Mitochondrial d-loop variation, coat colour and sex identification of Late Iron Age horses in Switzerland Academic research paper on "History and archaeology"

ELSEVIER

Contents lists available at ScienceDirect

Journal of Archaeological Science: Reports

journal homepage: www.elsevier.com/locate/jasrep

Mitochondrial d-loop variation, coat colour and sex identification of Late Jjj CrossMark Iron Age horses in Switzerland

Julia Elsner a,*< Sabine Deschler-Erb a, Barbara Stopp a, Michael Hofreiter b,Jörg Schibler a, Angela Schlumbaum a

a Integrative Prehistory and Archaeological Science, Department of Environmental Sciences, Basel University, Spalenring 145,4055 Basel, Switzerland b Institute for Biochemistry and Biology, University of Potsdam, Karl-Liebknecht-Str. 24-25, D-14476 Potsdam, Germany

ARTICLE INFO

ABSTRACT

Article history:

Received 26 November 2015 Accepted 7 March 2016 Available online 14 March 2016

Keywords: Genetic diversity Ancient DNA Iron Age Horse Coat colour Withers height Greying

Sex identification

In the Celtic world, horses enjoyed a prominent position as status symbols and objects of veneration, yet little is known about these Celtic horses except that they were rather small. The Late Iron Age was a time defined by increasing inter-cultural contact between Celtic peoples and the Romans. This is, amongst other features, observable in the phenotypes of domestic livestock such as horses. Amongst the usually small animals, larger ones are rarely but regularly encountered in the archaeological record. We have investigated mitochondrial (mt) DNA d-loop diversity, sex and coat colour using bones from 34 horses of different size from three Swiss sites (Mormont, Basel-Gasfabrik, Aventicum) most of them dating from 150 to 50 BCE. The aim was to characterise the diversity of matrilineages and coat colourations of Iron Age horses, and to identify molecular sex. We detected eleven mthaplotypes clustering into six haplogroups (B, D, F, I, X2,X3) in the ancient dataset (n = 19). Large individuals were all male, but smaller stallions were also identified; molecular sexing confirmed and augmented to morphological results. The horses were bay, chestnut and black in colour, and spottings or dilutions were absent in all animals. With a simplified primer system to detect premature greying, white coats can be excluded as well. The limited colour range proposes selection for monochrome animals. Additionally, ancient matrilineages were compared to modern horses from regions appertaining to the Late Roman Republic and to European pony breeds. Based on Principal Component Analysis (haplotype frequencies) and FST-values (genetic distances) the mtDNA variation of the Iron Age horses investigated here has survived in modern European breeds, particularly in northern European ponies.

© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license

(http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction

Several Late Iron Age sites have been identified in Switzerland, including the eponymous sacrificial site in La Tene, canton Neuchatel. In recent years comprehensive interdisciplinary investigations were carried out at Basel-Gasfabrik (Pichler et al., in preparation) and on the hill of Mormont (Brunetti et al., 2014) to gain detailed insight into the socio-economy of Celtic people in the region. In the Late Iron Age, contacts between Celtic groups and Romans intensified. Mainly the Celtic nobility were susceptible for Roman influence and long distance trade increased in the alpine foreland (Brem and Haldimann, 1999) to import prestige items like wine and tableware, and, according to Caesar, also horses (bell. gall. 4,2,2: Möller, 2013). Several written sources describe ancient horse and mule trade across Europe, Asia and Africa (see e.g. Peters, 1998:140f), yet the scientific evidence for this is scarce (Paulus and Uerpmann, 2007; Nuviala et al., 2014). Horses were venerated status symbols in ancient times (Green, 1992); they were significant for transportation and warfare; however, horse meat was also

* Corresponding author. E-mail address: julia.elsner@email.de (J. Elsner).

eaten on a regular basis by the Celts. Horses played an important part in Celtic symbolism as well, apparent in Epona, patroness of horses and riders, and in the ritual life as indicated for example from perforated horse skulls from La Tene (Meniel, 2007) or carcass depositions in Gournay-sur-Aronde, France (Rapin et al., 1980). However, most Iron Age sites in Switzerland do not contain more than 5% horse remains (Schibler et al., 1999: 121). Celtic horses are described as small (110130 cm withers height), whereas the Romans also bred larger animals (> 140 cm) (Muller-Lhotska, 1984: 114; Peters, 1998: 149f; Arbogast et al., 2002: 44f). Therefore, when encountering small and large horses in Celtic contexts, archaeozoologists often consider the small ones to be local, while larger ones are regarded as imported, endowed or looted. Some authors argue that the reason for the small size of the Celtic horse was poor pasture and low breeding interest (Boessneck et al., 1971: 106), but this interpretation contradicts the Celts' reputation as stock breeders and mounted warriors (Hyland, 1990: 173; Green, 1992: 66; Sidnell, 2006: 162). As small horses are more versatile and quick on the battlefield (Junkelmann, 1990: 44), it can be assumed that the Celts intentionally bred small horses. However, by the Late Iron Age, small and large horses were found to be coexisting in Celtic sites for example in southern Germany (Manching) or Luxembourg (Titelberg)

http://dx.doi.org/10.1016/jjasrep.2016.03.007

2352-409X/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/40/).

(Boessnecketal., 1971; Méniel, 2014:18). Little is known about the genetic diversity of Celtic and Roman horses (Di Bernardo et al., 2004; Bower et al., 2013), yet it is speculated that the Romans introduced new female lineages to conquered regions (Bower et al., 2013).

In ancient DNA (aDNA) studies, the analysis of the non-recombining maternally inherited mitochondrial (mt) DNA has been widely applied due to its high copy number in the cell and the high variability within the non-coding displacement-loop (d-loop). Studies of modern horse mtDNA diversity have revealed an intricate phylogenetic structure. Based on 616 base pairs six major haplogroups were defined (Vila et al., 2001 ; Jansen et al., 2002). The inclusion of additional aDNA data (Cieslak et al., 2010) and whole mitochondrial genomes (Lippold et al., 2011b; Achilli et al., 2012) led to revisions of the initial nomenclature, resulting in now 18 or 19 haplogroups. Apparently, geographic structuring is low today, and was so in wild horse populations, but there is also evidence that some matrilineages were regionally confined (Cieslak et al., 2010; Lira et al., 2010). Studies featuring ancient horse mtDNA suggest multiple domestications and an increasing diversity of female lineages from the Bronze Age onwards (Vila et al., 2001 ; Cieslak et al., 2010).

Animals with unique colour variants may have been specially valued. Individual phenotypic information can be retrieved from nuclear DNA, e.g. from single nucleotide polymorphisms (SNPs). An increasing number of genetic loci associated with coat colour has been detected so far (for reviews see Rieder, 2009; Cieslak et al., 2011) including the pleiotropic effect some of them have on behaviour and health (Reissmann, 2009: 18f; Trut et al., 2009; Bellone, 2010).

Morphological sex identification in archaeological horse remains is feasible when determinant skeletal elements are preserved; these include the canines, which dominantly prevail in males, and the pelvis (Montane et al., 1913). Molecular sex identification is possible using the amelogenin gene (Iwase et al., 2003) and the zinc-finger gene on the X and Y chromosomes (Senese et al., 1999; Han et al., 2010).

Here we investigate horse remains, mostly with known withers heights, from three key Late Iron Age sites in Switzerland where Roman cultural influence is noticeable in the archaeological record. We explore mitochondrial d-loop variation, molecular sex and coat

colour markers of 32 Late La Tene and two Roman time horses. The diversity of the ancient female lineages is compared to modern indigenous horse and pony breeds. This is the first study focusing on variation in horses from a defined region inhabited by Celtic peoples, zooming in on a narrow time frame.

2. Material and methods

2.1. Sites and material

We have selected 32 horse remains from Late Iron Age contexts (La Tene D, 150 BCE-30 CE), the sites of Mormont, Basel-Gasfabrik and pre-Roman Aventicum in Switzerland (Fig. 1). Two samples dating to the late 1st to early 2nd century AD from Aventicum have been added to the analysis. Sample details are given in Table 1. All sites comprised more horse remains than investigated here.

