGTGCCTGGAGTGGAACAGGGAGGAGTGAGCAGTTCTTC

TGTGCCAGCAGCTTGACTAGCGGGGGCTCCTACGAGCAGTACTTC

TGTGCCAGCAGTTGGACAGGGGGCGTTTACGAGCAGTACTTC

TGTGCCAGCAGCTGGGGACAGGGGCCCTATGGCTACACCTTC

TGTGCCAGCCTAAACAGGGGGCGCGGCACTGAAGCTTTCTTT

TGCAGCGTACTCCGGGACCCTAATTCCTACGAGCAGTACTTC

TGCGCCAGCAGCCAAGGCAGGAACACCGGGGAGCTGTTTTTT

TGTGCCAGCAGCTTTTCATCATCATACTCTGGAAACACCATATATTTT

TGCGCCAGCAGCCAAGAGGGCGGCGAGCGCTTCAATGAGCAGTTCTTC

TGCGCCAGCAGCTTGGCCGGGACAGGGAACACTGAAGCTTTCTTT

TGTGCCTGGAAACTAGCGGGAGTCGAGCAGTACTTC

TGCAGCGTACACCGGGACCCGAACTCCCATGAGCAGTTCTTC

TGTGCCAGCAGCTTAGGACCTTACACCGGGGAGCTGTTTTTT

TGTGCCTGGAGTTCAGGGACAGGGCTTCGCGGCTACACCTTC

TGTGCCAGCAGCTTTTACACAGATACGCAGTATTTT

TGTGCCTGGAACCTCAGGTTGGCAGAGACCCAGTACTTC

TGTGCCAGCAGCTTTACAGGAGCAATGAACACTGAAGCTTTCTTT

TGTGCCAGCAGCTTAGAGGGGTCTAGCGGGAGGCAGACCCAGTACTTC

TGCAGTGCTAGAAGGGGCGACACTGAAGCTTTCTTT

TGTGCCAGCAGCCGGGCATATCGGGGGTATGGCTACACCTTC

TGTGCCAGCAGCGAGAGACAGGGTCTCTTCAGTGGCTACACCTTC

TGTGCCAGCCAAAATCAGGCGGCGAAGGTTGAGACCCAGTACTTC

TGTGCCTGGAGCCCAGGGGGGGCTATCAGTCAGCCCCAGCATTTT

TGCGCCAGCAGCCAAGAACGTGGGACTAGTGGCTCTTGGCAGTTCTTC

TGTGCCAGCACCCCCCAAGGGACGGGAGAAAAAGCTTTCTTT

TGTGCCAGCAGCTTGGACTACCAAGAGACCCAGTACTTC

TGTGCCTGGAGCCCTCCAGGGCCAGATACGCAGTATTTT

TGTGCCAGCAGCAGACAGGGGGCCGTTCACGAGCAGTACTTC

TGTGCCTGGAGTGTTCGGCGCACAGATACGCAGTATTTT

TGTGCCAGCAGCTCACAGGGGGCGATGGAGACCCAGTACTTC

TGCGCCAGCAGCTTGGAGACAGGGCAATGGGGTTCACCCCTCCACTTT

TGTGCCAGCAGCTCCTCTGGAAACACCATATATTTT

TGCGCCAGCCGAAGACAGAATATGAACACTGAAGCTTTCTTT

TGCAGTGCTAGTGGACAGGCCGGCGAGCAGTACTTC

TGTGCCAGCAGCTTGAATTCGCGGGAGAGGGAAGAGACCCAGTACTTC

TGTGCCAGCAGCGATACAGGGGCCTATAATTCACCCCTCCACTTT

TGTGCCAGCAGCCTGACTAGCGGGTCCTACAATGAGCAGTTCTTC

TGCAGTCTAGCGGGAGAGGTGTGGGAGACCCAGTACTTC

TGTGCCACCAGCAGAGAAGGACAGGTGTATGGCTACACCTTC

TGCAGTGCTAGAAAGGAGGCGTTTAGCTCCTACAATGAGCAGTTCTTC

TGTGCCAGCAGCAATGGACTAGCCAGCACGAATGAGCAGTTCTTC

TGTGCCAGCGCTCCCCCCCGAGCTTCGGCTAATCAGCCCCAGCATTTT

TGCAGCGTTGCTGGACAGGGGGTGGGCTACACCTTC

TGCGCCAGCAGACCAGGGACTATGAACACTGAAGCTTTCTTT

TGCGCCAGCAGCCAAGCCCTAACCGGTGAGCAGTTCTTC

TGCGCCAGCAGCCGCTTCCCGGGACTAGCGGGAGAGCCTAAGTCTAGCACAGATACGCAGTA

