CC BY-NC-SA
0Citation: Molecular Therapy—Nucleic Acids (2015) 4, e268; doi:10.1038/mtna.2015.42 Official journal of the American Society of Gene & Cell Therapy All rights reserved 2162-2531/15
www.nature.com/mtna
CCR5 Disruption in Induced Pluripotent Stem Cells Using CRISPR/Cas9 Provides Selective Resistance of Immune Cells to CCR5-tropic HIV-1 Virus
HyunJun Kang1, Petra Minder2, Mi Ae Park1, Walatta-Tseyon Mesquitta1, Bruce E Torbett2 and Igor I Slukvin1-3
The chemokine (C-C motif) receptor 5 (CCR5) serves as an HIV-1 co-receptor and is essential for cell infection with CCR5-tropic viruses. Loss of functional receptor protects against HIV infection. Here, we report the successful targeting of CCR5 in GFP-marked human induced pluripotent stem cells (iPSCs) using CRISPR/Cas9 with single and dual guide RNAs (gRNAs). Following CRISPER/Cas9-mediated gene editing using a single gRNA, 12.5% of cell colonies demonstrated CCR5 editing, of which 22.2% showed biallelic editing as determined by a Surveyor nuclease assay and direct sequencing.The use of dual gRNAs significantly increased the efficacy of CCR5 editing to 27% with a biallelic gene alteration frequency of 41%. To ensure the homogeneity of gene editing within cells, we used single cell sorting to establish clonal iPSC lines. Single cell-derived iPSC lines with homozygous CCR5 mutations displayed the typical characteristics of pluripotent stem cells and differentiated efficiently into hematopoietic cells, including macrophages. Although macrophages from both wild-type and CCR5-edited iPSCs supported CXCR4-tropic virus replication, macrophages from CCR5-edited iPSCs were uniquely resistant to CCR5-tropic virus challenge. This study demonstrates the feasibility of applying iPSC technology for the study of the role of CCR5 in HIV infection in vitro, and generation of HIV-resistant cells for potential therapeutic applications.
Molecular Therapy—Nucleic Acids (2015) 4, e268; doi:10.1038/mtna.2015.42; published online 15 December 2015 Subject Category: Therapeutic proof-of-concept Gene insertion, deletion & modification
Intoduction
The chemokine receptor 5 (CCR5) binds RANTES (CCL5), MIP1a (CCL3), and MIP1 p (CCL4) cytokines1 and plays an important role in mounting an inflammatory response to infection. The discovery that CCR5 serves as a coreceptor for R5-HIV-1 virus, coupled with the findings that individuals lacking CCR5 are protected from HIV infection,2 led to the exploration of novel therapeutic strategies for HIV infection based on disruption of CCR5 function. Transplantation of hematopoietic stem cells with a CCR5-A32 mutation to a leukemic, HIV-positive patient cured both HIV and leukemia,34 thus underscoring the therapeutic power of CCR5-disrupted immune cells for resisting HIV-1, and importantly, contributing to a cure. Conversion of autologous human adult cells to induced pluripotent stem cells (iPSCs) provides a unique opportunity to produce different types of gene-edited cells since iPSCs can be expanded for long periods of time ex vivo, genetically modified using homologous recombination, clonally selected, and differentiated to almost any type of cell in the human body. Thus, iPSCs have emerged as a promising option for providing HIV-resistant immune cells for cellular therapies.
Recently, successful disruption of CCR5 gene function has been reported in human pluripotent stem cells using zinc finger nucleases (ZFNs)5 and a combination of
transcription activator-like effector nucleases (TALENs) and PiggyBac technology or clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein-9 (Cas9) gene-editing systems combined with PiggyBac technology.6 Herein, we evaluated the efficacy of using CRISPR/Cas9 to edit the CCR5 gene in iPSCs and compared single with dual guide RNA (gRNA) strategies for CCR5 disruption to protect cells from HIV-1 using CCR5 for entry. We found that the dual gRNA approach significantly increased the frequency of biallelic CCR5 gene editing without compromising specificity. To ensure the homogeneity of gene editing within cells, we used single cell sorting to establish clonal iPSC lines. These cell lines maintained the typical characteristics of pluripotent stem cells and differentiated efficiently into hematopoietic cells. Although prior studies have demonstrated resistance of macrophages from CCR5-mutant iPSCs to CCR5-tropic virus,6 it remains unclear whether this resistance is due to the effect of CCR5 mutation on macrophage development from iPSCs, thereby affecting their capacity to support any type of infection, or if this mutation confers a selective protection to CCR5-tropic viruses. In this study, we demonstrated that macrophages from both wild-type and CCR5-edited iPSCs supported CXCR4-tropic virus replication. However, macrophages from CCR5-edited iPSCs were uniquely resistant to CCR5-tropic virus challenge.
The last two authors are co-senior authors.
National Primate Research Center, University of Wisconsin Graduate School, Madison, Wisconsin, USA; department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California, USA; 3Department of Pathology and Laboratory Medicine, University of Wisconsin Medical School, Madison, Wisconsin, USA. Correspondence: Igor I Slukvin, Department of Pathology and Laboratory Medicine, University of Wisconsin, 1220 Capitol Court, Madison, Wisconsin 53715, USA. E-mail: islukvin@wisc.edu and Bruce E Torbett, Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037, USA. E-mail: betorbet@scripps.edu
Keywords: CCR5; CRISPR/Cas9; hematopoietic cells; HIV; induced pluripotent stemcells
Received 29 September 2015; accepted 24 October 2015; published online 15 December 2015. doi: 10.1038/mtna.2015.42
Results
CCR5 locus targeting using a single gRNA
A DF19-9-7T transgene-free fibroblast-derived iPSC line, obtained using episomal vectors as previously described,7 was utilized to generate hematopoietic derivatives. To track hematopoietic lineages in vitro derived from DF19-9-7T cells, we transfected the iPSCs with a Clover GFP plasmid. Following selection and screening of more than 20 cellular clones, we isolated a clone that retained GFP expression throughout all stages of hematopoietic differentiation, including mature macrophages (Supplementary Figure S1) and subsequently used this clone for the generation of human iPSCs with edited CCR5 alleles.