2.1.1. Mormont

The site on the hill of Mormont near Eclepens and La Sarraz, canton Vaud, was first discovered in 2006 during gravel works and addressed as a Helvetic sanctuary (Dietrich et al., 2007). After examining the faunal remains, a second scenario was proposed: the site might have been a temporal camp of refugees or migrants (Meniel, 2014: 195f). Since the investigations by other archaeological disciplines are not finished yet, both interpretations have to be regarded as preliminary. According to typological dating the main occupation time of the site was La Tene D1b (130/120-90/80 BCE), which is supported by absolute dendrochro-nological dates between 107 and 102 BCE (Kaenel, 2014). During this time c. 300 structures were constructed including 260 pits, filled with various items ranging from mill stones, ceramic and metal pots, and decorative objects to an abundance of faunal remains and even several human bones. Horses (n = 40) are the third most common animal based on minimum number of individuals (MNI), after cattle (n = 174) and pigs (n = 59) (Meniel, 2014:12). Given the short occupation time, they might stem from contemporaneous populations. The dead animals had been treated in different ways, some were deposited as articulated (partial) skeletons or cadavers, other bones show cut marks

Fig. 1. Location of investigated sites in Switzerland. 1 - Mormont, canton Vaud; 2 - Avenches/Aventicum, canton Vaud; 3 - Basel-Gasfabrik, canton Basel-City.

Details of archaeologic sites and samples, and summary of results. Given are name, location and date of sites, and laboratory and archaeological code, morphological sex and age identification if determinant elements (pelvis, teeth) are present, skeletal element for withers height estimation and genetic analyses, as well as mitochondrial haplotype, GenBank accession code of d-loop sequences; molecular sex and coat colour. The measurement for greatest length (GL) and smallest breadth of diaphysis (SD) are given in mm, withers height (WH) was estimated after May (1985) and is given in cm. For some of the samples from Mormont, radius GL and SD from the same individual are given in parenthesis (Meniel, 2014: 264). Details on the mitochondrial haplotypes are given in Table 5, on molecular sexing in Table 6 and nuclear loci for the coat colour analysis in Table 7. Nomenclature of mitochondrial haplotypes follows Cieslak et al. (2010).

Site, location (altitude, latitude, longitude), date

Samples

Lab Arch code Morph. Skeletal GL SD WH Mitochondrial GenBank Molecular Coat colour

code sex, age element haplotype ID sex

MO1 Id 4 fosse 293 Female, 18 y Metacarpus 191 27 116.5 I KC893855 - -

sinister (285) (31) (117)

MO2 Id 35 fosse 288 - Metacarpus 181 27 110.5 D3 KC893856 Female -

sinister

MO3 Id 3 fosse 42 Female, 11.5 y Metacarpus 191 25.5 116.5 - - - -

sinister (281) (29.3) (115.5)

MO4 Id 30 fosse 143 - Metacarpus 199 29 121.5 D2 KC893857 - Chestnut

sinister

MO5 Id 21 fosse 94 Female, 15 y Metacarpus 209 30 127.5 X2b KC893858 Female Black/not

sinister grey

MO6 Id 44 fosse 196 - Metacarpus 202 30.5 123 B1 KC893859 Male Black

sinister

MO7 Id 2 fosse 131 Female, 10 y Metacarpus 189 27 115 - - - -

sinister (281) (30.5) (115.5)

MO8 Id 27 fosse 146 - Metacarpus 205 28 125 - - - -

sinister

MO9 Id 42 fosse 275 - Metacarpus 194 29 118 X3c1 + 15,615G KC893860 Male Black/not

sinister grey

MO10 Id 01 fosse 45 Male, 10 y Metacarpus 241 36 147 A/B/C/D/F? KC893861 - -

dexter (365) (41) (150)

MO11 Id 10 fosse 146 Metacarpus Incomplete - - - -

sinister

MO12 Id 32 fosse 146 - Metacarpus 190 28 116 F KC893862 - -

sinister

MO13 Id 53 fosse 210 Male, 5.5 y Metacarpus 191 29.7 116.5 - - - -

sinister (290) (32) (119)

MO14 Id 58 fosse 542 - Metacarpus Incomplete K? KC893863 - -

sinister

MO15 Id 54 fosse 210 Male, 5 y Metacarpus 208 29.7 127 X2b KC893864 - -

sinister

MO16 Id 16 fosse 205 Male, 4 y Metacarpus 234 35.5 143 F KC893865 Male Bay/not grey

sinister (340) (39.2) (140)

MO17 Id 57 fosse 542 - Metacarpus 194 30 118 X2b KC893866 - Chestnut/not

sinister grey

MO18 Id 55 fosse 169 Male, 1.5 y Metacarpus Incomplete (subadult) X2 KC893867 - -

sinister

BGF1 Fk22519 pit44 - Metacarpus 201.5 30.4 123 F KC893850 - Chestnut

excavation 1990/42

BGF2 Fk22576 pit284 - Metacarpus 222.8 35.5 136 X2b KC893851 - -

excavation 1990/32

BGF3 Fk"2" pit114 - Metacarpus 196.9 31.4 120 X3c1 + 631G KC893852 - -

excavation 1941/4

BGF4 Fk"2" pit114 - Metacarpus 178.1 24.9 109 - - - Chestnut

excavation 1941/4

BGF5 Fk 18796 pit256 - Radius/Ulna 276 33 113.5 F KC893854 - -

excavation 1989/5

BGF6 Fk(18943)18714 - Upper - - - - -

pit255 excavation (pre)molar

1989/5

AV1** K10656, Sk4 - Radius 330 35 135.5 - - - -

AV2" K10574 - Radius/ulna 315 36 129.5 X3c1 + 15,615G KC893849 - -

AV3** K10656,Sk3 - Radius 358 39.7 147 X2 KC893848 - -

Mormont, 605 m, 46.66/6.54,

Basel-Gasfabrik, 255 m, 47.57/7.58,

Avenches, 630 m, 46.87/7.05, "Late La Tène, c. 50 BCE, **Roman, late 1st to early 2nd century CE

* refers to AV2 and Late La Tène. ** refers to AV1, AV3 and Roman.

and traces of burning. We have examined 18 randomly chosen equid metacarpi in this study.

2.1.2. Basel-Gasfabrik

In Basel, a settlement of the Rauricii was discovered in 1911 at the left border of the river Rhine (Hecht and Niederhäuser, 2011: 6), today within the area of chemical industry (Gasfabrik, GF). It was excavated in several campaigns during the following 100 years. The

unfortified proto-urban site was inhabited between 150 and 80 BCE (La Tene D1) as indicated for example by fibula types and coins. It comprised houses, gardens and pens as well as craft zones, and two cemeteries. The majority of archaeological and faunal remains stem from the c. 585 pits which had been filled with "waste" after they had become unusable as e.g. storage cellars (Hecht and Niederhäuser, 2011:47). Five horse limb bones and one tooth were chosen for the analysis based on calculability of the horses' withers height (except for the tooth).

2.1.3. Aventicum

Avenches, canton Vaud, was once the capital of the Helvetii known as Aventicum (Castella and Meylan, 2008). Celtic temples had been built in the first century BC, and under the reign of the Roman Emperor Augustus, who forced the urbanisation of the Celtic provinces, Roman town structures were added in the first decade CE which persisted about three hundred years (Blanc and Frei-Stolba, 2001). Aventicum became a Roman colony in 71 CE and was incorporated into Germania Superior when the province was formed in 85 CE (Blanc et al., 2001).The three radii studied here stem from sacrificial pits nearby the temples au Lavoëx and were chosen due to their large size (Deschler-Erb, 2015).

2.2. Modern horse populations

The matrilineages of the ancient horses were compared to modern horse mtDNA variability. The comparison of modern animal sequences to ancient genetic data has to be treated with caution. In ancient times, there were no breeds in today's sense (Johnstone, 2004: 88f) yet different morphotypes were described, for example by Vegetius (mulom. 3,6,2: Lommatzsch, 1903). We selected breeds that come from regions belonging to the Late Roman Republic in c. 100 BCE (Crook et al., 1994: add. mat. 1), contemporaneous to the occupation of both Mormont and Basel-GF. They were grouped into: Spain (Hispania Citerior and Ulterior); Italy (¡talia, Sardinia, Gallia Cisalpina), and Croatia (¡llyricum). In addition, breeds from Switzerland, southern Germany and eastern France represent the home region of the Celtic horses investigated here. Breeds were chosen due to their "indigenous" status according to the Domestic Animal Diversity Information System (DAD-IS; dad.fao.org), to availability on GenBank (ncbi.nlm.nih.gov) in April 2015 and when the authors sampled material from maternally unrelated individuals. As Celtic horses are ponies by today's standards (withers heights < 148 cm) (Fédération Equestre Internationale, 2015: 60) we compared them also to European pony breeds from Spain, Italy, the Carpathians, European Russia, and Northern Europe (including the British Isles). In total, we assembled sequences from 35 museum and 726 modern specimens representing 30 breeds (Table S1).

2.3. Metrics

Measurements of greatest length (GL) and smallest breadth of di-aphysis (SD) of metacarpi and/or radii from Mormont were taken from Méniel (2014: 263f) ; and from Aventicum and Basel-GF measured according to von den Driesch (1976). Withers heights were calculated from GL of all bones according to May (1985); note that this results in an estimation disregarding sexual dimorphism or robustness.

