Scholarly article on topic 'Acute salinity and temperature challenges during early development of zebrafish: Differential gene expression of PTHs, PTHrPs and their receptors'

Acute salinity and temperature challenges during early development of zebrafish: Differential gene expression of PTHs, PTHrPs and their receptors Academic research paper on "Biological sciences"

CC BY
0
0
Share paper
Academic journal
Aquaculture and Fisheries
OECD Field of science
Keywords
{"Parathyroid hormone" / Zebrafish / Development / Salinity / Temperature}

Abstract of research paper on Biological sciences, author of scientific article — Yingying Jin, Zhaohui Lan, Gege Zhu, Weiqun Lu

Abstract Parathyroid hormone (pth), parathyroid hormone-related peptide (pthrp) and their receptors are involved in the regulation of calcium homeostasis in all vertebrates. To further understand the role of these genes in teleosts during development, we investigated the expression pattern of pth1, pth2, pthrp1, pthrp2, and their receptors pth1r, pth2r, pth3r, and their response to acute salinity and temperature challenge during early development of zebrafish, Danio rerio. The results revealed that pth1, pth2, pthrp1, pthrp2, pth1r, pth2r, pth3r were differentially expressed during early development, and pth1, pthrp1, pth1r, pth2r mRNA were detected from 0 hpf. pth2 and pth3r mRNA were detected after fertilization. Exposure of zebrafish embryos and larvae to acute osmotic (30) stress for 15 min failed to modify the expression levels of pthrp2 mRNA from levels in control fish. However, salinity challenge significantly (P < 0.01) modified pth1, pth2, pth3r at 3 dpf, pthrp1 (P < 0.01) and pth1r (P < 0.05) were both significantly modified at 5 dpf, and pth2r was significantly (P < 0.01) modified at 4 dpf and 5 dpf. Exposure of embryos and larvae to a cold (18 °C) stress generally up-regulated mRNA levels of pth1, pth2, pthrp1, pthrp2 and pth3r from 2 dpf to 5 dpf, while a hot (38 °C) stress generally down-regulated mRNA levels of these genes. After acute temperature challenge, expression levels of pth receptors were greatly influenced except pth2r. The results indicate that the contribution of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r genes to the stress response in zebrafish may be stressor-specific during early development. Overall, the results from this study provide a basis for further research into the developmental and stressor-specific role of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r in zebrafish.

Academic research paper on topic "Acute salinity and temperature challenges during early development of zebrafish: Differential gene expression of PTHs, PTHrPs and their receptors"

Aquaculture and Fisheries xxx (2017) 1—10

Contents lists available at ScienceDirect

Aquaculture and Fisheries

journal homepage: www.keaipublishing.com/en/journals/ aquaculture-and-fisheries/

Acute salinity and temperature challenges during early development of zebrafish: Differential gene expression of PTHs, PTHrPs and their receptors

Yingying Jin a'1, Zhaohui Lan a'1, Gege Zhu a'1, Weiqun Lu a'b' *

a College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China

b Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai 201306, China

ARTICLE INFO ABSTRACT

Parathyroid hormone (pth), parathyroid hormone-related peptide (pthrp) and their receptors are involved in the regulation of calcium homeostasis in all vertebrates. To further understand the role of these genes in teleosts during development, we investigated the expression pattern of pth1, pth2, pthrpl, pthrp2, and their receptors pth1r, pth2r, pth3r, and their response to acute salinity and temperature challenge during early development of zebrafish, Danio rerio. The results revealed that pth1, pth2, pthrp1, pthrp2, pth1r, pth2r, pth3r were differentially expressed during early development, and pth1, pthrp1, pth1r, pth2r mRNA were detected from 0 hpf. pth2 and pth3r mRNA were detected after fertilization. Exposure of zebrafish embryos and larvae to acute osmotic (30) stress for 15 min failed to modify the expression levels of pthrp2 mRNA from levels in control fish. However, salinity challenge significantly (P < 0.01) modified pth1, pth2, pth3r at 3 dpf, pthrpl (P < 0.01) and pthlr (P < 0.05) were both significantly modified at 5 dpf, and pth2r was significantly (P < 0.01) modified at 4 dpf and 5 dpf. Exposure of embryos and larvae to a cold (18 °C) stress generally up-regulated mRNA levels of pth1, pth2, pthrp1, pthrp2 and pth3r from 2 dpf to 5 dpf, while a hot (38 °C) stress generally down-regulated mRNA levels of these genes. After acute temperature challenge, expression levels of pth receptors were greatly influenced except pth2r. The results indicate that the contribution of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r genes to the stress response in zebrafish may be stressor-specific during early development. Overall, the results from this study provide a basis for further research into the developmental and stressor-specific role of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r in zebrafish.

© 2017 Shanghai Ocean University. Published by Elsevier B.V. This is an open access article under the CC

BY license (http://creativecommons.org/licenses/by/4.0/).

Article history: Received 7 February 2017 Received in revised form 5 April 2017 Accepted 7 April 2017 Available online xxx

Keywords:

Parathyroid hormone

Zebrafish

Development

Salinity

Temperature

1. Introduction

Parathyroid hormone (pth) and parathyroid hormone-related peptide (pthrp, alias pthlh, pth-like hormone) both belonging to the pth gene family (Gensure et al., 2004). In mammals, PTH, is secreted by the parathyroid gland and small amounts are also produced by the brain and thymus (Gunther et al., 2000). Even though teleost fish do not have parathyroid glands they have two pth genes (pthl and pth2) (Papasani et al., 2004; Hogan et al., 2005) that arose during the whole genome duplication at the base of teleost radiation (Postlethwait et al., 1998; Taylor, Braasch, Frickey,

* Corresponding author. College of Fisheries and Life Science, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai 201306, China. E-mail address: wqlv@shou.edu.cn (W. Lu).

1 These authors contributed equally to this work.

Meyer and Peer, 2003; Jaillon et al., 2004). PTH1, PTH2 and PTHrPl are encoded by separate genes and in the protein share a conserved N-terminal amino acid sequence, which is involved in receptor binding and activation (Rotllant et al., 2005; Rotllant et al., 2006). PTHrP2 only exists in non-mammalian tetrapods and fish (Canario et al., 2006; Pinheiro et al., 2010). While mammals have two pth receptors genes, pthlr and pth2r, zebrafish express an additional receptor, pth3r (Rubin & Juppner, 1999), which is encoded by a separate gene, closely related to pth1r. Homologues of pth, pthrp and their receptors have been identified in the CNS (central nervous system) and other tissues of mammals including human (Merendino, Insogna, Milstone, Broadus and Stewart, 1986, Weir et al., 1990, Weaver, Deeds, Lee and Segre, 1995, Wysolmerski & Stewart, 1998; Bago & Dimitrov, 2009). In fish, genes of the pth family have a widespread distribution in the brain and many other tissues (Guerreiro, Renfro, Power and Canario, 2007) including the

http://dx.doi.org/10.1016/j.aaf.2017.04.001

2468-550X/© 2017 Shanghai Ocean University. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativec0mm0ns.0rg/licenses/by/4.0/).