To successfully alter CCR5 sufficiently to halt HIV-1 entry, a CCR5 CRISPR was developed with a single guide RNA (gRNAI), as previously reported8 (Table 1 and Figure 1a). The rationale for gRNA selection was that it must have homology to near the 5' end of the open-reading frame of the CCR5 gene and should promote a frame-shift of the entire CCR5 open-reading frame when active, thereby resulting in complete gene disruption. After trans-fection of iPSCs with a single CCR5 gRNAI and Cas9, 288 colonies were selected and each cell colony was analyzed by extraction of genomic DNA and amplification of the CCR5 open-reading frame encompassing region followed by Surveyor nuclease assay (Figure 1b). We found that 12.5% of the isolated iPSC colonies had evidence of CCR5 editing, of which 22.2% were found to be CCR5 biallelically edited (Figure 1c). Genomic sequencing further confirmed CCR5 gene disruption in the identified iPSCs clones. Single gRNA-targeting of CCR5 gene varied from 1 to 19 nucleotide (nt) deletions, as well as substitutions resulting in a stop codon (Figure 1b). For further studies, two cell colonies were selected from the biallelic CCR5 disrupted iPSCs, GFP-CCR5mut-hiPSC-7 with 7 bp- and 16 bp-mutations in each allele, and GFP-CCR5mut-hiPSC-8 with 10 bp- and 19 bp-mutations in each allele. To ensure homogeneity, we generated clones from both CCR5mut-iPSC lines using fluorescence-activated cell sorting-based automated single cell deposition. The GFP-CCR5mut-hiPSC-SC7 and GFP-CCR5mut-hiPSC-SC8 lines established from single cells retained expression of typical pluripotency markers ( Figure 1d), formed teratomas composed of the derivatives of all three germ layers (Figure 1e), and maintained a normal karyotype (Figure 1f).
CCR5 locus targeting using dual gRNAs
Recently, several CRISPR/Cas9 studies have reported that the simultaneous use of dual gRNAs results in a much better targeting efficiency and specificity when compared with the use of a single gRNA.9-12 Given that the activity of gRNA/ Cas9 varies in different cell types,1113 we next evaluated whether a dual gRNA strategy would be able to improve disruption of the CCR5 locus in human iPSCs. We designed CCR5 gRNA2 and gRNA3 with homology to genomic regions that are ~500bp downstream of the locus that was targeted with gRNA1 and used the combinations gRNA1 with gRNA2, or gRNA3, to produce iPSC CCR5 mutants (Figure 2a). Coincidently, gRNA2 that we designed was the same gRNA that Ye et al. used for their experiments.6 We found that combinatorial gRNA targeting was much more efficient for the introduction of CCR5 editing when compared with a single gRNA. Using genomic DNA-PCR followed by sequencing (Figure 2b and Supplementary Figure S2), gRNA1/ gRNA2 resulted in 30.8% mutated clones, whereas gRNA1/ gRNA3 resulted in 23.3% clones (Figure 2c). Approximately 40% of the mutant clones demonstrated biallelic mutations (Figure 2c). Thus, dual gRNAs targeting and editing efficiency was two times greater than with a single gRNA system. As shown in Supplementary Figure S2, the use of dual gRNAs targeting and editing resulted in ~500bp deletions from the two gRNA combinations, with a cleavage site 3-nt upstream of the protospacer-adjacent motif sequence, 5'-NGG as expected.14 Two clones, GFP-CCR5mut-hiPSC-Comb1 -8 with a biallelic 517-nt deletion and GFP-CCR5mut-hiPSC-Comb2-1 with a biallelic 551-nt deletion, were selected and subjected to fluorescence-activated cell sorting-based automated single cell deposition to obtain GFP-CCR5mut-hiPSC-Comb1-SC8 and GFP-CCR5mut-hiPSC-Comb2-SC1, both of which were single cell-derived iPSC lines. Both clonally derived CCR5-edited cell lines retained pluripotency markers (Figure 2d), formed teratomas (Figure 2e), and displayed a normal karyotype (Figure 2f).
Evaluation of off-targeting effects
The use of CRISPR/Cas9 for disrupting specific targets carries a risk for off-target genomic mutations.15 To investigate potential off-target genomic events in our chosen CCR5-mut iPSC clones, we selected 3-nt mismatch tolerance1516 then utilized Cas-OFFinder,17 an online user-friendly software for mismatch off-target predictions, which identified 18, 12, and 22 potential off-target sites (OTSs) for gRNA1, gRNA2, and
Table 1 CCR5-targeting gRNAs and potential off-target sites
gRNAs gRNA1 gRNA2 gRNA3
Position in CDSa 30-52 548-570 582-604
Sequences of gRNAs TGACATCAATTATTATACATCGG CATACAGTCAGTATCAATTCTGG GACATTAAAGATAGTCATCTTGG
Sequences of potential TGACATCAcTTATTATgCATgGG KCNJ6 gATACAGTCAGTgTCAcTTCaGG ZMAT1-1b GACAaTAAAGAaAGcCATCTTGG CNNM2 0TSd wrth gene name TGACATaAATTATTcTACATgGG CNTNAP2 gATACAGTCAGTgTCAcTTCaGG ZMAT1-2b
CATACAGgtAGTATtAATTCaGG B3GNTL1
_aATACAGTaAGTcTCAATTCaGG CEP85L_
PAM sequences are displayed with underlines. OTS, off-target sites; PAM, protospacer-adjacent motif.
'Position 1 is the first nucleotide of the start codon, ATG. bThe exact same sequence is found from two location in exon 7 of the ZMAT1 gene, and numbers were designated arbitrarily to distinguish two regions.