TGTGCCAGCAGGCGACAGGACAATCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAAAGGGGCGACTAGCGGGAGGGCGGGAGCAGTTCTTC

27446 CASSLMWEQYF 22505 CAWSGTGRSEQFF 9382 CASSLTSGGSYEQYF 8999 CASSWTGGVYEQYF 8588 CASSWGQGPYGYTF 8536 CASLNRGRGTEAFF 8032 CSVLRDPNSYEQYF 7069 CASSQGRNTGELFF 6826 CASSFSSSYSGNTIYF 4006 CASSQEGGERFNEQFF 3059 CASSLAGTGNTEAFF 3050 CAWKLAGVEQYF 2305 CSVHRDPNSHEQFF 2144 CASSLGPYTGELFF 1942 CAWSSGTGLRGYTF 1884 CASSFYTDTQYF 1830 CAWNLRLAETQYF 1758 CASSFTGAMNTEAFF 1656 CASSLEGSSGRQTQYF 1606 CSARRGDTEAFF 1432 CASSRAYRGYGYTF 1257 CASSERQGLFSGYTF 1121 CASQNQAAKVETQYF 1120 CAWSPGGAISQPQHF 1091 CASSQERGTSGSWQFF 985 CASTPQGTGEKAFF 952 CASSLDYQETQYF 940 CAWSPPGPDTQYF 940 CASSRQGAVHEQYF 925 CAWSVRRTDTQYF 883 CASSSQGAMETQYF 838 CASSLETGQWGSPLHF 764 CASSSSGNTIYF 737 CASRRQNMNTEAFF 712 CSASGQAGEQYF 710 CASSLNSREREETQYF 668 CASSDTGAYNSPLHF 639 CASSLTSGSYNEQFF 606 CSLAGEVWETQYF 587 CATSREGQVYGYTF 572 CSARKEAFSSYNEQFF 559 CASSNGLASTNEQFF 526 CASAPPRASANQPQHF 505 CSVAGQGVGYTF 473 CASRPGTMNTEAFF 425 CASSQALTGEQFF 424 CASSRFPGLAGEPKSSTDTQYF 421 CASRRQDNQPQHF 350 CASSLKGRLAGGREQFF

Clone count CDR3 AA Seq

CDR3 DNA Seq 1690 CAWSVGSNSNQPQHF 1396 CAWSVREASQPSF 1157 CAWSLPDTEAFF 896 CAWSVRSQDTQYF 867 CAWSVRGRGWTEAFF 820 CASSH_HEAFF 806 CAWSKTGGSEQFF 728 CAWTQARRQRETQYF 707 CASSLAKSGRVNEQYF 659 CASSHGGDQPQHF 650 CAWSVQQGMEYF 618 CASSFKGFF 614 CASTSGTGIGNTGELFF 608 CAWSGGSLGGNQPQHF 600 CAWGRGSYGYTF 597 CAWSTSGHANTGELFF 592 RASSPRRASGASSYNEQFF 590 CAWSVGGYTSGNTIYF 578 CAWSVSGLGSTETQYF 576 CAWSVREADTQYF 559 CAWRGAVQETQYF 551 CAWSVGRAWETQYF 548 CASSLGVGTGFSQPQHF 543 CASSLGGF_GITEAFF 528 CASTPGLAGGTGELFF 510 CAWSTGAVEQYF 507 CAWKPPPQRYYEQYF 506 CAWSVRDRVGYGYTF 500 CAWSVRQRGLPYEQYF 500 CAWSVRATGRAYGYTF 496 CASAPP_RQPQHF 491 CAWRAAGAHYEQYF 489 RASSLTWASTDTQYF 485 CAWRREAEAFF 476 CACPVGDLAGVNTEAFF 466 CAWSDPLAGGHEYF 465 CATSRLGTAVYGYTF 451 CAWWQGESYEQYF 443 CAWSGPGTNVLTF 441 CAWSPGTSPLHF 435 CACSSRYEQYF 434 CASSYSNTGSYEQYF 431 CAWTTGQASYEQYF 427 CAWSVLGTQYF 409 CAWSVLQGFANTGELFF 400 CAWSQRRATEAFF 384 CAWGLGDRPSYEQYF 380 CAWTPGALIEAFF 378 CACLRDRAPNYGYTF 365 CAWRPGQDPTYEQYF