2 Y Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

caudal neurosecretory system (CNSS) (Ingleton, Bendell, Flanagan, Teitsma and Balment, 2002). PTH and PTHrP interact with and activate G-protein-coupled receptors (GPCRs), PTH1R, PTH2R and PTH3R (Rubin & Juppner, 1999). PTH1 can activate all three zebra-fish receptors while PTH2 preferentially activates zebrafish and mammalian PTH2R (Usdin, Hoare, Wang, Mezey,. and Kowalak, 1999; Papasani et al., 2004). In mammals, PTH is an endocrine hormone comprised of 84 amino acids and has a central role in the regulation of serum calcium (Brown, 1999), whereas PTHrP is essential for chondrocyte differentiation and proliferation, breast development, tooth eruption, and cardiac development (Kronenberg, 2003). In fish, both of PTH and PTHrP participate in calcium balance (Abbink et al., 2006; Fuentes, Figueiredo, Power and Canario, 2006), phosphorus handling (Guerreiro et al., 2007), mineralisation (Rotllant et al., 2005) and osmoregulation (Abbink & Flik, 2007).

The changes in salinity and temperature of water masses due to global climate change represent vital stressors for aquatic organisms (Noyes et al., 2009; Elhakeem & Elshorbagy, 2013). It is proposed that salinity and temperature are essential abiotic master factors that play a crucial role in survival and development of fish embryos and larvae (Mendiola et al., 2006; Kai and Matthias 2010; Rosemore & Welsh, 2012). The direct exposure to fish embryos to the environment during development means they are directly exposed to environmental challenges (Fuzzen, Alderman, Bristow and Bernier, 2011) and this can have a profound effects on the physiology and health of the organism later in life (Kapoor, Dunn, Kostaki, Andrews and Matthews, 2006; Weinstock, 2008). However, few studies (Armesto et al., 2014; Luo, Chen, Hu and Lu, 2014) of the responsiveness of embryonic and larval fish to environmental stressors exist and further research is necessary.

In order to further understanding of pth, pthrp and their receptors, and their potential involvement in the responsiveness of fish embryos and larvae to environmental stressors, developing zebrafish were exposed to acute salinity and temperature challenges. The purpose of this study is to provide a basis for future genetic, developmental and physiological studies, and to also further explore the physiological function of these peptide hormones.

2. Materials and methods

2.1. Ethics statement

The experimental protocol was approved by the Animal Ethics committee of Shanghai Ocean University and abides by the Guidelines on Ethical Treatment of Experimental Animals established by the Ministry of Science and Technology, China.

2.2. Animals

Tübingen adult male and female zebrafish (n = 200; from 2.8 to 3.9 cm) were reared in an automatic recirculating water system (Haisheng, Shanghai, China) using a 14 h/day and 10 h/night cycle and a water temperature of 28 ° C. Adult fish were transferred to a spawning tank the day before mating. The next morning, eggs were collected 30 min after the light was turned on and the partition between male and female zebrafish was removed, then zebrafish embryos raised in beakers with a water from the re-circulating system at a temperature of 28 °C and 20% of the water was renewed daily. Embryos and larvae were staged in hours and days post fertilization (hpf and dpf) according to the morphological description of Kimmel et al (Kimmel, Ballard, Kimmel, Ullmann and Schilling, 1995). 0 hpf refers to unfertilized eggs immediately after stripping them from females. No food was provided to the

developing zebrafish larvae for the duration of the experiment. For sampling embryos and larvae were transferred to ice cold water and then stored at -80 °C.

23. Salinity challenge

Zebrafish embryos and larvae were raised in beakers (200 mL) containing filtered water at 28 °C taken from the main recirculating water system. Mesh-bottomed insert cups placed in beakers allowed quick transfer and exposure of animals to treatment conditions (Alderman & Bernier, 2009). To examine the effect of acute osmotic challenge and to control for handling and disturbance of the fish at 2, 3, 4, 5 dpf, embryos and larvae were taken out of the freshwater beakers and transferred to saline water (SW; 30 ppt salinity, experimental transfer) or in the case of the control fish to freshwater (time-matched control). After a 15 min challenge embryos were collected (30 larvae per sample, n = 3 pools per time point), snap-frozen (<1 min) and stored at -80 °C. The duration of exposure to the acute stressor was chosen based on previous studies (Alderman & Bernier, 2009; Fuzzen, Der Kraak and Bernier, 2010). Survival (100% survival rate) of embryos and larvae after a 15 min exposure to saline water was verified by confirming that the heart was beating.

2.4. Temperature experiments

To examine the effect of acute temperature challenge and to control for handling and disturbance of the fish at 2, 3, 4, 5 dpf, embryos and larvae were transferred from water at 28 °C—18 °C or 38 °C and exposed for 15 min. Embryos and larvae (30 individuals per pool, n = 3 pools) were sampled, snap-frozen and stored at -80 °C. Survival (100% survival rate) of embryos/larvae after a 15 min exposure to fresh water at 18 °C or 38 °C was verified by confirming that the heart was beating.

2.5. Preparation of total RNA and cDNA synthesis

Zebrafish embryos and larval samples were collected daily from 0 to 5 dpf (0,1.5, 3.7, 5.3, 8,10,16, 24, 48, 72 hpf, 4 dpf, 5 dpf). Three biological replicates that consisted of pools of 50 larvae (n = 50) were analyzed for each developmental time point. Embryos and larvae samples were homogenized in 1 mLof RNAiso Plus (TaKaRa). The homogenates were then mixed with 0.2 mL of chloroform and thoroughly shaken. After centrifugation at 12,000xg for 30 min at 4 ° C, the supernatants were mixed with an equal volume of iso-propanol. The solutions were precipitated by centrifugation at 12,000 xg for 30 min at 4 °C, and the resulting pellets were washed with 70% alcohol, and stored at -20 °C until use. The amount of total RNA extracted was determined by measuring the absorbance at 230, 260 and 280 nm by spectrophotometry with a Nanodrop 2000 (Thermo, Wilmington, USA). The quality of the extracted RNA was assessed using agarose gel (1.5%) electrophoresis. The total RNA was treated with deoxyribonuclease I (Promega, Madison, USA) following the manufacturer's instructions in order to eliminate potential genomic contamination. One microgram of DNA-free total RNA was used for first-strand cDNA synthesis with M-MLV Reverse Transcriptase (Promega, Madison, USA).