CCR5-CDS
"•^gtccaatctaTGACATCAATTATTATACATCGGagccctgcca"
# Clones assayed # (%) Total mutant clones # (%) Biallelic mutant clones among total mutant clones
288 36 (12.5) 8 (22.2)
^ ^ ^ x / .0 .0 .0 Jb J2>
cf cf </
343 bp 290 bp
AATCTATGACATCAATTATTATACAT££SAGCCCTGCCAAAA WT
AATCTATGACATCAATTATTATrGATCSSAGCCCTGCCAAAA Sub2 (Stop Codon)
AATCTATGACATCAATTATTATA ATCGGAGCCCTGCCAAAA DeM
AATCTATGACATCAATTATTAT CGGAGCCCTGCCAAAA Del4
AATCTATGACATCAATT ATfifiSAGCCCTGCCAAAA Del7
AATCTATGACATC CATCGGAGCCCTGCCAAAA Del 10
AATCTATGACATCA GCCCTGCCAAAA Del 16
AATCTATGACATCAATTATT AAA Del 19
TRA-1-81
Endoderm and ectoderm
II II SI
ilt? 2H tlft && A* ** fit »H §u C-
Mesoderm and ectoderm
K * •r
Figure 1 Generation of CCR5-mut iPSC cell lines using single gRNA. (a) Schematic diagram of the target site of the gRNA1 in CCR5 gene. Protospacer-adjacent motif sequence is written in bold, and the target sequence of gRNA1 is underlined. (b) Detection of gRNA1/ Cas9-promoted CCR5 gene alterations. Surveyor nuclease assay was used to detect mutations caused by gRNA1/Cas9 system. The exact sequence of the CCR5 mutation was determined by direct sequencing of multiple individual bacterial colonies transformed with T vector with subcloned PCR product from the indicated iPSC lines. (c) Editing efficiency of single gRNA/Cas9. (d) Flow cytometric analysis of CCR5-mut iPSCs established following single cell sorting. Plots depict isotype control (open) and specific antibody (gray) histograms. (e) Teratoma assay shows derivatives of all three germ layers. C, cartilage; ML, melanocytes, NE, rosettes of neural epithelium; PA, pancreatic acininar cells. (f) Karyotype of CCR5-mut iPSCs.
gRNA3, respectively. Among the OTSs theoretically possible within the genome, several OTSs were chosen for evaluation based on their potential impact on physical genomic positions, such as potential promoter, exon, and intron disruptions (Table 1). However, utilizing the Surveyor nuclease assay to identify potential OTSs mutations, we failed to identify genomic alterations at the OTSs selected for evaluation (Figure 3). Although genomic alterations were not identified in our limited study, further studies utilizing full genomic
sequencing are warranted to evaluate potential off-target genomic alterations. As reported, in vitro cleavage and deep sequencing was able to identify off-target cutting by gRNA,18 which was not detected using T7E1 assay in prior studies.8
Hematopoietic differentiation of CCR5mut-iPSCs
To determine whether iPSCs with an altered CCR5 gene retain the capacity to differentiate into the blood cells, we evaluated the hematopoietic differentiation efficacy of
Comb1-SC8
Comb2-SC1
■JctcattttcCATACAGTCAGTATCAATTCTGGaaaaatttcc--
gRNA2 ""
gRNAI ±
517 nt
—I ' CCR5-CDS I—
^ 551 nt ___ ___
__--" ~"~gRNA3----
•agaatttccaGACATTAAAGATAGTCATCTTGGggctggtcct"
C?> O?» O?» O?» O?» O?» O?» O?»
c>° Ö*3
1,200 bp 1,000 bp
500 bp
gRNA combination # clones assayed # (%) total mutant clones # (%) biallelic mutant clones among total mutant clones
Comb1 gRNA1/2 120 37 (30.8) 15 (40.5)
Comb2 gRNA1/3 120 28 (23.3) 12 (42.8)
V H (i ïî ic
Ectoderm
Mesoderm and endoderm
18 « 6 à - Ï-T - Zr S3 7 A à u 8 0 .
ti 13 il ' 14 H 15
ç c- 19 S <f 20
II 1Ê
Sa I»
10 11 12
te a* Ss
Figure 2 Generation of CCR5-mut iPSC cell lines using two gRNAs. (a) Schematic diagram of the CCR5genomic target sites and genetic distances of the combinatorial gRNAs; combination 1 (Combl) is gRNAI and gRNA2, and Comb2 is gRNAI and gRNA3. (b) Detection of large deletion caused by dual gRNAs/Cas9 cleavage. Genomic DNA-PCR analysis shows unaffected (1,265 bp), monoallelic (1,265 and 736 bp), and biallelic deletion (736 bp) of genomic alterations in clones isolated after transfection with Comb2-dual gRNAs/Cas9 plasmids. Representative eight clones out of 120 clones obtained from dual gRNAs targeting are shown. (c) Editing efficiency of dual gRNA/Cas9. (d) Flow cytometric analysis of CCR5-mut iPSCs established following single cell isolation. Plots depict isotype control (open) and specific antibody (gray) histograms. (e) Teratoma assay shows derivatives of all three germ layers. C, cartilage; ML, melanocytes; nE, rosettes of neural epithelium; rE, respiratory epithelium. (f) Karyotype of CCR5-mut iPSCs.
generated iPSC lines in coculture with OP9 stroma.1920 As shown in Figure 4, CCR5mut-iPSCs generated CD34+CD43+ hematopoietic progenitors with efficiency similar to that of paternal GFP-iPSCs (Figure 4a). Established cell lines also showed comparable clonogenic potential regardless of
whether single or dual gRNA was used for genomic disruption (Figure 4b). Using a protocol established in our lab,2122 we generated macrophages from all cell lines for phenotypic evaluation. As shown in Figure 4c,d, macrophages obtained from both lines displayed typical macrophage morphology
¡5¡s ¡ S"? S"? !
+ I OO OO i
+ 1 n'm n'm .