TGTGCCTGGAGTGTTGGGTCAAACAGCAATCAGCCCCAGCATTTT

TGTGCCTGGAGTGTACGGGAGGCGTCCCAACCCAGTTTT

TGTGCCTGGAGTCTGCCGGACACTGAAGCTTTCTTT

TGTGCCTGGAGTGTCAGAAGCCAAGATACGCAGTATTTT

TGTGCCTGGAGTGTGAGGGGCAGGGGATGGACTGAAGCTTTCTTT

TGTGCCAGCAGCCATGACACGAAGCTTTCTTT

TGTGCCTGGAGCAAAACAGGGGGCAGTGAGCAGTTCTTC

TGTGCCTGGACCCAGGCTAGGAGGCAGCGGGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGCGAAGAGCGGGAGGGTTAACGAGCAGTACTTC

TGTGCCTCCTCCCACGGCGGAGATCAGCCCCAGCATTTT

TGTGCCTGGAGTGTACAACAGGGGATGGAGTACTTC

TGTGCCAGCAGTTTCAAGGGGTTTTTT

TGTGCCTCGACTTCCGGGACAGGGATTGGAAACACCGGGGAGCTGTTTTTT

TGTGCCTGGAGCGGGGGCAGCCTCGGAGGGAATCAGCCCCAGCATTTT

TGTGCCTGGGGCAGGGGCAGCTATGGCTACACCTTC

TGTGCCTGGAGTACTAGCGGGCACGCGAACACCGGGGAGCTGTTTTTT

CGTGCCAGCAGCCCCCGCCGGGCTAGCGGGGCCAGCTCCTACAATGAGCAGTTCTTC

TGTGCCTGGAGTGTGGGAGGCTACACCTCTGGAAACACCATATATTTT

TGTGCCTGGAGTGTATCGGGTTTGGGGTCTACGGAGACCCAGTACTTC

TGTGCCTGGAGTGTCCGGGAGGCAGATACGCAGTATTTT

TGTGCCTGGAGGGGGGCGGTACAAGAGACCCAGTACTTC

TGTGCCTGGAGTGTGGGGAGGGCGTGGGAGACCCAGTACTTC

TGTGCCAGCAGCTTAGGGGTCGGGACAGGGTTCAGTCAGCCCCAGCATTTT

TGTGCCAGCAGCTTAGGCGGCTTCCGGGATCACTGAAGCTTTCTTT

TGTGCCAGCACCCCGGGACTAGCGGGAGGAACCGGGGAGCTGTTTTTT

TGTGCCTGGTCAACGGGAGCGGTCGAGCAGTACTTC

TGTGCCTGGAAACCACCGCCCCAGCGGTACTACGAGCAGTACTTC

TGTGCCTGGAGTGTACGGGACAGGGTAGGCTATGGCTACACCTTC

TGTGCCTGGAGTGTACGTCAGCGGGGACTCCCCTACGAGCAGTACTTC

TGTGCCTGGAGTGTACGGGCAACAGGGAGGGCCTATGGCTACACCTTC

TGTGCCAGCGCGCCCCCCTCGTCAGCCCCAGCATTTT

TGTGCCTGGAGAGCGGCAGGGGCTCACTACGAGCAGTACTTC

CGTGCCAGCAGCTTAACCTGGGCGAGCACAGATACGCAGTATTTT

TGTGCCTGGCGCAGGGAGGCTGAAGCTTTCTTT

TGTGCCTGCCCGGTGGGGGACCTAGCTGGGGTGAACACTGAAGCTTTCTTT

TGTGCCTGGAGTGATCCCCTAGCGGGAGGCCACGAGTACTTC

TGTGCCACCAGCAGATTAGGGACGGCAGTATATGGCTACACCTTC

TGTGCCTGGTGGCAGGGTGAATCCTACGAGCAGTACTTC

TGTGCCTGGAGTGGTCCAGGGACCAACGTCCTGACTTTC

TGTGCCTGGAGCCCCGGGACCTCACCCCTCCACTTT