2.6. Quantitative real-time PCR

The quantitative real-time PCR (qRT-PCR) was carried out in 96-well qPCR plates on an ABI PRISM 7500 detector (Applied Biosystems, Foster City, CA). Specific primers for pthl, pth2, pthrpl, pthrp2, pth1r, pth2r, pth3r and b-actin transcripts were designed using the zebrafish mRNA sequences deposited in GenBank: pth1

Y.Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

(NM_212950), pth2 (NM_212949), pthrp1 (NM_001024627), pthrp2 (NM_001043324), pthlr (NM_131357), pth2r (NM_131377), pth3r (nm_131378) and b-actin (AF057040) (http://www.ncbi.nlm.nih. gov) and Primer Premier 5.0. Primers were synthesized commercially (Sangon Biotech, Shanghai, China) (Table 1) and optimization and validation of primers for qRT-PCR was performed using standard ABI protocols. b-actin was used as the reference gene and has previously been validated for zebrafish ontogeny (Tang, Dodd, Lai, Mcnabb and Love, 2007; Alsop & Vijayan, 2008; Fernandes, Mommens, Hagen, Babiak and Solberg, 2008) and also for the response to stress (Craig, Al-Timimi and Bernier, 2005; Lu et al., 2006; Keller, Escarawilke and Keller, 2008; Narum, Campbell, Meyer, Miller and Hardy, 2013). qRT-PCR was carried out using SYBR Premix Ex Taq (TaKaRa) according to manufacturer's instructions. Three reactions were performed for each sample along with no-template controls. qRT-PCR parameters were 95 °C for 30 s followed by 40 cycles at 95 ° C for 5 s, and 60 °C for 34 s. The expression level of each gene was calculated using the comparative threshold cycle (CT) method and expressed as 2~ddct (Livak & Schmittgen, 2001). The internal control gene used for these analyses was the housekeeping gene b-actin gene, and amplified transcripts were expressed as the fold change relative to the mean value of the lowest control group. The products of qRT-PCR were analysed by agarose gel (1.5%) electrophoresis to confirm a single product was obtained.

2.7. Statistics

Differences in gene expression during development and exposure to a temperature stressor at each developmental stage in zebrafish were analyzed by one-way analysis of variance (ANOVA) followed by Tukey's test for multiple comparisons. The effect of seawater exposure on gene expression at each developmental stage was analyzed using a t-test to compare the results of control and test fish. Any data set that did not meet the assumption of normality was reciprocal-transformed prior to analysis. All analyses were performed with SigmaStat 3.0 and the data expressed as the mean ± standard error (SE) and was considered statistically significant when P < 0.05.

3. Results

3.1. Expression pattern of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r during the early development of zebrafish

qPCR using specific primers revealed pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r transcripts were expressed from 0 hpf to 5 dpf during zebrafish development (Fig. 1). pth1, pth1r and pth2r transcripts were most abundant from 0 hpf to 3.7 hpf, after which values significantly decreased but peaked again at 24 hpf for pth1, at 5 dpf for pth1r, at 16 hpf for pth2r. pthrp1 transcripts were also most abundant at 0 hpf, after which values significantly decreased and then reached the highest levels at 5 dpf. pth2, pthrp2 and pth3r mRNA was expressed at the lowest level at 0 hpf. The level of pth2 mRNA increased from 3.7 hpf and peaked at 5.3 hpf and 24 hpf. The pthrp2 mRNA immediately increased after fertilization, and peaked at 5.3 hpf, and at 16 hpf. The transcript abundance of pth3r was very low from 0 hpf to 10 hpf, after which it significantly increased and reached a maximum at 4 dpf.

3.2. Effects of acute salinity exposure on pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r

The responsiveness of zebrafish pth1, pth2, pthrp1, pthrp2,

Table 1

Gene-specific primers for pth1, pth2, pthrp1, pthrp2, pthlr, pth2r, pth3r and b-actin.

Gene Sequences (5'-3')

pth1 F:GTTTCCATCAACGGGAATTT

R:CATCAGCTGCACTTCATTCA

pth2 F: ATACGTTGTTTGGAGAAAGCC

R:CATTGTGCATCAGCTGAACTT

pthrp1 F: CAGCAGCCGAATGAAGCGTTC

R: GCAGGCAGTGTGATGGAGACTC

pthrp2 F: AGCGTGTGCCTTCCAAATGC

R: ATGCTCCCGTCTCTTCAAATGG

pth1r F: GCACAGAGAAAGACCGGAGAA

R: TGAAAGCACCGCAGTTGCT

pth2r F: TGAACGGCTGCACATCATGTA

R: GGCACGCAGCATAAAGGAAA

pth3r F: ATCATTTGCTGGCCCACAG

R: TGCCCACGTCCGGTTTATA

b-actin F: GCTGCCTCTTCTTCCTCC

R: ATGTCCACGTCGCACTTC

pth1r, pth2r and pth3r to 15 min acute osmotic stress during early development was established by using zebrafish at 2, 3, 4 and 5 dpf. The transcript abundance of pth1r and pth2r in the high-salinity-exposed groups was significantly higher (P < 0.05) than the control group at 5 dpf. Although pthrp1 was significantly lower (P < 0.05) in the high-salinity-exposed group relative to the control group at 5 dpf. The mRNA expression in the control group was significantly higher than the high-salinity-exposed groups at 3 dpf for pth1, pth2 and pth3r and at 4 dpf for pth2r (P < 0.05) (Fig. 2).

Correlation analysis revealed a significant relationship between transcripts for pthrp1 and pth2/pth2r, and pth2r and pth3r in both the control and SW-exposed fish at 2 dpf. Strong positive correlations were detected between pth1, pth2 and pth3r mRNA levels in the control and SW-exposed at 3 dpf. No significant correlations were observed at 4 dpf. The pth1, pthrp1 and pthrp2 mRNA expression levels were strongly correlated at 5 dpf (Table 2).