£Z £Z LL n LL n I O o u_!¿ U_!¿ I
O O Ç3 <Gf 1
CNTNAP2
O O CÛ N N
GFP-CCR5mut-hiPSC-Comb1-SC8
GFP-CCR5mut-hiPSC-Comb2-SC1
Figure 3 Surveyor nuclease assay for potential off-target mutation in selected CCR5-mut iPSC clones. Several genomic off-target sites were predicted by Cas-OFFinder, online software; the Surveyor nuclease assay shows no off-target genomic alterations during the gRNA/Cas9-mediated CCR5 editing. (a) Two predicted OTSs for gRNA1. (b) Four predicted OTSs for gRNA2. (c) One predicted OTSs for gRNA3. Con+: amplified DNA fragment mixture with only single base substitution provided by Surveyor Mutation Detection Kit (Transgenomics), Con-: amplified DNA product from parental GFP-iPSC cell line.
and expressed markers associated with macrophages, CD4, CD45, HLA-DR, and CD14, while retaining GFP expression.
Selective resistance of CCR5mut macrophages to CCR5 tropic HIV-1
The aim of our study was to generate CCR5-gene disrupted iPSCs that when differentiated to hematopoietic cells would be resistant to CCR5-tropic HIV infection. Macrophages obtained from GFP-CCR5mut-hiPSC-SC7 and GFP-CCR5mut-hiPSC-SC8 lines (generated using single gRNA) or GFP-CCR5mut-hiPSC-Comb1-SC8 and GFP-CCR5mut-hiPSC-Comb2-SC1 (generated using dual combination gRNAs) were challenged with the HIV-1 R5-tropic isolates BaL-1 and SF162 at relatively high amounts, 350-400 pg/ culture, to evaluate protection from infection. To control for HIV-1 specificity, the X4-tropic isolates, LAI and NL4-3, were utilized. Post exposure to HIV, supernatants were collected for up to 20 days and evaluated for viral infection and replication by determination of p24 amounts. As shown in Figure 5, R5-tropic virus replication, as judged by p24 production, was observed in parental macrophages after viral exposure within 3 days. In contrast, macrophages derived from the four iPSCs lines with CCR5 gene alterations did not demonstrate detectable p24 activity (assay sensitivity to 10 pg/ml p24) postexposure to either CCR5-tropic HIV isolate (Figure 5a,b). However, macrophages from all iPSC lines, irrespective of CCR5 alterations, exposed to the X4-tropic viruses LAI and
NL4-3 demonstrated fulminating viral infections within 3 days (Figure 5c,d). Taken together, these results demonstrate that CCR5-gene disrupted macrophages successfully generated from CCR5 gene altered iPSCs were protected from CCR5-tropic HIV-1 challenge.
Discussion
Genetic modification of iPSCs is an attractive strategy to produce gene-corrected and gene-modified cells for research and clinical purposes. In the context of generating methodology and lines for clinical studies, it is imperative to precisely modify the desired cellular genomic site without any accompanying off-target alteration(s) in the genome that might promote harmful effects. Even at low rates, off-target alterations in rare cells are transmissible to progeny and may hinder cell survival, proliferation, and differentiation and could lead to a growth advantage and eventual malignant transformation. Genome editing in iPSCs allows the opportunity to significantly reduce or eliminate risks associated with offtarget mutations; iPSCs, in contrast to hematopoietic stem and many progenitor cells isolated from individuals, can be cloned and expanded after genetic modification and thoroughly analyzed for genomic integrity, which may be necessary for therapeutic applications.
Several studies have reported successful CCR5 modification in human cells using TALENs,23-25 ZFNs,26 and CRISPR/ Cas9.6,811,2728 With regard to strategies for genomic modification, the CRISPR/Cas9 system is convenient, flexible, and more readily produced than TALEN and ZFN, since it utilizes a fixed nuclease and requires the design of only 20-nt sequence-matching gRNAs. Moreover, CRISPRs/Cas9 do not necessitate de novo engineering of proteins for each genomic target, as do TALENs and ZFNs, thereby making it easier for multiplex genome engineering.29 It has also been reported that the CRISPR/Cas9 system can provide a high specificity of genomic editing and low off-target effects.30-32
In this study, single or dual gRNA-guided Cas9 systems were employed to target and edit the CCR5 gene in iPSCs. When a single gRNA was used, the editing efficiency was 12.5%. This efficiency is comparable to that of Cho et al., 10-18%, where the same gRNA, gRNAI, was used to target the genome in HEK293T cells.8 Ye et al.6 showed a much higher editing efficiency of CCR5 in hiPSCs, 25%, which may be attributed to the small number of clones analyzed or the different sequence of gRNA used, given targeting efficiency is mostly gRNA specific.33
Our findings demonstrate that a dual gRNA approach resulted in at least double the CCR5-editing activity in hiP-SCs of a single gRNA, thereby implying that the use of dual gRNA has superior editing activity when compared to single gRNA. Our results are consistent with several studies that have reported the use of dual gRNAs resulting in higher editing efficiency in the mouse embryo,12 HEK293 and HCT116 cells9, primary human CD4+ T cells, and CD34+ hematopoietic stem and progenitor cells,11 as well as Caenorhabditis elegans.34 Importantly, the use of dual gRNAs yielded a much higher frequency of biallelic mutations (Figures 1c and 2c). Also, while the single gRNA elicited random insertions or
16.5 10.7
73.1 2.92
5.81 : 'it' 18.2
30 n CD43+ hematopoietic progenitor
J? <b <b <b <b
883H E
■ ' •
• • , .
o° o°
Figure 4 Hematopoietic differentiation and generation of macrophages from CCR5mut iPSCs. (a) Multipotent hematopoietic progenitors generated from parental and CCR5mut-hiPSCs. No significant differences were observed in the hematopoietic differentiation efficiency of parental and CCR5mut-hiPSCs. SC7, GFP-CCR5mut-SC7-; SC8, GFP-CCR5mut-SC8-; Comb1-SC8, GFP-CCR5mut Comb1-SC8-; Comb2-SC1, GFP-CCR5mut-Comb2-SC1-derived CD43+ hematopoietic progenitors. (b) Colony-forming potential of hematopoietic progenitors generated from parental and CCR5mut-hiPSCs. (c) Morphology of macrophages generated from parental and CCR5mut-hiPSCs. (d) Flow cytometric analysis of macrophage-specific markers and GFP expression in macrophages generated from parental and CCR5mut-hiPSCs. From the top row, parental-, GFP-CCR5mut-SC7-, GFP-CCR5mut-SC8-, GFP-CCR5mut-Comb1-SC8-, GFP-CCR5mut-Comb2-SC1-derived macrophages. Plots depict isotype control (open) and specific antibody (gray) histograms.