TGTGCCTGCTCAAGTCGCTACGAGCAGTACTTC

TGTGCCAGCAGCTACTCCAATACAGGGAGCTACGAGCAGTACTTC

TGTGCCTGGACCACGGGACAGGCCTCCTACGAGCAGTACTTC

TGTGCCTGGAGTGTCTTGGGGACCCAGTACTTC

TGTGCCTGGAGTGTTTTACAGGGATTCGCGAACACCGGGGAGCTGTTTTTT

TGTGCCTGGAGTCAGAGAAGGGCCACTGAAGCTTTCTTT

TGTGCCTGGGGCCTCGGGGACAGACCCTCCTACGAGCAGTACTTC

TGTGCCTGGACACCAGGAGCGCTTATTGAAGCTTTCTTT

TGTGCCTGTCTTCGGGACAGGGCACCCAACTATGGCTACACCTTC

TGTGCCTGGAGGCCCGGACAGGACCCTACCTACGAGCAGTACTTC

Clone count CDR3 AA Seq

CDR3 DNA Seq

TGTGCCAGCAGCTTTCGGACTAGCGGCGAGCAGTACTTC 2677 CASSFRTSGEQYF

TGTGCCAGCAGCCCCCCCCGCGGGGTCCGGGAGCTGTTTTTT 1392 CASSPPRGVRELFF

TGTGCCTGGAGTGTTTGGGGGACCCGGAACACTGAAGCTTTCTTT 979 CAWSVWGTRNTEAFF

TGTGCCTGGCAGAAACAGGACAACTATGGCTACACCTTC 885 CAWQKQDNYGYTF

TGTGCCAGCAGCCAAGAGCCAGGGCACAATCAGCCCCAGCATTTT 840 CASSQEPGHNQPQHF

TGTGCCTGGAGTGTGGACAGTGGCAATCAGCCCCAGCATTTT 769 CAWSVDSGNQPQHF

TGTGCCTGGAGTGTACTGGCTGCAGGCCAAGAGACCCAGTACTTC 706 CAWSVLAAGQETQYF

TGTGCCAGCAACAAAGCGGCAAACCAAGAGACCCAGTACTTC 694 CASNKAANQETQYF

TGTGCCTGGAGTGTACGTGACAGGGAGGTCATTGAAGCTTTCTTT 647 CAWSVRDREVIEAFF

TGTGCCTGGAGCAAAACAGGGGGCAGTGAGCAGTTCTTC 635 CAWSKTGGSEQFF

TGCGCCAGCAGCCAGTTAGGGCAGTACACCGGGGAGCTGTTTTTT 558 CASSQLGQYTGELFF

TGTGCCAGCAGCTTAGGAACAGAACCATCCTACGAGCAGTACTTC 478 CASSLGTEPSYEQYF

TGTGCCTGGAGTACCCGGACCTACCAGGGAGAATTC 442 CAWSTRTYQGEF

TGTGCCAGCAGCTTAGCGAGCCTAGCGGGAGAGCAGTACTTC 440 CASSLASLAGEQYF

TGTGCCAGCAGCCCCGGGACAGTCACAGATACGCAGTATTTT 412 CASSPGTVTDTQYF

TGTGCCTGGAGCGTCGGGCCCGGCCTGAACACTGAAGCTTTCTTT 408 CAWSVGPGLNTEAFF

TGTGCCTGGACAAGACTCGGAAACACCATATATTTT 406 CAWTRLGNTIYF

TGTGCCTGGAGACCTAGGACCAGCGGGGAGCTGTTTTTT 404 CAWRPRTSGELFF

TGTGCCTGGGCGACAGGGGAAAATCAGCCCCAGCATTTT 403 CAWATGENQPQHF

TGTGCCTGGAGTGTCCGCGGAGAGACCCAGTACTTC 391 CAWSVRGETQYF

TGTGCCAGCAGCTCAGGGGCTAGCCCTCAAGAGACCCAGTACTTC 372 CASSSGASPQETQYF