3.3. Effects of acute temperature exposure on pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r

The gene expression levels of pth1, pth2, pthrp1, pthrp2, pth3r were significantly higher (P < 0.05) in zebrafish at 2 dpf exposed to 18 °C relative to the control at 28 °C. No significant changes in pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r gene expression occurred in zebrafish larvae exposed at 2 dpf to 38 °C compared to the control (28 °C). In larvae exposed to 18 °C at 3 dpf, pthrp1, pthrp2, pth1r and pth3r mRNA levels increased significantly (P < 0.05) relative to the control. In larvae 3 dpf exposed to 38 °C, pth2 gene expression was significantly down-regulated and pth1r gene expression was significantly up-regulated. The mRNA levels of pthrp1, pthrp2, pth1r were significantly decreased (P < 0.05) at 4 dpf in larvae exposed to 38 °C compared to the control (28 °C). Temperature manipulation did not significantly modify transcript abundance of pth1, pth2, pthrp1, pth2r and pth3r in larvae at 5 dpf. The exception was pth1r which was significantly decreased (P < 0.05) at 18 °C and pthrp2 which was significantly increased at 18 °C relative to the control (28 °C) (Fig. 3).

Correlation analysis revealed a significant relationship existed between pth1, pth2, pthrp2 and pth3r mRNA levels in the control and experimental treatments at 2 dpf, and also between pthrp1, pthrp2 and pth3r at 3 dpf. At 4 dpf and 5 dpf no correlations in gene expression were identified (Table 3).

Y Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

Fig. 1. Developmental expression profile of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r determined by qPCR. All gene expression data are standardized to the expression of b-actin and expressed relative to 0 dpf in the control. Values plotted are mean ± SE (n = 3). Significant differences were determined by one-way ANOVA followed by Duncan's test for multiple comparisons (P < 0.05) and significant differences are indicated by different letters.

Y.Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

Fig. 2. Effects of acute salinity exposure on the expression measured by qPCR of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r. All gene expression data are standardized to the expression of b-actin and expressed relative to the lowest expression value in the control. Values plotted are mean ± SE (n = 3). Significant differences is indicated with an asterisk between the control and SW exposed larvae at each time point. FW-FW represents the zebrafish transferred from fresh water to fresh water and FW-SW represents the zebrafish transferred from fresh water to saline water.

Y Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

Table 2

Relationships among pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r gene expression in acute salinity experiments.

Correlation 2dpf 3dpf 4dpf 5dpf

pth1 vs pth2 r -0.932 0.952* 0.820 0.455

pth1 vs pthrp1 r 0.870 0.915 0.834 -0.986*

pth1 vs pthrp2 r 0.391 -0.334 0.220 -0.982*

pth1 vs pth1r r 0.657 0.010 0.615 0.242

pth1 vs pth2r r 0.772 0.703 -0.136 0.803

pth1 vs pth3r r 0.683 0.964* 0.176 -0.699

pth2 vs pthrp1 r -0.979* 0.784 0.814 -0.478

pth2 vs pthrp2 r -0.620 -0.411 0.254 -0.521

pth2 vs pth1r r -0.692 0.173 0.644 -0.271

pth2 vs pth2r r -0.932 0.886 -0.146 0.804

pth2 vs pth3r r -0.829 0.984* 0.156 0.398

pthrp1 vs pthrp2 r 0.564 -0.231 0.596 0.999**

pthrp1 vs pth1r r 0.550 -0.160 -0.702 -0.365

pthrp1 vs pth2r r 0.985* 0.357 0.013 -0.863

pthrp1 vs pth3r r 0.925 0.787 0.040 0.803

pthrp2 vs pth1r r 0.840 -0.920 -0.525 -0.350

pthrp2 vs pth2r r 0.570 -0.365 -0.706 -0.887

pthrp2 vs pth3r r 0.341 -0.253 0.839 0.821

pth1r vs pth2r r 0.460 0.303 0.483 0.275

pth1r vs pth3r r 0.203 -0.003 -0.66 -0.590

pth2r vs pth3r r 0.961* 0.846 -0.137 -0.933

Notes: All gene expression data are standardized to the expression of b-actin. An * indicates a significant correlation (P < 0.05), and an "indicates a highly significant correlation (P < 0.01).

4. Discussion

4.1. A dynamic expression pattern of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r occurs during early development

PTH and PTHrP are two endocrine factors which share amino acid sequence homology and act via three different GPCRs. Only a hand-full of physiological studies have been carried out with the fish PTH-like peptides and their receptors. And the studies that exist were mainly focussed on PTHrP. PTH is suggested to regulate calcuim and phosphate homeostasis (Guerreiro et al., 2001; Guerreiro et al., 2007; Lin, Su and Hwang, 2014) and PTHrP seems to have multiple functions, including acting as a hypercalcaemic factor in fish (Danks et al., 1998), and regulating of craniofacial skeltogenesis in larval zebrafish (Yi-Lin et al., 2012).

There is a paucity of studies describing the role of pth, pthrp and pthr during development. Key insights into a gene's functions come from its pattern of expression. The mRNA expression pattern of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r were described during early teleost development in the present study. The results indicated that pth1, pthrp1, pth1r and pth2r were maternally activated genes, which is consistent with previous studies ofpth1, pth2r (Bhattacharya, Yan, Postlethwait and Rubin, 2011; Lin et al., 2013) and pthrp1 (Yi-Lin et al., 2012). The results suggest that pth, pthrp and pthr may have different functional roles before or after fertilization. The zebrafish possess two pth paralogs, pth1 and pth2 that are highly homologous to the human pth gene and the proteins derived from these genes have high affinity for PTH1R (Gensure et al., 2004). In developing zebrafish both pth1 and pth2 mRNA are expressed in the lateral line, although only pth2 mRNA is expressed in the central nervous system (CNS) (Hogan et al., 2005), and only pth1 plays an essential role in gill formation and the differentiation of ion-transporting cells (Kwong & Perry, 2015). Such results suggest that pth1 and pth2 have different functions during early development in zebrafish.

In mammals, pthrp is associated with chondrogenesis and development of the pancreas, the craniofacial skeleton, and other tissues (Philbrick et al., 1996). In this research, zebrafish pthrps

were detected throughout early development. This may be a consequence of a dual role that pthrp could act as a paracrine hormone, which is vital for chondrogenesis and osteogenesis, as occurs in mammals, and as a circulating hormone involved in calcium homeostasis and osmoregulation. Data from Yi-Lin and colleagues (Yi-Lin et al., 2012) indicated that pthrp is necessary for neural crest cell-derived craniofacial endochondrogenesis during development. In our study, only pth2 and pth3r was expressed at a relatively high level after 5.3 hpf or 16 hpf, a time that coincides with otic placode and brain neuromere formation in zebrafish and this may hint at a role for pth2 - pth3r in these processes.