Metacarpus : GL (mm) * 0.6102 = WH (cm) Radius : GL (mm) * 0.4111 = WH (cm)

2.4. Sample preparation, DNA extraction and PCR analysis

Sample preparation and DNA extraction were performed as previously described in Elsner et al. (2014) following the User Developed Protocol: „Purification of total DNA from compact animal bone using the DNeasy® Blood & Tissue Kit "(Qiagen, Basel, Switzerland) in dedicated aDNA facilities physically separated from post-PCR laboratories. Standard precautions and measures in aDNA processing were adhered to (Shapiro and Hofreiter, 2012).

PCR for mtDNA and the nuclear (nc) loci (grey, AMELX/Y, ZFX/Y) was set up in 25 volumes containing 1.5 U AmpliTaq Gold, 1 x GeneAmp 10 x PCR Gold Buffer (150 mM Tris-HCl, 500 mM KCl, pH 8.0) and 2 mM MgCl2 (all Applied Biosystems, Hombrechtikon, Switzerland); 0.4 mM dNTP Mix (Promega, Dübendorf, Switzerland); 0.2 ^M of

Table 2

Primer sequences for mitochondrial haplotyping, and amplification strategy. Target lengths are given excluding primers. Reference sequence from Xu and Arnason (1994).

Name Sequence 5'-3' Position of target in reference sequence NC_001640 Annealing temperature (°C) Length of target (bp, colour)

Ec1_f TTCTTCCCCTAAACGACAACA 15492-15563 52 72(green)

Ec1_r GACGTACATAGGCCATTCATAAGA

Ec4_f GAATGGCCTATGTACGTCGTG 15591-15669 55 79 (4f+4r,

Ec4_r GACTTGGATGGGGTATGCAC pink)

Ec4b_r ATATTATGTACATGCTTATTATTCA 15591-15609 50 19 (4f+4br, red)

Ec2_f ACATAACACCATACCCACCTGACA 15557-15659 55 103 (violet)

Ec2_r GATGGGGTATGCACGATCAATAAT

Ec5_f ACCCCATCCAAGTCAAATCA 15696-15758 55 63 (5f+5r,

Ec5_r TAGTTGGGAGGGTTGCTG light blue)

Eca1_r GGCTTGGTGATTAAGCTCGT 15696-15730 52 35 (5f+a1r, blue)

'5 -^----3

each primer; 20 \ngl\A BSA (bovine serum albumin, Roche, Basel, Switzerland), and up to 10 |al template DNA on a Mastercycler ProS (Eppendorf, Allschwil, Switzerland). The cycling conditions were: 12 min initial denaturation, followed by either 50 (for mtDNA) or 70 (for ncDNA) cycles of denaturation at 95 °C for 40 s, annealing at 52 °C to 58 °C (see Tables 2-4) for 30 s, and extension at 72 °C for 30 s, with a final extension of 60 s at 72 °C. Non-template controls were performed alongside all amplifications. Amplification products were visualised on 2% agarose gels. To authenticate sequence patterns and to exclude potential contamination, at least two PCR products from two independent extractions were obtained.

PCR products of mtDNA amplifications were cloned with the TOPO TA Cloning Kit (Invitrogen, Zug, Switzerland) following the manufacturer's protocol, except that the reaction volume was halved. Two clones of each PCR product were Sanger sequenced by Microsynth (Balgach, Switzerland). The products of the ncDNA PCR were premixed with tailed sequencing primers (Binladen et al., 2007) and also Sanger sequenced by Microsynth.

The coat colour SNPs were amplified in multiplex PCR; the first step in 20 volumes containing 2.5 U AmpliTaq Gold, 1 x GeneAmp 10x Gold Buffer, and 4 mM MgCl2, 0.1 ^M of each primer, 20 |jg/|i BSA, and 4 |al template DNA. After 30 cycles of amplification as described above, PCR products were diluted 1:20; 5 were used in the second, singleplex amplification step (40 cycles) including 0.5 U AmpliTaq Gold, 1 x GeneAmp 10x Gold Buffer, and 4 mM MgCl2, 0.2 |jM of each primer, and 20 ^g/^l BSA. Again, non-template controls were performed and PCR products visualised on 2% agarose gels.

Pyrosequencing of coat colour SNPs of the Basel-GF and Aventicum samples was performed in the Institute for Animal Sciences, Humboldt University Berlin and of Mormont specimens at the Life Science Training Facilities in the Biozentrum, University of Basel according to manufacturer's instructions and Ludwig et al. (2009) on PSQ™ 96MA (Biotage, Uppsala, Sweden).

2.5. Mitochondrial haplotyping

To investigate the matrilineages six partially overlapping and interspersed targets of the mtDNA d-loop with different lengths covering nucleotide positions 15,492-15,669 and 15,696-15,758 (Table 2) (Xuand Arnason, 1994) were amplified. Primers were taken and/or modified from Weber (2005), Cieslaketal. (2010) and Elsner etal. (2014) except for Ec4b_r (this study).

2.6. Molecular sex identification

For the molecular sex identification primer sets Ecab_AMELX/Y from Lippold et al. (2011a) and ZFX/Y_Equus (this study, Table 3) were applied.

Table 3

Primer sequences to identify the molecular sex of horse remains. Reference sequences from Han et al. (2010).

Name Sequence 5'-3' Reference sequence Position of target in reference sequence Annealing temperature (°C) Length of target (bp)

ZFX_Equus_F ATTATATCTGGCCCAGGACT DQ179230 326-382 55 58

ZFX_Equus_R TGCCTAGCTTCCAAATCTAA

ZFY_Equus_F GAATTTCCTACATGCCCATA DQ179229 214-263 55 50

ZFY_Equus_R ATAAAGTCATGAGCCGGATA

2.7. Coat colour analysis

The investigation of nuclear SNPs in the genes associated with coat colour phenotypes was performed as described in Ludwig et al. (2009). Samples were tested for the basic colours bay, chestnut and black via the MCIR- and ASiP-loci (Marklund et al., 1996; Rieder et al., 2001). Epistatic dilutions Cream (Mariat et al., 2003) and Silver (Reissmann et al., 2007) and spottings Overo (Santschi et al., 1998), Tobiano (Brooks et al., 2002) and Sabino (Brooks and Bailey, 2005) were examined. In addition, the grey-locus, resulting in a complete white coat in adult horses regardless of original colour, was investigated. This phenotype is caused by a duplication in intron 6 of the STX17 gene (Rosengren Pielberg et al., 2008). We designed primer pairs to target short fragments of c. 100 bp, first, for the region that spans the end and the beginning of the 4.6 kb duplication (Table 4, red) to detect the mutated allele as well as second, a primer pair to target the end of the fragment (Table 4, blue) which would be present in both wildtype (not grey) and mutated genotype (grey). The suitability of the primer systems was tested on five randomly chosen Freiberger (bay or chestnut) and Camargue (grey) horses each (Fig. S1) at the Institute of Genetics, University of Bern.

2.8. Sequence data analysis

D-loop and STX17 sequences were examined with BioEdit (Hall, 1999). Mitochondrial haplotypes were determined by comparison with the reference sequence NC_001640 (Xu and Arnason, 1994). We used the nomenclature of Cieslak et al. (2010) to determine the haplo-type (Table S2). Haplotype and nucleotide diversity as well as pairwise difference FST values were computed with Arlequin 3.5 (Excoffier and Lischer, 2010), excluding five ancient samples with missing data (see Table 5). The comparison of Iron Age and modern sequences was done on the basis of haplotype frequencies and pairwise differences for each breed, geographic origin and type (horse, pony). Sequences were pruned to positions 15,494-15,740 to include as many samples as possible. FST values were interpreted as follows: values from 0 to 0.05 indicate non to little genetic differentiation, 0.05-0.15 moderate differentiation, 0.15-0.25 large differentiation, and values above 0.25 very large differentiation. Negative FST values equate to zero (Hartl and Clark, 2007: 288). Based on relative haplotype frequencies, Principal Component Analysis (PCA) was computed with PAST (Hammer et al., 2001). Singleton haplotypes were removed from this analysis. Median Joining Networks (MJN) (Bandelt et al., 1999) were constructed with Network 4.6.1.2 (fluxus-engeneering.com) using the following parameters: insertions and deletions were double weighted (default 50),

Table 4

Primer sequences to detect i) the duplication causing premature greying (grey-locus) and ii) the wildtype (no duplication). Figure shows position of target sequences. Reference sequences from Rosengren Pielberg et al. (2008).

transition: transversion ratio was set to 1:10, and variable sites were down weighted according to the number of deviations from the majority at each nucleotide position excluding haplotype defining sites (Tables S2 & S3). The dataset was reduced to 360 modern (one representative per haplotype per breed) and 14 ancient sequences. The probabilities P of allelic dropout for the SNP loci were calculated as in Gagneux et al. (1997): P = K * (K/2)n-1, where K is the number of observed allelic dropouts divided by the number of all positive amplifications of heterozygous individuals, and n is the number of PCR replications.