TGTGCCTGGAGTGTCGTTCTAGCGGGATTAGAGACCCAGTACTTC 355 CAWSVVLAGLETQYF

TGTGCCAGCAGTCCCTTACTGAACACTGAAGCTTTCTTT 343 CASSPLLNTEAFF

TGTGCCAGCAGCTCCTCGAATGAAAAACTGTTTTTT 331 CASSSSNEKLFF

TGCGCCAGCAGCCAAATTGGGGAGACCCAGTACTTC 325 CASSQIGETQYF

TGTGCCAGCAGCCGGCCAGCAACGAACACTGAAGCTTTCTTT 311 CASSRPATNTEAFF

TGTGCCTGCCGTGGCGGACAGGGGAACTATGGCTACACCTTC 307 CACRGGQGNYGYTF

TGTGCCTGGATAGCGGCGGGGAGAGAGACCCAGTACTTC 306 CAWIAAGRETQYF

TGTGCCTGGAGTGGGGTTTCCAACACTGAAGCTTTCTTT 300 CAWSGVSNTEAFF

TGTGCCAGCAGCCCTCGTCCCCGTGAGCAGTTCTTC 299 CASSPRPREQFF

TGTGCCAGCAGCGAGGGGACAGGGAACTATGGCTACACCTTC 299 CASSEGTGNYGYTF

TGTGCCTGGAGGGTAGCGGGAGGCCTTCTAGAGCAGTACTTC 295 CAWRVAGGLLEQYF

TGTGCCAGCAGCCCCCCGGACAGCGGCTTACCCAATCAGCCCCAGCATTTT 288 CASSPPDSGLPNQPQHF

TGTGCCTGGAGTGTCCTACAAGAGACCCAGTACTTC 288 CAWSVLQETQYF

TGTGCCAGCAGCTTAAACAGGGGCTCCTACGAGCAGTACTTC 282 CASSLNRGSYEQYF

TGTGCCTGGAGTAGCGGGCTAGCGGGCGGGGAGCTGTTTTTT 275 CAWSSGLAGGELFF

TGCAGCGTTGAAAGGGGGTCCAATGAGCAGTTCTTC 267 CSVERGSNEQFF

TGTGCCTGGCGTGGGGACAGATACTACGAGCAGTACTTC 267 CAWRGDRYYEQYF

TGTGCCTGGAGTGTAGGCGGGGGAGGAGATACGCAGTATTTT 262 CAWSVGGGGDTQYF

TGTGCCAGCAGCTCCCGACTAGCCTCCGAGCAGTACTTC 257 CASSSRLASEQYF

TGTGCCAGCGGGACTAGCGGAGGCACAGATACGCAGTATTTT 255 CASGTSGGTDTQYF

TGTGCCTGGAGACCTACCGGTGCGCGAGATACGCAGTATTTT 254 CAWRPTGARDTQYF

TGTGCCTGGATGGTGTCCTATGGCTACACCTTC 254 CAWMVSYGYTF

TGTGCCAGCAGCCAAGCGGAAAGCAATCAGCCCCAGCATTTT 254 CASSQAESNQPQHF

TGTGCCAGCAGCGCCCGACTAGCGGAAGAGACCCAGTACTTC 248 CASSARLAEETQYF

TGTGCCTGGAGAGACTACCGGGACAGGGGGAACACCTTC 247 CAWRDYRDRGNTF

TGTGCCAGCAGCTTCGGGGTGTGGAATTCACCCCTCCACTTT 242 CASSFGVWNSPLHF

TGTGCCAGCAGCTTGGGGCTAGCGGAAGATACGCAGTATTTT 241 CASSLGLAEDTQYF

240 CAfCIAGGITVEAVr

Supplementary Table 5. Clinical characteristics of Oxford cohort patients assessed in this study for gene expression analysis.