R8-BaL
GFP-parental «- GFP-CCR5mut-SC7 ■A- GFP-CCR5mut-SC8
GFP-CCR5mut-Comb1-SC8 GFP-CCR5mut-Comb2-SC1
Days post-infection with R8-BaL
GFP-parental 4- GFP-CCR5mut-SC8 ■- GFP-CCR5mut-SC7 • - GFP-CCR5mut-Comb1-SC8 GFP-CCR5mut-Comb2-SC1
------
Days post-infection with SF162
GFP-parental
GFP-CCR5mut-SC7
GFP-CCR5mut-SC8
GFP-CCR5mut-Comb1-SC8
GFP-CCR5mut-Comb2-SC1
Days post-infection with LAI
1,400 1,200 1,000 J= 800
400 200 0
GFP-parental
GFP-CCR5mut-SC7
GFP-CCR5mut-SC8
GFP-CCR5mut-Comb1-SC8
GFP-CCR5mut-Comb2-SC1
Days post-infection with NL4-3
Figure 5 HIV challenge of iPSC derived CCR5mut macrophages. Macrophages derived from the parental and CCR5mut iPSC-derived macrophages were challenged with (a) A R5-tropic R8-Bal (three independent experiments), (b) a R5-tropic SF162 (two independent experiments), (c) A X4-tropic LAI (two independent experiments), or (d) A X4-tropic NL4-3 (two independent experiments) HIV-1. On the designated days post-infection, supernatants were collected and analyzed for p24 antigen by an enzyme-linked immunosorbent assay.
deletions among the clones evaluated, the same combination of dual gRNAs gave rise to the same size deletions in all of the clones analyzed, as predicated with the cleavage at 3-nt upstream from the protospacer-adjacent motif sequence.14
Given the lack of knowledge concerning the significant phenotypic consequences of CCR5 defects, preclinical studies and clinical trials were initiated to disrupt CCR5 function in human primary CD34+ hematopoietic stem and progenitor cells,11 35-38 primary CD4+ T cells,1126 and human iPSCs.639 These published studies confirmed the successful generation of HIV-1-resistant immune cells following disruption of CCR5 gene function by various genetic methodologies. However, the incomplete protection from HIV-1 infection using shRNA-mediated knockdown strategy,37,39 the potential for mutagenesis from integrated viral vectors required for constitutive shRNA expression for knockdown function,3739 loss of HSPCs engraftment potential due to transduction toxicity,40 concerns about the competitive disadvantage of transduced cells,11 2635 and the potential off-target damage by ZFNs263641 all remain central issues that must be resolved to advance the translation of genome-modified autologous stem cell therapy to the clinic.
In this study, we have shown that genomic editing of the CCR5 gene does not alter pluripotency or hematopoietic
differentiation of iPSCs, consistent with the published reports that genetic alterations within the CCR5 locus presumably have no significant effect on the cellular development in humans, macaques, and mice.24243 We have found that macrophages from both wild and CCR5mut iPSCs remained susceptible to infection with X4-tropic HIV-1 virus. Macrophages derived from wild-type iPSCs were susceptible to R5-tropic virus, whereas macrophages from all CCR5mut cells were resistant to CCR5 viral challenge. This protective effect was observed in macrophages from all CCR5mut iPSCs regardless of nt deletion amounts, indicating that even small disruptions within the CCR5 gene are sufficient to provide HIV resistance.
In summary, our study demonstrates that the CCR5 gene editing can be successfully and efficiently accomplished in hiPSCs. Importantly, we demonstrated that clonal selection could be applied to iPSCs to ensure homogeneity of CRISPR/ Cas9 genomic editing and potentially to eliminate clones with deleterious off-target effects. The macrophages derived from the CCR5mut-hiPSCs are resistant to HIV-1 CCR5-tropic viruses, thus implying that hematopoietic stem cells derived from the iPSCs are useful for continued studies for translation to HIV patient therapy. In this context, the generation of CCR5mut-hiPSCs in the background of GFP-marked cells
in our studies will facilitate the assessment of CCR5mut hematopoietic cells in appropriate animal models for future studies. Although a naturally occurring CCR5 mutation protects humans from HIV infection, the lack of CCR5 is also associated with an increased susceptibility to West Nile Virus infection,44 and other infections, including Toxoplasma gondii, Mycobacterium tuberculosis, Herpes Simplex Virus, Trypanosoma cruzi, Cryptococcus neoformans, Chlamydia trachomatis, Listeria, and Plasmodium (reviewed in ref. 45). Thus, since CCR5mut-hiPSC lines can produce unlimited numbers of CCR5-deficient hematopoietic and immune cells, our stable lines, and the CRISPR/Cas9 methodology, will be useful for interrogating the role of CCR5 not only in HIV pathogenesis, but in other infectious diseases as well.