At 3 dpf, zebrafish hatch and this is followed soon after by mouth opening and transition from endogenous to exogenous feeding. N-terminal PTHrP enhances the accumulation of calcium in larval sea bream (Guerreiro et al., 2001). The larvae take up calcium from the water via chloride cells, whereas the epithelial efflux is reduced or unaffected; through these combined effects a strong positive net uptake of calcium ions from the environment occurs, presumably to permit the rapid growth of the skeleton. Whether pth2 and pth3r play a role in developmental processes such as hatching, mouth opening and transition from endogenous to exogenous feeding remains unexplored and needs further investigation.

4.2. Effects of acute salinity exposure on the pth gene family and their receptors

Compared to mammals, teleost fertilization and embryogenesis generally takes place outside the body of females. Therefore, fertilization, development and survival of embryos and larvae are easily influenced by environmental factors, such as salinity (Sawant, Zhang and Li, 2001). The effects of a salinity stressor has been extensively examined in embryos and larvae of marine and estuarine fish, but has largely been ignored for freshwater fish (Hobby, Pankhurst and Haddy, 2000; Sawant et al., 2001). In this study, when zebrafish at 2, 3, 4 and 5 dpf were challenged with an acute osmotic stressor (salinity change), pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r had a modified expression patterns. The expression level of pth1 in this study was similar to those of Kazuyuki & Shigehisa, 2007 who demonstrated that the expression level of pth1 was dependent on Ca2+ levels in the water (Kazuyuki & Shigehisa, 2007). This indicated that pth1 regulation in zebrafish larvae was similar to that in mammals and other vertebrates where decreased plasma Ca2+ induces pth expression.

The reduction in the pth1 and pth2 mRNA expression in the high salinity-exposed groups at 3 dpf and their strong positive correlation suggests that these two genes may have a similar role in osmoregulation. Abbink and his colleagues (Abbink et al., 2006) found that the expression of pthrp and pth1r mRNA was significantly downregulated in the pituitary gland of Juvenile gilthead sea bream exposed to diluted seawater. A reduction in salinity increases prolactin secretion from the pituitary gland (Kaneko & Hirano, 1993) in sea water fishes, which limits ion loss and water permeability and stimulates Ca2+ influx through the gills (Flik, Rentier-Delrue and Bonga, 1994). The hypercalcemic control by PTHrP may connect both factors (Abbink et al., 2006) which was further confirmed by the observation that gene expression of pthrp in mammals is upregulated in response to increased plasma pro-lactin level (Thiede, 1989).

Water ingestion by drinking is the basis of ion homeostasis, and PTHrP may maintain osmotic pressure in marine fish by regulating intestinal water absorption through an adenylyl cyclase signaling pathway (Carvalho, Gregorio, Canario, Power and Fuentes, 2015). Two kinds of pthrp with highly conserved structures exist in zebrafish and PTHrP2 only exists in non-mammalian tetrapods and

Y.Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

Fig. 3. Effects of acute temperature exposure on the expression measured by qPCR of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r. Gene expression data are standardized to the expression of b-actin and expressed relative to the abundance in the control (2 dpf). Values plotted are mean ± SE (n = 3). Significant differences between the control and treatment larvae at each time point are determined by one-way ANOVA followed by Duncan's test for multiple comparisons (P < 0.05). Significant differences are indicated with an asterisk.

Y Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

Table 3

Relationships among pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r gene expression in acute temperature experiments.

Correlation 2dpf 3dpf 4dpf 5dpf

pth1 vs pth2 r 0.984* 0.693 -0.261 -0.380

pth1 vs pthrp1 r 0.733 0.670 0.348 0.897

pth1 vs pthrp2 r 0.988* 0.710 0.741 0.522

pth1 vs pth1r r -0.521 -0.416 -0.901 -0.608

pth1 vs pth2r r 0.724 0.330 -0.547 0.161

pth1 vs pth3r r 0.985* 0.519 0.822 0.831

pth2 vs pthrp1 r 0.630 0.423 0.191 -0.350

pth2 vs pthrp2 r 0.977* 0.458 -0.078 -0.502

pth2 vs pth1r r -0.466 0.846 0.331 0.722

pth2 vs pth2r r 0.652 -0.268 0.904 0.390

pth2 vs pth3r r 0.985* 0.252 -0.161 -0.367

pthrp1 vs pthrp2 r 0.730 0.993** 0.867 0.285

pthrp1 vs pth1r r -0.335 0.009 0.073 -0.476

pthrp1 vs pth2r r 0.810 0.541 0.120 -0.159

pthrp1 vs pth3r r 0.653 0.976* 0.598 0.541

pthrp2 vs pth1r r -0.585 0.002 -0.405 -0.936

pthrp2 vs pth2r r 0.794 0.580 -0.259 -0.090

pthrp2 vs pth3r r 0.992** 0.965* 0.837 0.692

pth1r vs pth2r r -0.679 0.662 0.579 0.319

pth1r vs pth3r r -0.607 0.203 -0.660 -0.631

pth2r vs pth3r r 0.733 0.621 -0.259 0.472

Notes: All gene expression data are standardized to the expression of b-actin. An * indicates a significant correlation (P < 0.05), and an "indicates a highly significant correlation (P < 0.01).

fish (Canario et al., 2006; Pinheiro et al., 2010). However, only pthrp1 mRNA expression levels were significantly downregulated in 5 dpf zebrafish exposed to a salinity challenge. These observations and the results of in situ hybridization revealing the divergent distribution of pthrp1 and pthrp2 during early development (Yi-Lin et al., 2012) indicates they probably have different functions in osmoregulation.

The ligand specificity and structure of PTH3R resembles PTH1R more than PTH2R (Rubin et al., 1999; Rubin & Juppner, 1999; Pinheiro, Cardoso, Power and Canario, 2012). Zebrafish PTH3R has a preference for PTHrP over PTH (Rubin & Juppner, 1999). For seabream PTH3R, only PTHrP activates the receptor (Rotllant et al., 2006). High salinity caused down-regulation of pth3r abundance at 3 dpf, which was similar to what occurred with pth1 and pth2 (Fig. 2). Moreover, strong positive correlations were detected between the pths and pth3r. It has been proposed that pth1 and pth2 may both activate pth3r to regulate the osmotic pressure. The expression pattern of pth1r and pth2r at 5 dpf was opposite to that of pthrp1 and this may indicate that pth1r and pth2r are influenced in a different way by osmotic stress than pth3r. In summary, the results of our study suggest that salinity change affects the expression of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r, and that pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r in embryos and larvae respond to osmotic stress.