Characteristic Control UC CD

(«=13) («=31) («=27)

Male/female 3/9 13/17 11/16

Median (IQR) age at sampling (years) 58 48 37

(41-65) (35-62) (24-61)

Median (IQR) age at diagnosis (years) n/a 31 25

(24-39) (18-46)

Median (IQR) disease duration (years) n/a 9 9

(3-23) (6-13)

Median (IQR) C-reactive protein (mg/l) n/a 6.0 11.1

(1.1-14.9) (3.8-46.3)

Median (IQR) peripheral blood leukocytes 8.8 8.3 8.0

(10A9/l) (8.3-9.0) (7.0-9.7) (6.5-10.7)

Current medication at sampling

5-Aminosalicylates 21 1

Corticosteroids 8 1

Azathioprine/6-mercaptopurine 7 10

Infliximab/adalimumab 1 9

Unknown 4 7

Demographic and clinical characteristics of IBD patients analysed in Figure 5E and 7D

Supplementary Table 6. Clinical characteristics of Oxford cohort patients assessed in this study for the analysis of microbiota-specific CD4 T cells.

Characteristic All patients UC CD

(«=44) (n=20) (n=24)

Male/female 24/20 10/10 14/10

Median (IQR) age at sampling (years) 41 42 ( 38.5

(31.5-54.75) 34-55.75) (31-52)

Median (IQR) age at diagnosis (years) 31 39 26.5

(21-47) (25-55) (19.5-37.75)

Median (IQR) disease duration (years) 7 4 12

(2-15) (1-12) (6-15.75)

Median (IQR) C-reactive protein (mg/l) 2.1 1.3 2.6

(0.9-4.425) (0.85-3.56) (0.92-4.65)

Median (IQR) peripheral blood 7.065 7.1 6.9

leukocytes (10A9/l) (5.4-8.11) (5.35-9.11) (5.33-8)

Current medication at sampling

5-Aminosalicylates 10 2

Corticosteroids 4 2

Azathioprine/6-mercaptopurine 3 12

Infliximab/adalimumab 2 10

Unknown 3 1

Demographic and clinical characteristics of IBD patients analysed in Figure 7A, B and Supplementary 6A-H

Supplementary Table 7. Clinical characteristics of Oxford cohort patients assessed in this study for cell accumulation in the mucosa.

Characteristic Control UC CD

(«=13) (n=8) (n=9)

Male/female 6/7 6/2 4/5

Median (IQR) age at sampling (years) 32.5 29.5 24

(25-45.5) (25.75-39.5) (18.5-29.5)

Median (IQR) age at diagnosis (years) 25 25 23.5

(22-46) (17.5-28.5) (19.5-33.75)

Median (IQR) disease duration (years) n/a 4 1

(1-10.5) (0-6)

Median (IQR) C-reactive protein (mg/l) 1.75 0.9 20.7

(0.15-8.3) (0.4-6.3) (6.3-43.2)

Median (IQR) peripheral blood 7.02 6.73 6.12

leukocytes (10A9/l) (5.8-8.3) (6.018-8.54) (5.35-11.68)

Current medication at sampling

5-Aminosalicylates 4 2

Corticosteroids 1 0

Azathioprine/6-mercaptopurine 1 4

Infliximab/adalimumab 0 1

Unknown or no treatment 2 4

Demographic and clinical characteristics of IBD patients analysed in Figure 3B, C and