Materials and Methods
iPSC culture and generation of GFP-marked iPSCs. In this study, we used the transgene-free human iPSC cell line DF19-9-7T, which was obtained using episomal vectors.7 iPSCs were maintained on mouse embryonic fibroblasts (MEFs) or Matrigel as previously described.746 The clover GFP-targeting vector was generated by PCR amplification from the pcDNA3-Clover (Addgene plasmid 40259), and the fragment was subsequently inserted into the XbaI and NheI sites of the pRMCE-EF1 vector. In addition, an antibiotics-resistant cassette T2A-puromycin was inserted into NheI and MluI sites of pRMCE-EF1-Clover GFP vector. iPSCs growing on Matrigel were detached by using TrypLE (Life Technologies, Grand Island, NY) for 6 minutes and were washed with mTeSR1 (StemCell Technologies, Vancouver, Canada) culture medium. 1x 106 cells were resuspended in 100 pl Amaxa Human Stem Cell Nucleofector Kit 2 reagent (Lonza, Basel, Switzerland). After addition of 3 pg DNA, iPSCs were exposed to a single pulse (B16 program for human stem cells) using Amaxa Nucleofector II (Lonza). The electropor-ated cells were resuspended with mTeSR1 culture medium supplemented with 10 pmol/l of Y-27632 Rho kinase inhibitor (ROCKi; Tocris, Bristol, UK), plated in a six-well plate on Matrigel and cultured in mTeSR1 growth medium. Puromycin selection (1 pg/ml; Sigma-Aldrich, St Louis, MO) was started 3 days after electroporation. After 10-14 days, 20 GFP-pos-itive surviving colonies were picked and expanded in each well of a 12-well plate. Following analysis of hematopoietic differentiation, two clones with constitutive GFP expression at all stages of differentiation, including mature macrophages, were selected for further studies.
Construction of CCR5-targeting vectors and generation of CCR5-mutant iPSCs. JDS246 coding mammalian codon-optimized Cas9 and MLM3636 containing the U6 promoter and tracrDNA were acquired from Addgene (Addgene plas-mids 43861 and 43860 from Keith Joung). With a general rule for designing gRNA,47 two gRNA sequences were manually searched and designed for target sequences near the delta 32 region, while one gRNA from Cho et a/.'s report was used.8 These gRNAs were PCR amplified and then inserted downstream of U6 polymerase III promoter in MLM3636. iPSCs growing on Matrigel in mTeSR1 medium with 10 pmol/l
ROCKi were detached 1 hour prior to nucleofection by TrypLE Select (Life Technologies, Grand Island, NY) and singlized by pipetting. 5 x 105 of the singlized cells were resuspended in 100 pl of Human Stem Cell Nucleofector Solution 1 containing 18 pl Supplement 1 solution and 15 pg of Cas9 and 2.5 pg of single gRNA or 5.0 pg of one of the combination of two gRNAs and transfected according to manufacturer's instruction (Lonza). After transfection, cells were replated onto a Matrigel-coated six-well plate with mTeSR1 containing 10 pmol/l ROCKi and placed in an incubator at 37 °C with 5% CO2. Fresh mTeSR1 (WiCell, Madison, WI) medium was provided every day. Four to five days later, colonies were picked up and expanded. To select CCR5-mut iPSC clones, genomic DNA from the iPSC colonies was extracted using Quick-DNA Universal Kit (Zymo Research, Irvine, CA) and assayed by Surveyor nuclease assay (Transgenomic, Omaha, NE) with single gRNA-targeted clones and PCR with dual gRNA-tar-geted clones. To identify and confirm the biallelic mutations from the selected mutant clones, PCR products containing the target region from each CCR5-mut iPSC were cloned into T vectors (Promega, Madison, WI) and transformed into bacteria. T vectors from at least four bacterial colonies for each CCR5-mut iPSC line were sequenced. Selected CCR5mut-iPSCs were single cell sorted using FASCAria to ensure the derivation of iPSCs with homogenous genetic mutations within the CCR5 locus and then expanded on MEFs. To confirm pluripotency, cell surface staining was performed with anti-SSEA4 (Stemgent, Cambridge, MA) and anti-TRA-1-81 (Stemgent, MA) antibodies, and with antibodies against plu-ripotent factors, OCT4, NANOG, and SOX2 (all from BD Biosciences, Franklin Lakes, NJ). For intracellular staining, cells were fixed and permeated using Cytofix buffer and cold Perm Buffer III (both from BD Bioscience), respectively, according the manufacturer's instruction. After being washed, cells were stained with anti-OCT4, anti-NANOG, and anti-SOX2 and then analyzed by flow cytometry.
Hematopoietic differentiation of iPSCs and generation of macrophages. To induce hematopoietic differentiation, iPSCs maintained on MEFs were collected and co-cultured with OP9, as previously described in detail.48 Flow cytometry was used to analyze the generation of the CD34+CD43+ hematopoietic progenitors. Colony-forming potential of the generated hematopoietic progenitors was tested in MethoCult GF+ complete methylcellulose medium with fetal bovine serum and hematopoietic cytokines (SCF, G-CSF, GM-CSF, IL-3, IL-6, and EPO; StemCell Technologies, Vancouver, Canada). Subsequently, iPSC-derived hematopoietic progenitors were differentiated into macrophages following exposure to M-CSF (Shenan-doah Biotechnology, Warwick, PA) and IL-1P (Shenandoah Biotechnology), as described previously.21 Generated macrophages were evaluated by flow cytometry using CD4, CD45, HLA-DR, and CD14 antibodies (BD Biosciences).
Off-target analysis. Cas-OFFinder17 was employed to find potential OTSs with limitation of three-base mismatched sequences. From the resulting off-targets, OTSs only in gene-coding regions were selected and Surveyor nuclease assayed (Surveyor Mutation Detection Kit; Transgenomics).
Karyotyping and teratoma assay. Karyotypes from the CCR5mut-iPSC colonies were tested by standard G-banded and SKY spectral karyptyping.49 For teratoma formation, CCR5mut-iPSCs were harvested from days 3-5 of MEF feeder culture and resuspended with 100 pl of 30% Matrigel in DMEM/F12 basal media. The cells were injected s.c. into the hind leg of NOD.Cg-PrkdcscidIl2rgtm1wjl/SzJ mice (The Jackson Laboratory, Bar Harbor, ME) and teratomas formed were collected at 8-12 weeks.