3. Results

3.1. Metrics

The measurements of SD and GL as well as the estimation of withers height of the La Tene and Roman time horses revealed variation at all archaeological sites. Furthermore, based on metacarpi the individuals cluster into a smaller and into a larger group, based on the radii into three groups (Fig. 2). Note that not all individuals are represented by both skeletal elements. There is a linear correlation between length and breadth (R2 = 0.81 for metacarpi, R2 = 0.9 for radii) indicating isometric growth and no robustness differences.

The archaeozoological defined standard withers height of Celtic horses ranges between c. 110 cm to 130 cm (Peters, 1998; Arbogast et al., 2002); the majority of animals investigated here accord to this (Fig. 3). Five horses were larger than 130 cm: three from the Late Iron

Table 5

Differences to the reference sequence NC_001640 between nucleotide positions 15,49215,669 and 15,696-15,758. Samples indicated by an asterisk have missing data at nucleotide positions: M010, MO14, MO18: 15,564-15,669; BGF2, AV3: 15,564-15,690 and 15,610-15,669. Cieslak et al. (2010) disregard hotspot nucleotide positions 15,585; 15,597; 15,604 and 15,650 for haplotype assignment, they are mentioned here for completeness.

Name Sequence 5'-3' Position of targetin reference sequence EU606026 EU606027 Annealing temperature (°C) Length of target (bp, colour)

Both_f GCACCACCTGGGAACTCA

Both_r CTGGAGTGTGCACCAGAATC 5830-5900 10407-10477 52 71 (blue)

Dup_r GAGAAGTTGGGCAAGAGCAG - 5830-5889 58 61 (red)

Sample Differences to NC_001640 (Xu and Arnason, 1994) Haplotype after

15,... Cieslak et al.

(2010)

MO1 495C; 538G; 602T; 650G; 709T; 720A I

MO2 495C; 650G; 666A; 720A D3

MO4 495C D2

MO5 494C; 495C; 496G; 534T; 585A; 603C; 649G; 720A X2b

MO6 495C; 602T; 617C; 659C; 720A B1

MO9 495C; 542T; 585A; 597G; 602T; 615G; 635T; 650G; X3c1 +615

666A; 703C; 720A

moio* 495C; 720A Haplogroup

A/B/C/D/F?

MO12 495C; 585A; 601C; 602T; 720A F

MO14* 495C; 546T; 703C; 720A Haplogroup K?

MO15 494C; 495C; 496G; 534T; 603C; 649G; 720A X2b

MO16 495C; 585A; 601C; 602T; 720A F

MO17 494C; 495C; 496G; 534T; 603C; 649G; 720A X2b

MO18* 494C; 495C; 496G; 534T; 720A Haplogroup X2

BGF1 495C; 585A; 601C; 602T; 720A F

BGF2* 494C; 495C; 496G; 534T; 603C; 649N; 720A X2b

BGF3 495C; 542T; 597G; 602T; 631G; 635T; 650G; 666A; X3c1 + 631

703C; 720A

BGF5 495C; 585A; 601C; 602T; 720A F

AV2 495C; 542T; 585A; 597G; 602T; 615G; 635T; 650G; X3c1 + 615

666N; 703C; 720A

AV3* 494C; 495C; 496G; 534T; 602T; 603C; 604A; 720A Haplogroup X2

Metacarpi Radii

MOl 0,mE3

M016:] -B AV3 □

MOIO. m 1

BG ?2 ■ c 3 a 016. m J AVI □

BGF5 ■

BGF MOr 3 ® M06.m liMW 05.f MOT. f zF M0 i,f

M013,mg< M09.m 515.m M03; f S3

f ■ m M07.f lOl.f

B> UBGF4 AOi.f -

175 195 215 235 255 275 295 315 335 355

GL (mm)

Fig. 2. Greatest length (GL) against smallest breadth ofdiaphysis (SD) of metacarpi (left panel) and radii (right panel). Bones from Mormont (black), Basel-GF (grey) and Aventicum (light grey). Mormont individuals with data from both skeletal elements indicated by symbol; morphological and/or molecular sex determination: f = female, m = male.

Age: two from Mormont (MO10:149 cm, MO16:142 cm) and one from Basel-GF (BGF2: 136 cm), and both Roman time horses (AV1: 136 cm, AV3: 147 cm) from Aventicum. The average withers height of the Mormont horses was, based on 15 measurable metacarpi and six radii, 124 cm (119 cm without the two large animals). The average in Basel-GF was 120 cm and in Aventicum 137 cm (141 cm for the Roman time individuals).

3.2. Mitochondrial haplotyping

In Mormont ten metacarpi were genetically well preserved, three only allowed for a partial amplification of the target region, and five had no amplifiable mtDNA preserved. It was possible to amplify mtDNA from four out of six samples from Basel-GF and from two out of three radii (one Iron Age, one Roman) from Aventicum. This results in an overall amplification success of 56% (19/34).

We identified eleven haplotypes belonging to six haplogroups (hg). Most prevalent is hg X2 (n = 6), followed by hg F (n = 4), hg X3 (n = 3),hgD(n = 2),hgB(n = 1) and hg I (n = 1). Additionally, one sample each might be associated with hg K and hgs A/B/C/D/F, respectively

(Table 5). Haplotype sharing within and between archaeological sites was observed: haplotype F is shared by MO12, MO16, BGF1 and BGF5. MO15 and MO17 have the same haplotype X2b, MO5 and BGF2 also share variants of X2b, and despite some missing data MO18 and AV3 can be assigned to haplogroup X2 as well. MO9, BGF3 and AV2 possess variants of haplotype X3c1, one of which previously undescribed (BGF3). Horses with withers height below 130 cm carried haplotypes B1, D2, D3, F, I, X2b, and X3c1; they share haplotype F and haplogroup X2 with the large horses. Haplotype (0.92 ± 0.06) and nucleotide (0.3 ± 0.02) diversity is very high in the investigated Iron Age horses (Table S4). This result is mirrored by the horses from Mormont: haplotype diversity = 0.97 ± 0.06, nucleotide diversity5 = 0.3 ± 0.02.

3.3. Molecular sex identification

Molecular sex could be identified for five specimens from Mormont, the other samples were not preserved well enough to enable the amplification of targets in the amelogenin and/or zinc-finger genes (Table 6). This confirms the results of the morphological sex determination for MO5 and MO16; MO2, MO6 and MO9 were previously undetermined.

Fig. 3. Estimated withers height (May, 1985) in cm from metacarpi and/or radii from Mormont (black), Basel-GF (grey) and Aventicum (light grey). When measurements of both bones were available, the mean was used.

Table 6

Results for molecular sex identification with AMELX/Y and ZFX/Y.

Sample AMELX AMELY ZFX ZFY Sex

MO2 1/3 0/3 1/2 0/3 Female

MO5 1/3 0/2 2/2 0/4 Female

MO6 0/2 1/2 2/2 1/3 Male

MO9 0/2 1/1 2/2 2/3 Male

MO16 0/1 0/1 2/2 2/2 Male

3.4. Coat colour

For six of the Mormont and two of the Basel-GF samples DNA preservation allowed for the amplification of SNPs in genes associated with coat colour (Table 7). The specimens from Aventicum were not preserved well enough for SNP typing. All positive samples revealed basic colourations. One large horse (MO16) was bay, of the smaller horses (< 130 cm) three had a black coat and four were chestnut. We did not detect any mutations in the dilution and spotting loci. The Mormont specimens were also tested for the duplication that causes premature greying. For five individuals the target at the end of the 4.6 kb fragment present in both wildtype and mutated genotype could be amplified twice (once for MO6, see Table 7), but the shorter PCR products for the grey-locus were negative four times for each individual suggesting all tested animals were not grey. The probability of allelic dropout for the only heterozygous SNP, MCIR, was p = 0.0015 with four PCR replications.

3.5. Comparison with modern horses

The Median Joining Network shows the widespread distribution of Late Iron Age horse mtDNA d-loop sequences within the variation of southern European horse and European pony breeds (Fig. 4). The ancient horses are represented in the major haplogroups (B, D, F, I, X2, X3) except for hg K (see above).

The fixation index based on the number of pairwise differences between each breed and the ancient horses indicated substantial structuring (FST = 0.12, p < 0.001) (see Table S5 for pairwise population FST). The genetic differentiation between the geographic regions is moderate (FST = 0.06, p < 0.001). FST-values for the regional groups indicate close relationships between all European horse and pony breeds and the Celtic horses, except for the Spanish breeds which are moderately different (Table S6). This outcome is supported by PCA based on the frequencies of haplotypes with loadings > 10% (Fig. 5; frequencies of all haplotypes in Fig. S2). The Iron Age horses stand out from the modern breeds because of their unique variability but tend to be closer to the northern European ponies which share all haplotypes present in the ancient dataset.