Figure 7C

Firmicutes

Clostridiaceae

• Clostridium difficile

Lactobacillaceae

• Lactobacillus acidophilus

Lachnospiraceae

• Roseburia intestinalis

• Ruminococcus obeum

Ruminococcaceae

• Faecalibacterium prausnitzii

Staphylococcaceae

• Staphylococcus aureus

Proteobacteria

Enterobacteriaceae

• Escherichia coli

• Salmonella typhimurium

Actinobacteria

Bifidobacteriaceae

• Bifidobacterium animalis Mycobacteriaceae

• Mycobacterium tuberculosis

Bacteroidetes

Bacteroidaceae

• Bacteroides vulgatus

Saccharomycetaceae

• Candida albicans

# Obligate aerobe

O Facultative anaerobe

# Obligate anaerobe

gated on live, CD3+

E. coll

L. acidophilus B. vulgatus

S. aureus

no microbe

g 0.0001

0.00001

**** *

□ CD154+ ■ CD154-

CD4+ T cells

0 102 10-

2 in3 in4 in5

E S. typhimurium B. animalis L. acidophilus

el 104 c

> ä 'S ° 10 ra <u

S O 102,

**** *

S. typhimurium C. difficile

0.03t _i"

I Adult blood Cord blood

B. vulgatus R. intestinalis R. obeum

0.0151 * 0.008T * 0.008n _:

- .A».. 0.001: °

E. coli S. typhimurium B. anin

(3.84x) (6.6x)

% : CO .

<&i> 0.1- ags

ANUSCRIPT

OrfJ 0.01 o ;

0.001; 0.0001

0.1 0.01: 0.001 0.0001

0.1-1 0.010.001; 0.0001

F. prausnitzii C. difficile

(3.5x)

°oo° 0 0.001-

^ <f>. o

--0.0001

(6.2x)

B. vulgatus

U (32x)

0.1; 0.01; 0.001; 0.0001

R. intestinalis

. (5.8x)

• «a*

°oo<? O

R. obeum

S. aureus

- 0.0001

C. albicans M. tuberculosis

I (4.3x) 1-s (Jfxi 1-1 (6.2x) 1-1 (32.5x) 100.

0.1 0.1 OonO 0.1 °oo° 0.1 ■ä 10

0.01 °o° H °o° o 0.01 0.01 °o o0 0.01 o°o 1 0.1

0.001 0.001 ccp O 0.001 <% o o o O__0 oo 0.001 °o 0 0.01

0.0001 0.0001 0.0001 0.0001 0.001^

(0.6x)

~.CD154+ of CD154+ of

^ naive T cells (CD45RA+) ^

memory T cells (CD45RA-)

1009080-~ 70-& 60-o 50-§ 405 3020-10-| 0

fo^i 5§> o oa

# o- <$>

Memory CD4 T cells

(live CD3+ CD4+ CD154+ CD45RA-)

# ir °<2>v * o-

CD4* CD154+ CD45RA- T cells

CD4*CD154-CD45RA- T cells b. animalis stimulation

95.1 55 1.3 1.1

0.6 0.1

J2 103 104 105

Integrin ß7

76.6 44.4

9.6 1.6

25.1 1.6

96.1 545 0.4 2.6

■'Ii 39.6 3.4 3.2 0.06

83.7 56.6^ 10 7.6

31.6&V' 3.5. . f- 4.1 2.8

37.4 t 50.6

2 89 •J 9.12

0 102 103 104 105

0.1 0.9

11.6 ¡ÉËÈÉ; 87.3

82.3 1.13

14.5 2.05

103 104 10'

14lS"'' I v ■>■:

32.2 61.6 m -¿if!

5.79 0.39

87.1 3.09

9 6V * I 0 16 n

32.6 60.7 sa

5 09 ' i.6i

12.1 0.16

0 "0s "04 "04

3.5 24.4

■ffc '/1

34.5^^ BP 37.6

LPMCs CD4+ T cells

PBMCs CD4+ T cells

CD45RA

8.44 4.38

70.9 16.2

IL-17A

CD154+ TNF-a+

CD154+ TNF-a-

CD154+ . TNF-a+

CD154+ TNF-a-

E. coli

E. coli

m 0.10

S. typhimurium

C. difficile

gated on Live, lymphocyte, singlets, CD3*, CD4*

1600-, 1400120010008006004002000

■ Control mucosa □ Peripheral blood

605040-

■ Control mucosa □ Peripheral blood

IL-17A

ns 9°" 80706050-

30-i 5"T!