HIV-1 challenge of iPSC-derivedmacrophages. iPSC-derived macrophages were seeded at a density of 4 x 104 cells per 48-well plate the day before infection. The cells were infected with 350-400 pg of R5-tropic viruses BaL-1 or SF162 or X4-tropic viruses LAI or NL4-3 for 6 hours in the presence of 6 pg/ml polybrene. Cells were washed intensively with media and cultured for the desired time. On various days postinfection, tissue culture supernatants were collected and supernatants taken on days 0, 3, 7, and 10 were analyzed for p24 with an HIV antigen enzyme-linked immunosorbent assay kit (AbLinc, Rockville, MD) according to the manufactures instructions. Experiments were performed in triplicate, BaL-1, or duplicate SF-162, LAI, or NL4-3.
Supplementary Material
Figure S1. Establishment of GFP-expressing hiPSC line and
its hematopoietic differentiation.
Figure S2. Validation of mutations in CCR5 gene.
Acknowledgments. We thank Mitchell Probasco for cell sorting, T. Nakano for providing the OP9 bone marrow stromal cell line, and Mathew Raymond for editorial assistance. This work was supported by funds from the National Institute of Health (R01HL116221, U01HL099773, P510D011106, and P30AI036214) and The Charlotte Geyer Foundation.
H.K. generated and characterized CCR5-mut iPSCs, analyzed their hematopoietic differentiation potential, produced macrophages, interpreted experimental data, made figures, and contributed to paper writing; P.M. performed HIV infection studies; M.A.P. generated GFP-iPSC line. W.-T.M. assisted in hematopoietic differentiation of iPSCs and macrophage production. B.E.T. and I.S. developed the concept, led and supervised studies, analyzed and interpreted data, and wrote the manuscript.
I. Samson, M, Labbe, O, Mollereau, C, Vassart, G and Parmentier, M (1996). Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Biochemistry 35: 3362-3367.
2. Broder, CC and Collman, RG (1997). Chemokine receptors and HIV. J Leukoc Biol62: 20-29.
3. Allers, K, Hutter, G, Hofmann, J, Loddenkemper, C, Rieger, K, Thiel, E et al. (2011). Evidence for the cure of HIV infection by CCR5a32/a32 stem cell transplantation. Blood 117: 2791-2799.
4. Hutter, G, Nowak, D, Mossner, M, Ganepola, S, Mussig, A, Allers, K et al. (2009). Long-term control of HIV by CCR5 Delta32/Delta32 stem-cell transplantation. N Engl J Med 360: 692-698.
5. Yao, Y, Nashun, B, Zhou, T, Qin, L, Qin, L, Zhao, S et al. (2012). Generation of CD34+ cells from CCR5-disrupted human embryonic and induced pluripotent stem cells. Hum Gene Ther 23: 238-242.
6. Ye, L, Wang, J, Beyer, AI, Teque, F, Cradick, TJ, Qi, Z et al. (2014). Seamless modification of wild-type induced pluripotent stem cells to the natural CCR5a32 mutation confers resistance to HIV infection. Proc Natl Acad Sci USA 111: 9591-9596.
7. Yu, J, Hu, K, Smuga-Otto, K, Tlan, S, Stewart, R, Slukvin, II et al. (2009). Human Induced pluripotent stem cells free of vector and transgene sequences. Science 324: 797-801.
8. Cho, SW, Kim, S, Kim, JM and Kim, JS (2013). Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31: 230-232.
9. Ho, TT, Zhou, N, Huang, J, Koirala, P Xu, M, Fung, R et al. (2015). Targeting non-coding RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43: e17.
10. Li, JF, Zhang, D and Sheen, J (2015). Targeted plant genome editing via the CRISPR/Cas9 technology. Methods Mol Biol 1284: 239-255.
11. Mandal, PK, Ferreira, LM, Collins, R, Meissner, TB, Boutwell, CL, Friesen, M et al. (2014). Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/ Cas9. Cell Stem Cell 15: 643-652.
12. Zhou, J, Wang, J, Shen, B, Chen, L, Su, Y Yang, J et al. (2014). Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. FEBS J281: 1717-1725.
13. Sander, JD and Joung, JK (2014). CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol32: 347-355.
14. Jinek, M, Chylinski, K, Fonfara, I, Hauer, M, Doudna, JA and Charpentier, E (2012).
A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337: 816-821.
15. Lin, Y Cradick, TJ, Brown, MT, Deshmukh, H, Ranjan, P Sarode, N et al. (2014). CRISPR/ Cas9 systems have off-target activity with insertions or deletions between target DNA and guide RNA sequences. Nucleic Acids Res 42: 7473-7485.
16. Wu, X, Scott, DA, Kriz, AJ, Chiu, AC, Hsu, PD, Dadon, DB et al. (2014). Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat Biotechnol32: 670-676.
17. Bae, S, Park, J and Kim, JS (2014). Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30: 1473-1475.
18. Cho, SW, Kim, S, Kim, Y, Kweon, J, Kim, HS, Bae, S et al. (2014). Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res 24: 132-141.
19. Choi, KD, Yu, J, Smuga-Otto, K, Salvagiotto, G, Rehrauer, W, Vodyanik, M et al. (2009). Hematopoietic and endothelial differentiation of human induced pluripotent stem cells. Stem Cells 27: 559-567.
20. Vodyanik, MA, Bork, JA, Thomson, JA and Slukvin, II (2005). Human embryonic stem cell-derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and analysis of lymphohematopoietic potential. Blood 105: 617-626.
21. Choi, KD, Vodyanik, M and Slukvin, II (2011). Hematopoietic differentiation and production of mature myeloid cells from human pluripotent stem cells. Nat Protoc 6: 296-313.
22. Choi, KD, Vodyanik, MA and Slukvin, II (2009). Generation of mature human myelomonocytic cells through expansion and differentiation of pluripotent stem cell-derived lin-CD34+CD43+CD45+ progenitors. J Clin Invest 119: 2818-2829.
23. Mock, U, Machowicz, R, Hauber, I, Horn, S, Abramowski, P Berdien, B et al. (2015). mRNA transfection of a novel TAL effector nuclease (TALEN) facilitates efficient knockout of HIV co-receptor CCR5. Nucleic Acids Res 43: 5560-5571.