4. Discussion

This study provides first insight into mtDNA d-loop diversity, molecular sex and coat colour of Late La Tene horses in Switzerland. DNA preservation was as expected for the region and time frame explored, however, the results for the nuclear markers were better for the recently excavated site on the hill of Mormont (Pruvost et al., 2007; Bollongino et al., 2008). The withers height of the investigated horses fell mostly within the variation of standard Iron Age horses, yet five individuals were larger than 130 cm reaching up to 149 cm. Two of these were identified as male, but smaller stallions were also present, thus sexual dimorphism does not explain the height differences. Moreover, the relation between length and breadth (robustness) is linear, indicating that smaller and larger horses did not belong to different morphotypes (Brooks et al., 2010; Dzierzecka and Komosa, 2013). Only one horse exceeded the defined pony range of maximal 148 cm. The investigation of the maternal lineages revealed high nucleotide and haplotype diversity within the upper range of variance in modern European breeds (see Table S4). The horses belonged to six haplogroups (B, D, F, I, X2, X3) which are rare in wild horses (Weinstock et al., 2005; Cieslak et al., 2010; Lorenzen et al., 2011; Orlando et al., 2013). They were first described from domestic horses from sites in Novosibirsk, Russia, dating to c. 2000 BCE, and Moldova and Romania around 1250 BCE (Cieslak et al., 2010). A haplogroup-package dominated by hgs D, K, X2 and X3 is subsequently found in archaeologic sites throughout Eurasia (Vila et al., 2001; Di Bernardo et al., 2004; Keyser-Tracqui et al., 2005; McGahern et al., 2006; Cai et al., 2007; Cai et al., 2009; Lira et al., 2010; Cieslak et al., 2010; Priskin et al., 2010; Bower et al., 2013).

The large matrilineage diversity is striking, particularly given that the majority of horses, namely those from Mormont, belonged to a potentially contemporaneous local population which should include directly related individuals. The occurrence of shared lineages in the sites Mormont and Basel-GF might indicate horse exchange between Helvetii and Rauricii. The ancient matrilineages show affinities to modern horse and pony breeds from most regions investigated. They tend to have bequeathed more to northern European and British Isles pony breeds and less to Spanish breeds. However, considering that domestic horses were first introduced to Switzerland in the Late Neolithic or Early Bronze Age, i.e. around 2500-2000 BCE (Schibler and Studer, 1998: 177), it is remarkable that most major haplogroups are present in the Iron Age archaeological record, notably in view of the rareness of archaeologic horse remains.

With morphological and molecular methods, five mares and seven stallions were identified, all from the hill site of Mormont. This corresponds to the male:female ratio of 1:1.5 amongst all morphologically sex determined horses in Mormont (Meniel, 2014:17).

Coat colouration seems to be rather uniform. We would expect more variety: Ludwig et al. (2009) documented a rapid and substantial increase in coat colourations already in the Bronze Age, at least in Asia

Results from the coat colour analysis. In addition to the phenotype, the genotypes for the eight SNPs investigated are shown; differences from the wildtype are indicated in bold and only detected at the ASIP- and MCRI-loci. The duplication causing premature greying was not detected in any of the Mormont samples (Avenches and Basel-GF samples were not tested). Unreproducible results are parenthesised.

Sample Phenotype Nuclear Genes

ASIP MC1R EDNRB KIT13 K1T16 MATP SILV9 SILVH GREY

Overo spotting Tobiano spotting Sabino spotting Cream dilution Silver dilution

MO4 (Chestnut) (a/a) (e/e) ov/ov KM0/KM0 (sb1/sb1) C/C (z/z) z/z -

MO5 Black a/a E/e ov/ov KM0/KM0 sb1/sb1 C/C z/z z/z No

MO6 Black a/a E/e ov/ov KM0/KM0 sb1/sb1 C/C z/z z/z (No)

MO9 Black a/a E/e ov/ov KM0/KM0 sb1/sb1 C/C z/z z/z No

MO16 Bay A/A E/E ov/ov KM0/KM0 sb1/sb1 C/C z/z z/z No

MO17 Chestnut a/a e/e ov/ov KM0/KM0 sb1/sb1 C/C z/z (z/z) No

BGF1 Chestnut a/a e/e ov/ov KM0/KM0 sb1/sb1 C/C (z/z) z/z -

BGF4 Chestnut - e/e - KM0/KM0 - C/C z/z z/z -

Differences from the wildtype are indicated in bold; the wildtype is given in capital letters in the genetic nomenclature.

Fig. 4. Median Joining Network of 14 ancient and 355 modern mtDNA d-loop sequences. Circle size is proportional to haplotype frequency. Nomenclature follows Cieslak et al. (2010).

and eastern Europe, and in northern Europe spotted Iron Age horses were detected (Svensson et al., 2012) in comparable datasets. However, monochrome horses were favoured over skewbalds and white markings on face and leg according to written Roman sources (e. g. Corp.

Hippiatr. Gr., 1, 115: Oder and Hoppe, 1924-1927; Geop. 16,2: Wappmann, 1985). Breeders probably had noticed hearing, visual, and neurological impairment and even stillbirths coming along predominantly with spottings, especially in homozygous individuals

Fig. 5. PCA plot based on relative mtDNA haplotype frequencies of the haplotypes present in the Iron Age horses and additional haplotypes with loadings over 10% (see Fig. S2). The two dimensions display 60% of the total variance.

(Reissmann, 2009: 20; Bellone, 2010) and thus may have selected against those phenotypes. Notably premature greying resulting in a white coat regardless of original colour was also not detected. Again, we expected a different result, as white horses played an important role in Roman and also in Germanic ceremonies (Tacitus, Germ. 1,10: Kretschmer, 1986; Johnstone, 2004: 61). However, of the horses investigated, only the specimens from Aventicum stem from an unambiguous ritual context and those were not preserved well enough for genetic coat colour identification. Assuming that ceremonial activities were also performed on the hill of Mormont, we find no evidence that specially coloured horses were preferred in ritual, which apparently also applies for sex as both females and males were present.

Some important archaeozoological questions concerning horse exchange, breeding aims and selection criteria e.g. for ceremony have to remain open yet, due to both the small sample size and insufficient data for comparison. Further complicating is the fact that Roman horses, too, were not standardised and the workaday animals were usually smaller than military or circus breedings (Junkelmann, 1990: 39). It appears that mtDNA d-loop variation offers too little structuring, but because it is highly conservative the investigation of the paternal inherited Y-chromosome cannot contribute to the question of horse provenience either ( Lippold et al., 2011a; Wallner et al., 2013). The exploration of nuclear markers beyond sex and colouration (Schubert et al., 2014) might give insight into possibly distinct characteristics of horses bred by Celtic and Roman stud farmers. Further approaches like stable isotope analysis, particularly of strontium (Slovak and Paytan, 2011), seem even more promising to solve these important issues. It might thus be necessary to dig deeper into the past and to include archaeological material from both Rome and its provinces, and regions outside the Roman Empire to trace the origin and breeding history of small and large horses.

5. Conclusion

The horse remains excavated from the archaeological sites Mormont, Basel-GF and Aventicum, dating to 150-50 BCE (La Tène D) and to c. 100 CE, revealed a high diversity of matrilineages. The most frequent haplogroups F and X2 were shared between the sites, and between small and large horses. While all determinable large individuals (> 140 cm withers height) were male, both sexes were present amongst horses with withers heights between 110 and 130 cm. The detection of solely monochrome coats and the absence of white colourations might indicate selection. The simplified approach to detect premature greying developed in this study provides a relevant tool for aDNA research concerning the phenotypes of (pre)historic horses. Compared to modern indigenous breeds, Late Iron Age horses seem to have bequeathed more to northern European ponies than to Spanish breeds. By broadening the methodological spectrum and by complementing the dataset both spatially and temporally, we hope to address archaeozoological questions on horse exchange, breeding aims, and selection criteria e.g. in ritual contexts more comprehensively.

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.jasrep.2016.03.007.

Acknowledgements

Samples were kindly provided by Archéologie Vaudoise (Mormont), Site et Musée Romain d'Avenches (Aventicum) and Archäologische Bodenforschung Basel-Stadt (Basel-Gasfabrik). The authors thank Tosso Leeb and Michaela Drögemüller (Institute for Genetics, University of Bern), Andreas Papassotiropoulos and Kim Dung Huynh (Biozentrum, University of Basel), Arne Ludwig (Institute for Zoo- and Wildlife Research) and Mélanie Pruvost (then Institute for Animal Sciences, Humboldt University Berlin), Patrice Méniel and Pauline Nuviala (University of Burgundy, Dijon), co-editor Andy Howard, University of Durham, and one anonymous reviewer. Julia Elsner was funded by Swiss National Science Foundation (K-31K1_120528/1), Freiwillige

Akademische Gesellschaft Basel, Nikolaus und Bertha Burckhardt-Bürgin-Foundation.