IL-17A

60-| 50403020100

ns ns ns ns ns « ns

if] .fl ■ ,(] il ^ all I

20 15 10 5

■ Control mucosa □ Peripheral blood

ns ns ns ns

<9- v v Çy™

50 40 30 20 10 0 80t

"1 I I I I I

ns * ** ** ** **

"1—I—I—I—I—I—I

** *** ns ns ns ns ns

E. coli

E. coli Nissle

0 102 103 104 105

30.2 7.7 i

Hi H 11.5 ''•'■ 1 50.6

0.28 0.4

41.4 li ■-,9

I I I r ** ** ** **

378 _ 2.4

8.2 : t 85.7

CFSE B. animalis

0 102 103 104 105

0 102 103 104 105

1 I I I I I I

E S 60- 1.6 2.5 .^3.6 40.1 0.5 2.4

F C B. animalis .4 A. 103, :) v P" .4

40- < J If ...

! i 1. • < H'll

* Z !

4.2 91.7 U- ; 2.2 54.1 _J 5.3 91.7

/ /A/o.///o^

* ^ / # * v/

IL-17A

100 90 80 70 60 50 40 30 20 10 0

50 40 30 20 10 0

1 I T ns ns «

"1—I

100 90807060-50^ o 40 30 20 10 0

"1 I T i ns !

n 0 u O

25 20 15 10 5 0

"1—I—I-1—I

*ns ns ns ns

0 102 103 10* 105

0 102 103 10* 105

0 102 103 10* 105

no microbe

S. aureus

FMO control

10^ 0.07 2.95 1 •-48.2 .14 1 5-0.25 0.6 FMO PE _ 0 0.02

102- 0.09 l1 96.9 -40.2 1 -28.1 i 71 1 # 86.7 13 3

0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105

105-0.07 1.32 1 5-32.5 A 0.19 ^ 18.3 3; # 2 §~ 69 7 fmopb _ 0.02 0

■0.08 I1 98.5 0 w •55.9 » •9.91 86.5 | 13 5

0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105

,05-0 0.3 1 5-0.1 0.03 1 0.4 FMO APC _ 0 0

!0.2 I1 99.4 ;88.4 1 11.5 ;28.6 1 . t 1 13 1

S. typhimurium L. acidophilus F. prausnitzii C. difficile

* Jk Q ^

S. aureus

RORyt + + + +---T-bet + + --++-GATA-3 + - + - + - +

F. prausnitzii

30.1 7.34

mi 56.7 5.87

21.7 8 6.99

W: 65.1 6.2

IL-10+

g' 6-o

IL-10-

IL-17A-

103 10* 105

<=>• v

typhimurium

C. difficile

- 0.00- _1—

typhimurium C. difficile

0.08-]

S. typhimurium

■ Control (n=30) □ IBD (n=38)

I Control mucosa (n=17-20) | Inflamed mucosa (n=10-15)

158 14-ra 13--^12-

Eö11"

ra -fa 10-l

O o 5-(n 4

E. coli

□ëps

Control mucosa

Inflamed mucosa

Control (n=23) IBD (n=33)

S. aureus

IL-17A

M. tuberculosis

IL-17A

Control (n=23) IBD (n=33)

■ Control m Control

■ Ulcerative colitis ■ Active IBD

■ Crohn's disease ■ IBD remission

■ Control

en Aminosalicylates _ Purine synthesis inhibitors

■ Biologics

IL-17A

B. animalis

100 IL-2

L. acidophilus

F. prausnitzii

C. difficile

70 IL-17A

i- °° 60- - „ ° r^h 50- °o

' ° PHriî

I Control (n=9-17) I IBD (n=15-22)

E. coli

B. animalis

S. typhimurium1L. acidophilus

■ Control

■ IBD (n= IL-17A

£ ^ 1.0-<u

2 0.5-

I Control (n=9) I IBD (n=11)

0.0-IL-1 ß -IL-6 -IL-23 -

+ + ++ ++

<D (0 (0

¡0 0 E

J ° f=

.S i- a e— J

■ > + ■ > ^r

BaBa c