4.3. Effects of acute temperature challenge on pth gene family and their receptors

Global climate change is a major factor which would be expected to increase water temperature, and seasonal change also has effects via alterations in temperature (Marcogliese, Ball and Lankester, 2001). The body temperature of most fishes equilibrates rapidly to ambient temperature, so water temperature is believed to be the abiotic master factor, which virtually controls and limits biochemical, physiological and life history events (Beitinger, Bennett and McCauley, 2000; Donaldson, Cooke, Patterson and Macdonald, 2008). Moreover, the development of embryos is more sensitive to variations in temperature than that of

larvae due to their incomplete osmoregulatory system (Lasker, 1964; Markofsky & Matias, 1977; Arenzon, Lemos and Bohrer, 2002).

In the present study, the expression levels of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r in zebrafish were generally upregu-lated by cold temperature stress with the exception of pth1r and pth2r. Most of the genes responded earlier, at 2 dpf, to temperature stress than to salinity stress, suggesting a higher susceptibility. Furthermore, the effects of cold or heat stress on pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r mRNA levels changed with zebrafish developmental status. In ectotherms, elevations in water temperature can cause higher metabolism, faster growth rates and higher food conversion efficiency (Wurtsbaugh & Cech, 1983; Goolish & Adelman, 1984; Vondracek, Wurtsbaugh and Cech., 1988). An increase in fish growth induced by high temperatures is predicted to be mediated by temperature sensitive hormone production. For example, growth hormone (GH) levels increase as temperature increases in many species (Deane & Woo, 2009). By analogy the mRNA expression levels of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r after thermal challenge may be caused by temperature adaptation. Previous studies have demonstrated a significant seasonal change in mRNA expression of pthrp in the adult flounder, with lowest level in August and highest levels in February to April (Lu, Worthington, Riccardi, Balment and McCrohan, 2007). It is tempting to speculate that the present study indicates that the PTH family and receptors may be involved in biological events, such as stress response, metabolism and development, although this needs to be further investigated. Futhermore, the response of pth3r to temperature suggests a regulatory mechanism unique to this non-mammalian receptor.

5. Conclusions

In summary, the dynamic expression pattern of mRNA encoding pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r, suggests they may be involved in development of zebrafish. Furthermore, we report for the first time that acute salinity and temperature modify the expression levels of pth1, pth2, pthrp1, pthrp2, pth1r, pth2r and pth3r mRNA during early development. Furthermore, pth1, pth2, pthrp1, pthrp2, pth1r and pth3r appear to be more sensitive to changes in temperature than salinity during early zebrafish development.

Conflict of interest

The authors have no conflict of interest to report.

Acknowledgments

This work was supported by National Natural Science Foundation of China (grant numbers 31572599, 41376134), Shanghai Universities First-class Disciplines Project of Fisheries.

References

Abbink, W., Bevelander, G., Hang, X., Lu, W., Guerreiro, P., Spanings, T., et al. (2006). PTHrP regulation and calcium balance in sea bream (Sparus auratus L.) under calcium constraint. Journal of Experimental Biology, 209(18), 3550—3557. Abbink, W., & Flik, G. (2007). Parathyroid hormone-related protein in teleost fish.

General & Comparative Endocrinology, 152(2—3), 243—251. Alderman, S. L., & Bernier, N. J. (2009). Ontogeny of the corticotropin-releasing factor system in zebrafish. General & Comparative Endocrinology, 164(1), 61—69. Alsop, D., & Vijayan, M. M. (2008). Development of the corticosteroid stress axis and receptor expression in zebrafish. Ajp Regulatory Integrative & Comparative Physiology, 294(2), 711—719. Arenzon, A., Lemos, C. A., & Bohrer, M. B. (2002). The influence of temperature on the embryonic development of the annual fish Cynopoecilus melanotaenia (Cyprinodontiformes, Rivulidae). Brazilian Journal of Biology = Revista brasleira de biologia, 62(4B), 743.

Y.Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10 9

Armesto, P., Campinho, M. A., Rodriguez-Rua, A., Cousin, X., Power, D. M., Manchado, M., et al. (2014). Molecular characterization and transcriptional regulation of the Na+/K+ ATPase alpha subunit isoforms during development and salinity challenge in a teleost fish, the Senegalese sole (Solea senegalensis). Comparative Biochemistry and Physiology B-Biochemistry & Molecular Biology, 175(1), 23—38.

Bago, A. G., & Dimitrov, E. R. (2009). Parathyroid hormone 2 receptor and its endogenous ligand tuberoinfundibular peptide of 39 residues are concentrated in endocrine, viscerosensory and auditory brain regions in macaque and human. Neuroscience, 162(1), 128—147.

Beitinger, T. L., Bennett, W. A., & McCauley, R. W. (2000). Temperature tolerances of North American freshwater fishes exposed to dynamic changes in temperature. Environmental Biology of Fishes, 58(3), 237—275.

Bhattacharya, P., Yan, Y., Postlethwait, J., & Rubin, D. (2011). Evolution of the vertebrate pth2 (tip39) gene family and the regulation of PTH type 2 receptor (pth2r) and its endogenous ligand pth2 by hedgehog signaling in zebrafish development. Journal of Endocrinology 211(2), 187—200.

Brown, E. (1999). Physiology and pathophysiology of the extracellular calcium-sensing receptor. The American Journal of Medicine, 106(2), 238—253.

Canario, A., Rotllant, J., Fuentes, J., Guerreiro, P., Teodosio, H., Power, D., et al. (2006). Novel bioactive parathyroid hormone and related peptides in teleost fish. FEBS Letters, 580(1), 291—299.

Carvalho, E. S., Gregorio, S. F., Canario, A. V., Power, D. M., & Fuentes, J. (2015). PTHrP regulates water absorption and aquaporin expression in the intestine of the marine sea bream (Sparus aurata, L.). General and Comparative Endocrinology, 213(1), 24—31.

Craig, P. M., Al-Timimi, H., & Bernier, N. J. (2005). Differential increase in forebrain and caudal neurosecretory system corticotropin-releasing factor and urotensin I gene expression associated with seawater transfer in rainbow trout. Endocrinology, 146(9), 3851—3860.

Danks, J. A., Trivett, M. K., Power, D. M., Canario, A., Martin, T. J., & Ingleton, P. M. (1998). Parathyroid hormone-related protein in lower vertebrates. Clinical & Experimental Pharmacology & Physiology, 25(9), 750—752.