References

Achilli, A., Olivieri, A., Soares, P., Lancioni, H., Hooshiar Kashani, B., Perego, U.A., Nergadze, S.G., Carossa, V., Santagostino, M., Capomaccio, S., Felicetti, M., Al-Achkar, W., Penedo, M.C., Verini-Supplizi, A., Houshmand, M., Woodward, S.R., Semino, O., Silvestrelli, M., Giulotto, E., Pereira, L., Bandelt, H.J., Torroni, A., 2012. Mitochondrial genomes from modern horses reveal the major haplogroups that underwent domestication. PNAS 109, 2449-2454. http://dx.doi.org/10.1073/pnas.1111637109.

Arbogast, R.M., Benoit, C., Lepetz, S., Méniel, P., Yvinec, J.-H., 2002. Archéologie du cheval. Des origines à la période moderne en France. Hespérides, Paris.

Bandelt, H.J., Forster, P., Rohl, A., 1999. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16, 37-48.

Bellone, R.R., 2010. Pleiotropic effects of pigmentation genes in horses. Anim. Genet. 41, 100-110. http://dx.doi.org/10.1111/j.1365-2052.2010.02116.x.

Binladen, J., Gilbert, M.T., Campos, P.F., Willerslev, E., 2007.5'-tailed sequencing primers improve sequencing quality of PCR products. Biotechniques 42,174-176. http://dx. doi.org/10.2144/000112316.

Blanc, P., Frei-Stolba, R., 2001. Die Stadtentwicklung. Archäol. Schweiz. 24. http://dx.doi. org/10.5169/seals-18959.

Blanc, P., Frey-Kupper, S., Frei-Stolba, R., 2001. Die Anfänge der Hauptstadt der Helvetier. Archäol. Schweiz. 24. http://dx.doi.org/10.5169/seals-18956.

Boessneck J., von den Driesch, A., Meyer-Lemppenau, U., Wechsler-von Ohlen, E., 1971. Die Tierknochenfunde aus dem Oppidum von Manching. Franz Steiner, Wiesbaden.

Bollongino, R., Tresset, A., Vigne, J.D., 2008. Environment and excavation: pre-lab impacts on ancient DNA analyses. C.R. Palevol 7,91-98. http://dx.doi.org/10.1016/j.crpv.2008.02.002.

Bower, MA., Edwards, C.J., Evans, C., Downes, C.S., 2013. Horse husbandry in Iron Age and Romano-British East Anglia: ancient DNA analysis of horses at Langdale Hale, Cambridgeshire. In: Evans, C., Appleby, G., Lucy, S., Regan, R (Eds.), Process and History: Romano-British Communities at Colne Fen, Earith: An Inland Port and Supply Farm. University Press, Cambridge, pp. 140-143.

Brem, H., Haldimann, M.-A., 1999. Handel und Verkehr: Die Latènezeit. In: Müller, F., Kaenel, G., Lüscher, G. (Eds.), SPMIV: Eisenzeit. Verlag Schweizerische Gesellschaft für Ur- und Frühgeschichte, Basel, pp. 215-219.

Brooks, S.A., Bailey, E., 2005. Exon skipping in the KIT gene causes a Sabino spotting pattern in horses. Mamm. Genome 16,893-902. http://dx.doi.org/10.1007/s00335-005-2472-y.

Brooks, S.A., Makvandi-Nejad, S., Chu, E., Allen, J.J., Streeter, C., Gu, E., McCleery, B., Murphy, B.A., Bellone, R., Sutter, N.B., 2010. Morphological variation in the horse: defining complex traits of body size and shape. Anim. Genet. 41,159-165. http://dx.doi. org/10.1111/j.1365-2052.2010.02127.x.

Brooks, S.A., Terry, R.B., Bailey, E., 2002. A PCR-RFLP for KIT associated with tobiano spotting pattern in horses. Anim. Genet. 33,301-303. http://dx.doi.org/10.1046/j.1365-2052.2002.00854.x.

Brunetti, C., Kaenel, G., Méniel, P. (Eds.), 2014. Les Helvètes au Mormont. Une énigme dans le monde celtique. SAS Archeodunum, Chaponnay.

Cai, D.W., Han, L., Xie, C.Z., Li, S.N., Zhou, H., Zhu, H., 2007. Mitochondrial DNA analysis of Bronze Age horses recovered from Chifeng region, Inner Mongolia, China. Prog. Nat. Sci. 17, 544-550.

Cai, D.W., Tang, Z.W., Han, L., Speller, C.F., Yang, D.Y.Y., Ma, X.L., Cao, J.E., Zhu, H., Zhou, H.,

2009. Ancient DNA provides new insights into the origin of the Chinese domestic horse. J. Archaeol. Sci. 36, 835-842. http://dx.doi.org/10.1016/j.jas.2008.11.006.

Castella, D., Meylan, M.F., 2008. Topographie sacrée et rituels: le cas d'Aventicum, capital des Helvètes: Actes du colloque international d'Avenches, 2-4 Novembre 2006: Antiqua.

Cieslak, M., Pruvost, M., Benecke, N., Hofreiter, M., Morales, A., Reissmann, M., Ludwig, A.,

2010. Origin and history of mitochondrial DNA lineages in domestic horses. PLoS One 5, e15311. http://dx.doi.org/10.1371/journal.pone.0015311.

Cieslak M., Reissmann, M., Hofreiter, M., Ludwig, A., 2011. Colours of domestication. Biol. Rev. Camb. Philos. Soc. 86, 885-899. http://dx.doi.org/10.1111/j.1469-185X.2011. 00177.x.

Crook J.A., Lintott, A., Rawson, E. (Eds.), 1994. The Cambridge Ancient History Volume 9: The Last Age of the Roman Republic, 146-43 BC. University Press, Cambridge.

Deschler-Erb, S., 2015. Tier und Kult - Spezielle Tierknochendeponierungen der Spätlatène- und Römerzeit aus Aventicum/Avenches (CH) im nordalpinen Vergleich. Musée Romain d'Avenches, Avenches.

Di Bernardo, G., Galderisi, U., Del Gaudio, S., D'Aniello, A., Lanave, C., De Robertis, M.T., Cascino, A., Cipollaro, M., 2004. Genetic characterization of Pompeii and Herculaneum Equidae buried by Vesuvius in 79 AD. J. Cell. Physiol. 199,200-205. http://dx.doi.org/ 10.1002/jcp.10461.

Dietrich, E., Kaenel, G., Weidmann, D., Jud, P., Méniel, P., Moinat, P., 2007. Le sanctuaire helvète du Mormont. Archäol. Schweiz. 30, 2-13. http://dx.doi.org/10.5169/seals-109261.

Dzierzecka, M., Komosa, M., 2013. Variability of the proximal phalanx in warmblood and coldblood horses - morphological and structural analyses. Belg. J. Zool. 143, 119-130.

Elsner, J., Schibler, J., Hofreiter, M., Schlumbaum, A., 2014. Burial condition is the most important factor for mtDNA PCR amplification success in Palaeolithic equid remains from the Alpine foreland. Archaeol. Anthropol. Sci. 1--11 http://dx.doi.org/10.1007/ s12520-014-0213-4.

Excoffier, L., Lischer, H.E., 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 10, 564-567. http://dx.doi.org/10.! 111/j.1755-0998.2010.02847.x.

Fédération Equestre Internationale FEI, 2015. 2015 Veterinary Regulations. Fédération Equestre Internationale, Lausanne.

Gagneux, P., Boesch, C., Woodruff, D.S., 1997. Microsatellite scoring errors associated with noninvasive genotyping based on nuclear DNA amplified from shed hair. Mol. Ecol. 6, 861-868.

Green, M.J., 1992. Animals in Celtic life and Myth. Routledge, London New York.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95-98 (doi: citeulike-article-id:691774).

Hammer, O., Harper, D.A.T., Ryan, P.D., 2001. PAST: paleontological statistics software package for education and data analysis. Palaeontol. Electron. 4, 1 -9.

Han, S.-H., Yang, B.-C., Ko, M.-S., Oh, H.-S., Lee, S.-S., 2010. Length difference between equine ZFX and ZFY genes and its application for molecular sex determination. J. Assist. Reprod. Genet. 27, 725-728. http://dx.doi.org/10.1007/s10815-010-9467-7.