24. Mussolino, C, Alzubi, J, Fine, EJ, Morbitzer, R, Cradick, TJ, Lahaye, T et al. (2014). TALENs facilitate targeted genome editing in human cells with high specificity and low cytotoxicity. Nucleic Acids Res 42: 6762-6773.
25. Miller, JC, Tan, S, Qiao, G, Barlow, KA, Wang, J, Xia, DF et al. (2011). A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29: 143-148.
26. Tebas, P Stein, D, Tang, WW, Frank, I, Wang, SQ, Lee, G et al. (2014). Gene editing of CCR5 in autologous CD4 T cells of persons infected with HIV. N Engl J Med 370: 901-910.
27. Li, C, Guan, X, Du, T, Jin, W, Wu, B, Liu, Y et al. (2015). Inhibition of HIV-1 infection of primary CD4+ T-cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9. J Gen Virol96: 2381-2393.
28. Fine, EJ, Appleton, CM, White, DE, Brown, MT, Deshmukh, H, Kemp, ML et al. (2015). Trans-spliced Cas9 allows cleavage of HBB and CCR5 genes in human cells using compact expression cassettes. Sci Rep 5: 10777.
29. Cong, L, Ran, FA, Cox, D, Lin, S, Barretto, R, Habib, N et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819-823.
30. Smith, C, Gore, A, Yan, W, Abalde-Atristain, L, Li, Z, He, C et al. (2014). Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs. Cell Stem Cell 15: 12-13.
31. Suzuki, K, Yu, C, Qu, J, Li, M, Yao, X, Yuan, T et al. (2014). Targeted gene correction minimally impacts whole-genome mutational load in human-disease-specific induced pluripotent stem cell clones. Cell Stem Cell 15: 31-36.
32. Veres, A, Gosis, BS, Ding, Q, Collins, R, Ragavendran, A, Brand, H et al. (2014). Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing. Cell Stem Cell 15: 27-30.
33. Hsu, PD, Scott, DA, Weinstein, JA, Ran, FA, Konermann, S, Agarwala, V et al. (2013). DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31: 827-832.
34. Chen, X, Xu, F, Zhu, C, Ji, J, Zhou, X, Feng, X et al. (2014). Dual sgRNA-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans. Sci Rep 4: 7581.
35. Holt, N, Wang, J, Kim, K, Friedman, G, Wang, X, Taupin, V et al. (2010). Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo. Nat Biotechnol 28: 839-847.
36. Li, L, Krymskaya, L, Wang, J, Henley, J, Rao, A, Cao, LF et al. (2013). Genomic editing of the HIV-1 coreceptor CCR5 in adult hematopoietic stem and progenitor cells using zinc finger nucleases. Mol Ther 21: 1259-1269.
37. Liang, M, Kamata, M, Chen, KN, Pariente, N, An, DS and Chen, IS (2010). Inhibition of HIV-1 infection by a unique short hairpin RNA to chemokine receptor 5 delivered into macrophages through hematopoietic progenitor cell transduction. J Gene Med 12: 255-265.
38. Wang, W, Ye, C, Liu, J, Zhang, D, Kimata, JT and Zhou, P (2014). CCR5 gene disruption via lentiviral vectors expressing Cas9 and single guided RNA renders cells resistant to HIV-1 infection. PLoS One 9: e115987.
39. Kambal, A, Mitchell, G, Cary, W, Gruenloh, W, Jung, Y, Kalomoiris, S et al. (2011). Generation of HIV-1 resistant and functional macrophages from hematopoietic stem cell-derived induced pluripotent stem cells. Mol Ther 19: 584-593.
40. Hollis, RP Nightingale, SJ, Wang, X, Pepper, KA, Yu, XJ, Barsky, L et al. (2006). Stable gene transfer to human CD34(+) hematopoietic cells using the Sleeping Beauty transposon. Exp Hematol34: 1333-1343.
41. Pattanayak, V, Ramirez, CL, Joung, JK and Liu, DR (2011). Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection. Nat Methods 8: 765-770.
42. Kuziel, WA, Dawson, TC, Quinones, M, Garavito, E, Chenaux, G, Ahuja, SS et al. (2003). CCR5 deficiency is not protective in the early stages of atherogenesis in apoE knockout mice. Atherosclerosis 167: 25-32.
43. Chen, Z, Kwon, D, Jin, Z, Monard, S, Telfer, P Jones, MS et al. (1998). Natural infection of a homozygous delta24 CCR5 red-capped mangabey with an R2b-tropic simian immunodeficiency virus. J Exp Med 188: 2057-2065.
44. Lim, JK, Louie, CY Glaser, C, Jean, C, Johnson, B, Johnson, H et al. (2008). Genetic deficiency of chemokine receptor CCR5 is a strong risk factor for symptomatic West Nile virus infection: a meta-analysis of 4 cohorts in the US epidemic. J Infect Dis 197: 262-265.
45. Telenti, A (2009). Safety concerns about CCR5 as an antiviral target. Curr Opin HIV AIDS 4: 131-135.
46. Amit, M, Carpenter, MK, Inokuma, MS, Chiu, CP Harris, CP Waknitz, MA et al. (2000). Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 227: 271-278.
47. Mali, P Yang, L, Esvelt, KM, Aach, J, Guell, M, DiCarlo, JE et al. (2013). RNA-guided human genome engineering via Cas9. Science 339: 823-826.
48. Vodyanik, MA and Slukvin, II (2007). Hematoendothelial differentiation of human embryonic stem cells. Curr Protoc Cell Biol Chapter 23: Unit 23.6.
49. Schröck, E, du Manoir, S, Veldman, T, Schoell, B, Wienberg, J, Ferguson-Smith, MA et al. (1996). Multicolor spectral karyotyping of human chromosomes. Science 273: 494-497.
l6x)®@®l This work is licensed under a Creative Commons K-a«»1» Attribution-NonCommercial-ShareAlike 4.0 International License. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/
Supplementary Information accompanies this paper on the Molecular Therapy-Nucleic Acids website (http://www.nature.com/mtna)