Deane, E., & Woo, N. (2009). Modulation of fish growth hormone levels by salinity, temperature, pollutants and aquaculture related stress: A review. Reviews in Fish Biology and Fisheries, 19(1), 97—120.

Donaldson, M. R., Cooke, S. J., Patterson, D. A., & Macdonald, J. S. (2008). Cold shock and fish. Journal of Fish Biology, 73(7), 1491—1530.

Elhakeem, A., & Elshorbagy, W. (2013). Evaluation of the long-term variability of seawater salinity and temperature in response to natural and anthropogenic stressors in the Arabian Gulf. Marine Pollution Bulletin, 76(1—2), 355—359.

Fernandes, J. M., Mommens, M., Hagen, O., Babiak, I., & Solberg, C. (2008). Selection of suitable reference genes for real-time PCR studies of Atlantic halibut development. Comparative Biochemistry & Physiology Part B Biochemistry & Molecular Biology, 150(1), 23—32.

Flik, G., Rentier-Delrue, F., & Bonga, S. W. (1994). Calcitropic effects of recombinant prolactins in Oreochromis mossambicus. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 266(4), 1302—1308.

Fuentes, J., Figueiredo, J., Power, D., & Canario, A. (2006). Parathyroid hormone-related protein regulates intestinal calcium transport in sea bream (Sparus auratus). American Journal of Physiology-Regulatory Integrative and Comparative Physiology, 291 (5), 1499—1506.

Fuzzen, M., Alderman, S., Bristow, E., & Bernier, N. (2011). Ontogeny of the corticotropin-releasing factor system in rainbow trout and differential effects of hypoxia on the endocrine and cellular stress responses during development. General and Comparative Endocrinology, 170(3), 604—612.

Fuzzen, M., Der Kraak, G., & Bernier, N. (2010). Stirring up new ideas about the regulation of the hypothalamic-pituitary-interrenal Axis in zebrafish (Danio rerio). Zebrafish, 7(4), 349—358.

Gensure, R., Ponugoti, B., Gunes, Y., Papasani, M., Lanske, B., Bastepe, M., et al. (2004). Identification and characterization of two parathyroid hormone-like molecules in zebrafish. Endocrinology, 145(4), 1634—1639.

Goolish, E., & Adelman, I. (1984). Effects of ration size and temperature on the growth of juvenile common carp (Cyprinus carpio L.). Aquaculture, 36(1—2), 27—35.

Guerreiro, P. M., Fuentes, J., Power, D. M., Ingleton, P. M., Flik, G., & Canario, A. V. (2001). Parathyroid hormone-related protein: A calcium regulatory factor in sea bream (Sparus aurata L.) larvae. Ajp Regulatory Integrative & Comparative Physiology, 281 (3), 855—860.

Guerreiro, P. M., Renfro, J. L., Power, D. M., & Canario, A. V. M. (2007). The parathyroid hormone family of peptides: Structure, tissue distribution, regulation, and potential functional roles in calcium and phosphate balance in fish. American Journal of Physiology - Regulatory, Integrative and Comparative Physiology, 292(2), 679—696.

Gunther, T., Chen, Z., Kim, J., Priemel, M., Rueger, J., Amling, M., et al. (2000). Genetic ablation of parathyroid glands reveals another source of parathyroidhormone. Nature, 406(6792), 199—203.

Hobby, A. C., Pankhurst, N. W., & Haddy, J. A. (2000). The effect of short term confinement stress on binding characteristics of sex steroid binding protein (SBP) in female black bream (Acanthopagrus butcheri) and rainbow trout (Oncorhynchus mykiss). Comparative Biochemistry and Physiology A: Molecular & Integrative Physiology, 125(1), 85—94.

Hogan, B., Danks, J., Layton, J., Hall, N., Heath, J., & Lieschke, G. (2005). Duplicate zebrafish pth genes are expressed along the lateral line and in the central nervous system during embryogenesis. Endocrinology, 146(2), 547—551.

Ingleton, P., Bendell, L., Flanagan, J., Teitsma, C., & Balment, R. (2002). Calcium -sensing receptors and parathyroid hormone - related protein in the caudal neurosecretory system of the flounder (Platichthys flesus). Journal of Anatomy, 200(5), 487-497.

Jaillon, O., Aury, J.-M., Brunet, F., Petit, J.-L., Stange-Thomann, N., Mauceli, E., et al. (2004). Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature, 431(7011), 946-957.

Kai, S., & Matthias, S. J. (2010). Developmental plasticity, modularity, and hetero-chrony during the phylotypic stage of the zebra fish, Danio rerio. Journal of Experimental Zoology Part B Molecular & Developmental Evolution, 314b(2), 166-178.

Kaneko, T., & Hirano, T. (1993). Role of prolactin and somatolactin in calcium regulation in fish. The Journal of Experimental Biology, 184(1), 31-45.

Kapoor, A., Dunn, E., Kostaki, A., Andrews, M., & Matthews, S. (2006). Fetal programming of hypothalamo - pituitary - adrenal function: Prenatal stress and glucocorticoids. The Journal of Physiology, 572(1), 31-44.

Kazuyuki, H., & Shigehisa, H. (2007). Expression of endocrine genes in zebrafish larvae in response to environmental salinity. Journal of Endocrinology, 193(3), 481-491.

Keller, J., Escarawilke, J., & Keller, E. (2008). Heat stress-induced heat shock protein 70 expression is dependent on ERK activation in zebrafish (Danio rerio) cells. Comparative Biochemistry & Physiology Part A-Molecular & Integrative Physiology, 150(3), 307 -314.

Kimmel, C., Ballard, W., Kimmel, S., Ullmann, B., & Schilling, T. (1995). Stages of embryonic development of the zebrafish. Developmental Dynamics, 203(3), 253-310.

Kronenberg, H. (2003). Developmental regulation of the growth plate. Nature, 423(6937), 332-336.

Kwong, R. W. M., & Perry, S. F. (2015). An essential role for parathyroid hormone in gill formation and differentiation of ion-transporting cells in developing zebrafish. Endocrinology, 156(7), 2384-2394.

Lasker, G. W. (1964). American association of Physical anthropologists. Science, 146(3641), 289-290.

Lin, C., Su, C., & Hwang, P. (2014). Calcium-Sensing receptor mediates Ca2+ ho-meostasis by modulating expression of PTH and Stanniocalcin. Endocrinology, 155(1), 56-67.

Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCt Method. Methods, 25(4), 402-408.