Hartl, D.L., Clark, A.G., 2007. Principles of Population Genetics. Sinauer Associates, Inc. Publishers, Sunderland, Mass.

Hecht, Y., Niederhäuser, A., 2011. Alltagskultur und Totenrituale der Kelten. Ein Siedlungszentrum am Oberrhein um 100 v. Chr. - The everyday culture and funerary rituals of the Celts. A central settlement on the Upper Rhine around 100 BC. Christoph Merian Verlag, Basel.

Hyland, A., 1990. Equus: The Horse in the Roman World. Yale University Press, New Haven, London.

Iwase, M., Satta, Y., Hirai, Y., Hirai, H., Imai, H., Takahata, N., 2003. The amelogenin loci span an ancient pseudoautosomal boundary in diverse mammalian species. PNAS 100,5258-5263. http://dx.doi.org/10.1073/pnas.0635848100.

Jansen, T., Forster, P., Levine, M.A., Oelke, H., Hurles, M., Renfrew, C., Weber, J., Olek, K., 2002. Mitochondrial DNA and the origins of the domestic horse. PNAS 99, 10905-10910. http://dx.doi.org/10.1073/pnas.152330099.

Johnstone CJ (2004) A Biometric Study of Equids in the Roman World. (PhD thesis Archaeology department). York: University of York

Junkelmann, M., 1990. Die Reiter Roms. Teil I: Reise, Jagd, Triumph und Circusrennen. Philipp von Zabern, Mainz.

Kaenel, G., 2014. De quand date l'occupation du Mormont? In: Brunetti, C., Kaenel, G., Méniel, P. (Eds.), Les Helvètes au Mormont Une énigme dans le monde celtique. SAS Archeodunum, Chaponnay, pp. 74-75

Keyser-Tracqui, C., Blandin-Frappin, P., Francfort, H.P., Ricaut, F.X., Lepetz, S., Crubezy, E., Samashev, Z., Ludes, B., 2005. Mitochondrial DNA analysis of horses recovered from a frozen tomb (Berel site, Kazakhstan, 3rd Century BC). Anim. Genet. 36, 203-209. http ://dx.doi.org/10.1111/j.1365-2052.2005.01316.x.

Kretschmer, M. (Ed.), 1986. Tacitus: Germania. Verlag Aschendorff, Münster.

Lippold, S., Knapp, M., Kuznetsova, T., Leonard, J.A., Benecke, N., Ludwig, A., Rasmussen, M., Cooper, A., Weinstock J., Willerslev, E., Shapiro, B., Hofreiter, M., 2011a. Discovery of lost diversity of paternal horse lineages using ancient DNA. Nat. Commun. 2, 450. http://dx.doi.org/10.1038/Ncomms1447.

Lippold, S., Matzke, N.J., Reissmann, M., Hofreiter, M., 2011b. Whole mitochondrial genome sequencing of domestic horses reveals incorporation of extensive wild horse diversity during domestication. BMC Evol. Biol. 11, 328. http://dx.doi.org/10.1186/ 1471-2148-11-328.

Lira, J., Linderholm, A., Olaria, C., Brandstrom Durling, M., Gilbert, M.T., Ellegren, H., Willerslev, E., Liden, K., Arsuaga, J.L., Gotherstrom, A., 2010. Ancient DNA reveals traces of Iberian Neolithic and Bronze Age lineages in modern Iberian horses. Mol. Ecol. 19, 64-78. http://dx.doi.org/10.1111/j.1365-294X.2009.04430.x.

Lommatzsch, E. (Ed.), 1903. P. Vegeti Renati digestorum artis mulomedicinae libri. B. G. Teubner, Leipzig.

Lorenzen, E.D., Nogues-Bravo, D., Orlando, L., Weinstock, J., Binladen, J., Marske, K.A., Ugan, A., Borregaard, M.K., Gilbert, M.T., Nielsen, R., Ho, S.Y., Goebel, T., Graf, K.E., Byers, D., Stenderup, J.T., Rasmussen, M., Campos, P.F., Leonard, J.A., Koepfli, K.P., Froese, D., Zazula, G., Stafford Jr., T.W., Aaris-Sorensen, K., Batra, P., Haywood, A.M., Singarayer, J.S., Valdes, P.J., Boeskorov, G., Burns, J.A., Davydov, S.P., Haile, J., Jenkins, D.L., Kosintsev, P., Kuznetsova, T., Lai, X., Martin, L.D., McDonald, H.G., Mol, D., Meldgaard, M., Munch, K., Stephan, E., Sablin, M., Sommer, R.S., Sipko, T., Scott, E., Suchard, M.A., Tikhonov, A., Willerslev, R., Wayne, R.K., Cooper, A., Hofreiter, M., Sher, A., Shapiro, B., Rahbek C., Willerslev, E., 2011. Species-specific responses of Late Quaternary megafauna to climate and humans. Nature 479, 359-364. http:// dx.doi.org/10.1038/nature10574.

Ludwig, A., Pruvost, M., Reissmann, M., Benecke, N., Brockmann, G.A., Castanos, P., Cieslak, M., Lippold, S., Llorente, L., Malaspinas, A.S., Slatkin, M., Hofreiter, M., 2009. Coat color variation at the beginning of horse domestication. Science 324,485. http://dx.doi.org/ 10.1126/science.1172750.

Mariat, D., Taourit, S., Guerin, G., 2003. A mutation in the MATP gene causes the cream coat colour in the horse. Genet. Sel. Evol. 35,119-133. http://dx.doi.org/10.1051/ gse:2002039.

Marklund, L., Moller, M.J., Sandberg, K., Andersson, L., 1996. A missense mutation in the gene for melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat color in horses. Mamm. Genome 7, 895-899. http://dx.doi.org/10. 1007/s003359900264.

May, E., 1985. Widerristhöhe und Langknochenmaße bei Pferden - ein immer noch aktuelles Problem. Z. Säugetierkunde 50, 368-382.

McGahern, A.M., Edwards, C.J., Bower, M.A., Heffernan, A., Park, S.D., Brophy, P.O., Bradley, D.G., MacHugh, D.E., Hill, E.W., 2006. Mitochondrial DNA sequence diversity in extant Irish horse populations and in ancient horses. Anim. Genet. 37,498-502. http://dx. doi.org/10.1111 /j.1365-2052.2006.01506.x.

Méniel, P., 2007. Les animaux de La Tène. In: Musée Schwab Bienne MSB and Landesmuseum Zürich LZ (eds) La Tène La recherche, les questions, les réponses. Verlag Museum Schwab, Biel, pp. 61 -65.

Méniel, P., 2014. Les restes animaux du site du Mormont. Eclépens et La Sarraz, canton de Vaud, vers 100 avant J.-C. Cahiers d'Archéologie Romande, Lausanne.

Möller, L. (Ed.), 2013. Der gallische Krieg/Gaius Iulius Ceasar. Marixverlag, Wiesbaden.

Montane, L., Bourdelle, E., Bressou, C., 1913. Anatomie régionale des animaux domestiques, I: Cheval. Baillière, Paris.

Müller-Lhotska, U.A., 1984. Das Pferd in der Schweiz. Von der Prähistorie bis zum ausgehenden Mittelalter (PhD thesis History department) University of Zürich, Zürich.

Nuviala, P., Nowell, G., Ughetto, J., Balasse, M., 2014. L'origine des chevaux du site du Mormont (canton de Vaud, Suisse): L'apport des isotopes du carbone, de l'oxygène et du strontium. In: Barral, P., Guillaumet, M.-J., Roulière-Lambert, M.-J., Saracino, M., Vitali, D. (Eds.), Les Celtes et le nord de l'Italie Premier et second âges du fer. Société archéologique de l'Est, Vérone, pp. 603-610.

Oder, E., Hoppe, K. (Eds.), 1924-1927. Corpus hippiatricorum graecorum. B. G. Teubner, Leipzig.

Orlando, L., Ginolhac, A., Zhang, G., Froese, D., Albrechtsen, A., Stiller, M., Schubert, M., Cappellini, E., Petersen, B., Moltke, I., Johnson, P.L., Fumagalli, M., Vilstrup, J.T., Raghavan, M., Korneliussen, T., Malaspinas, A.S., Vogt, J., Szklarczyk, D., Kelstrup, C.D., Vinther, J., Dolocan, A., Stenderup, J., Velazquez, A.M., Cahill, J., Rasmussen, M., Wang, X., Min, J., Zazula, G.D., Seguin-Orlando, A., Mortensen, C., Magnussen, K., Thompson, J.F., Weinstock, J., Gregersen, K., Roed, K.H., Eisenmann, V., Rubin, C.J., Miller, D.C., Antczak, D.F., Bertelsen, M.F., Brunak, S., Al-Rasheid, K.A., Ryder, O., Andersson, L., Mundy, J., Krogh, A., Gilbert, M.T., Kjaer, K., Sicheritz-Ponten, T., Jensen, L.J., Olsen, J.V., Hofreiter, M., Nielsen, R., Shapiro, B., Wang, J., Willerslev, E., 2013. Recalibrating Equus evolution using the genome sequence of an early Middle Pleistocene horse. Nature 499, 74-78. http://dx.doi.org/10.1038/nature12323.

Paulus, S., Uerpmann, H.P., 2007. Physikalisch-chemische Untersuchungen an Equidenzähnen aus Kalkriese zur Bestimmung von Knochenerhaltung und Jahreszeit der Schlacht. In: Wilbers-Rost, S., Uerpmann, H.P., Uerpmann, M., Grosskopf, B., Tolksdorf-Lienemann, E. (Eds.), Kalkriese 3: Interdisziplinäre Untersuchungen auf dem Oberesch in Kalkriese, Archäologische Befunde und naturwissenschaftliche Begleituntersuchungen. Verlag Philipp von Zabern, Mainz, pp. 145-156.

Peters, J., 1998. Römische Tierhaltung und Tierzucht. Marie Leidorf GmbH, Rahden/Westf.

Pichler SL, Lassau G, Alt KW, Röder B and Schibler J (eds) (in preparation). Ober die Toten zu den Lebenden. Interdisziplinäre Synthese, Basel: ABBS.

Priskin, K., Szabo, K., Tomory, G., Bogacsi-Szabo, E., Csanyi, B., Eordogh, R., Downes, C.S., Rasko, I., 2010. Mitochondrial sequence variation in ancient horses from the Carpathian Basin and possible modern relatives. Genetica 138, 211-218. http://dx. doi.org/10.1007/s10709-009-9411-x.

Pruvost, M., Schwarz, R., Correia, V.B., Champlot, S., Braguier, S., Morel, N., Fernandez-Jalvo, Y., Grange, T., Geigl, E.M., 2007. Freshly excavated fossil bones are best for amplification of ancient DNA. PNAS 104, 739-744. http://dx.doi. org/10.1073/pnas.0610257104.

Rapin, A., Méniel, P., Brunaux, J.-L., 1980. Un sanctuaire gaulois à Gournay-sur-Aronde (Oise) Gallia pp. 1-25.

Reissmann, M., 2009. Die Farben der Pferde. Genetik, Klassifizierung, Charakteristik. Cadmos, Brunsbek.

Reissmann, M., Bierwolf, J., Brockmann, G.A., 2007. Two SNPs in the SILV gene are associated with silver coat colour in ponies. Anim. Genet. 38, 1 -6. http://dx.doi.org/10. 1111/j.1365-2052.2006.01553.x.

Rieder, S., 2009. Molecular tests for coat colour in horses. J. Anim. Breed. Genet. 126, 415-424. http://dx.doi.org/10.1111 /j.1439-0388.2009.00832.x.

Rieder, S., Taourit, S., Mariat, D., Langlois, B., Guerin, G., 2001. Mutations in the agouti (ASIP), the extension (MC1R), and the brown (TYRP1) loci and their association to coat color phenotypes in horses (Equus caballus). Mamm. Genome 12, 450-455. http://dx.doi.org/10.1007/s003350020017.

Rosengren Pielberg, G., Golovko, A., Sundstrom, E., Curik, I., Lennartsson, J., Seltenhammer, M.H., Druml, T., Binns, M., Fitzsimmons, C., Lindgren, G., Sandberg, K., Baumung, R., Vetterlein, M., Stromberg, S., Grabherr, M., Wade, C., Lindblad-Toh, K., Ponten, F., Heldin, C.H., Solkner, J., Andersson, L., 2008. A cis-acting regulatory mutation causes premature hair graying and susceptibility to melanoma in the horse. Nat. Genet. 40, 1004-1009. http://dx.doi.org/10.1038/ng.185.

Santschi, E.M., Purdy, A.K., Valberg, S.J., Vrotsos, P.D., Kaese, H., Mickelson, J.R., 1998. Endothelin receptor B polymorphism associated with lethal white foal syndrome in horses. Mamm. Genome 9, 306-309.

Schibler, J., Stopp, B., Studer,J., 1999. Haustierhaltung und Jagd. In: Müller, F., Kaenel, G., Lüscher, G. (Eds.), SPM IV: Eisenzeit. Schweizerische Gesellschaft für Ur- und Frühgeschichte, Basel, pp. 116-136.

Schibler, J., Studer, J., 1998. Haustierhaltung und Jagd während der Bronzezeit der Schweiz. In: Hochuli, S., Niffeler, U., Rychener, J. (Eds.), SPM III: Bronzezeit. Gesellschaft für Ur- und Frühgeschichte der Schweiz, Basel, pp. 171-192.

Schubert, M., Jonsson, H., Chang, D., Der Sarkissian, C., Ermini, L., Ginolhac, A., Albrechtsen, A., Dupanloup, I., Foucal, A., Petersen, B., Fumagalli, M., Raghavan, M., Seguin-Orlando, A., Korneliussen, T.S., Velazquez, A.M., Stenderup, J., Hoover, C.A., Rubin, C.J., Alfarhan, A.H., Alquraishi, S.A., Al-Rasheid, K.A., MacHugh, D.E., Kalbfleisch, T., MacLeod, J.N., Rubin, E.M., Sicheritz-Ponten, T., Andersson, L., Hofreiter, M., Marques-Bonet, T., Gilbert, M.T., Nielsen, R., Excoffier, L., Willerslev, E., Shapiro, B., Orlando, L., 2014. Prehistoric genomes reveal the genetic foundation and cost of horse domestication. PNAS 111, E5661-E5669. http://dx.doi.org/10.1073/pnas.1416991111.

Senese, C., Penedo, M.C.T., Shiue, Y.L., Bowling, A.T., Millon, L.V., 1999. A HaeIII PCR-RFLP in the ZFY/ZFX genes of horses. Anim. Genet. 30, 390-391. http://dx.doi.org/10.1046/j. 1365-2052.1999.00526-10.x.

Shapiro, B., Hofreiter, M. (Eds.), 2012. Ancient DNA - Methods and Protocols. Springer, New York.

Sidnell, P., 2006. Warhorse. Cavalry in Ancient Warfare. Continuum Books, London, New York.

Slovak, N.M., Paytan, A., 2011. Applications of Sr isotopes in archaeology. In: Baskaran, M. (Ed.), Handbook of Environmental Isotope Geochemistry. Springer, Berlin, Heidelberg, pp. 743-768. Svensson, E.M., Telldahl, Y., Sjoling, E., Sundkvist, A., Hulth, H., Sjovold, T., Gotherstrom, A., 2012. Coat colour and sex identification in horses from Iron Age Sweden. Ann. Anat. 194, 82-87. http://dx.doi.org/10.10167j.aanat.2011.11.001. Trut, L., Oskina, I., Kharlamova, A., 2009. Animal evolution during domestication: the domesticated fox as a model. BioEssays 31, 349-360. http://dx.doi.org/10.1002/bies. 200800070.

Vila, C., Leonard, J.A., Gotherstrom, A., Marklund, S., Sandberg, K., Liden, K., Wayne, R.K., Ellegren, H., 2001. Widespread origins of domestic horse lineages. Science 291, 474-477. http://dx.doi.org/10.1126/science.291.5503.474. von den Driesch, A., 1976. A Guide to the Measurement of Animal Bones From Archaeological Sites. Harvard University Press, Cambridge, Mass. Wallner, B., Vogl, C., Shukla, P., Burgstaller, J.P., Druml, T., Brem, G., 2013. Identification of genetic variation on the horse y chromosome and the tracing of male founder

lineages in modern breeds. PLoS One 8, e60015. http://dx.doi.org/10.1371/journal. pone.0060015.

Wappmann, U., 1985. Buch 16 und 17 der Geoponica. Obersetzung und Besprechung (PhD thesis Veterinary Medicine. München).

Weber, C., 2005. Molekulargenetische Typisierung einer skythenzeitlichen Pferdepopulation (Master thesis Paleogenomics Mainz: Johannes Gutenberg-Universität).

Weinstock, J., Willerslev, E., Sher, A., Tong, W., Ho, S.Y., Rubenstein, D., Storer, J., Burns, J., Martin, L., Bravi, C., Prieto, A., Froese, D., Scott, E., Xulong, L., Cooper, A., 2005. Evolution, systematics, and phylogeography of Pleistocene horses in the new world: a molecular perspective. PLoS Biol. 3, e241. http://dx.doi.org/10.1371/journal.pbio. 0030241.

Xu, X., Arnason, U., 1994. The complete mitochondrial DNA sequence of the horse, Equus caballus: extensive heteroplasmy of the control region. Gene 148,357-362.