Lu, W., Greenwood, M., Dow, L., Yuill, J., Worthington, J., Brierley, M. J., et al. (2006). Molecular characterization and expression of urotensin II and its receptor in the flounder (Platichthys flesus): A hormone system supporting body fluid homeostasis in euryhaline fish. Endocrinology, 147(8), 3692-3708.

Lu, W., Worthington, J., Riccardi, D., Balment, R. J., & McCrohan, C. R. (2007). Seasonal changes in peptide, receptor and ion channel mRNA expression in the caudal neurosecretory system of the European flounder (Platichthys flesus). General & Comparative Endocrinology, 153(1-3), 262-272.

Luo, L., Chen, A., Hu, C., & Lu, W. (2014). Dynamic expression pattern of corticotropin-releasing hormone, urotensin I and II genes under acute salinity and temperature challenge during early development of zebrafish. Fish Physiology and Biochemistry, 40(6), 1877-1886.

Marcogliese, D. J., Ball, M., & Lankester, M. W. (2001). Potential impacts of clear-cutting on parasites of minnows in small boreal lakes. Folia Parasitologica, 48(4), 269-274.

Markofsky, J., & Matias, J. R. (1977). The effects of temperature and season of collection on the onset and duration of diapause in embryos of the annual fish Nothobranchius guentheri. Journal of Experimental Zoology, 202(1), 49-56.

Mendiola, J., Hernandez, H., Sariego, I., Rojas, L., Otero, A., Ramirez, A., et al. (2006). Antimalarial activity from three ascidians: An exploration of different marine invertebrate phyla. Transactions of The Royal Society of Tropical Medicine and Hygiene, 100(10), 909-916.

Merendino, J., Insogna, K., Milstone, L., Broadus, A., & Stewart, A. (1986). A parathyroid hormone-like protein from cultured human keratinocytes. Science, 231(4736), 388-390.

Narum, S. R., Campbell, N. R., Meyer, K. A., Miller, M. R., & Hardy, R. W. (2013). Thermal adaptation and acclimation of ectotherms from differing aquatic climates. Molecular Ecology, 22(11), 3090-3097.

Noyes, P., Mcelwee, M., Miller, H., Clark, B., Van Tiem, L., Walcott, K., et al. (2009). The toxicology of climate change: Environmental contaminants in a warming world. Environment International, 35(6), 971 -986.

Papasani, M. R., Gensure, R. C., Yi-Lin, Y., Yasemin, G., Postlethwait, J. H., Bhaskar, P., et al. (2004). Identification and characterization of the zebrafish and Fugu genes encoding tuberoinfundibular peptide 39. Endocrinology, 145(11), 5294-5304.

Philbrick, W., Wysolmerski, J., Galbraith, S., Holt, E., Orloff, J., Yang, K., et al. (1996). Defining the roles of parathyroid hormone-related protein in normal physiology. Physiological Reviews, 76(1), 127-173.

Pinheiro, P., Cardoso, J., Gomes, A., Fuentes, J., Power, D., & Canario, A. (2010). Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken. BMC Evolutionary Biology, 10(1), 373-386.

Pinheiro, P., Cardoso, J., Power, D., & Canario, A. (2012). Functional characterization and evolution of PTH/PTHrP receptors: Insights from the chicken. BMC Evolutionary Biology, 12(1), 110-124.

Postlethwait, J., Yan, Y., Gates, M., Horne, S., Amores, A., Brownlie, A., et al. (1998). Vertebrate genome evolution and the zebrafish gene map. Nature Genetics, 18(4), 345-349.

10 Y Jin et al. / Aquaculture and Fisheries xxx (2017) 1—10

Rosemore, B. J., & Welsh, C. A. (2012). The effects of rearing density, Salt concentration, and incubation temperature on Japanese medaka (Oryzias latipes) embryo development. Zebrafish, 9(9), 185-190.

Rotllant, J., Guerreiro, P. M., Redruello, B., Fernandes, H., Apolonia, L., Anjos, L., et al. (2006). Ligand binding and signalling pathways of PTH receptors in sea bream (Sparus auratus) enterocytes. Cell and Tissue Research, 323(2), 333-341.

Rotllant, J., Redruello, B., Guerreiro, P. M., Fernandes, H., Canario, A. V., & Power, D. M. (2005). Calcium mobilization from fish scales is mediated by parathyroid hormone related protein via the parathyroid hormone type 1 receptor. Regulatory Peptides, 132(1-3), 33-40.

Rubin, D., Hellman, P., Zon, L., Lobb, C., Bergwitz, C., & Juppner, H. (1999). A G protein-coupled receptor from zebrafish is activated by human parathyroid hormone and not by human or teleost parathyroid hormone-related peptide implications for the evolutionary conservation of calcium-regulating peptide hormones. Journal of Biological Chemistry, 274(33), 23035-23042.

Rubin, D., & Juppner, H. (1999). Zebrafish express the common parathyroid hormone/parathyroid hormone-related peptide receptor (PTH1R) and a novel receptor (PTH3R) that is preferentially activated by mammalian and fugufish parathyroid hormone-related peptide. Journal of Biological Chemistry, 274(40), 28185-28190.

Sawant, M. S., Zhang, S., & Li, L. (2001). Effect of salinity on development of zebrafish, Brachydanio rerio. Currentence, 81(10), 1347-1350.

Tang, R., Dodd, A., Lai, D., Mcnabb, W. C., & Love, D. R. (2007). Validation of zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochimica et Biophysica Sinica, 39(5), 384-390.

Taylor, J. S., Braasch, I., Frickey, T., Meyer, A., & Peer, Y. V. D. (2003). Genome duplication, a trait shared by 22,000 species of ray-finned fish. Genome Research, 13(3), 382-390.

Thiede, M. A. (1989). The mRNA encoding a parathyroid hormone-like peptide is produced in mammary tissue in response to elevations in serum prolactin. Molecular Endocrinology, 3(9), 1443—1447.

Usdin, T. B., Hoare, S. R., Wang, T., Mezey, E., & Kowalak, J. A. (1999). TIP39: A new neuropeptide and PTH2-receptor agonist from hypothalamus. Nature Neuroscience, 2(11), 941—943.

Vondracek, B., Wurtsbaugh, W., & Cech, J. (1988). Growth and Reproduction of the mosquitofish, Gambusia affinis, in relation to temperature and ration Level: Consequences for life history. Environmental Biology of Fishes, 21(1), 45—57.

Weaver, D. R., Deeds, J. D., Lee, K., & Segre, G. V. (1995). Localization of parathyroid hormone-related peptide (PTHrP) and PTH/PTHrP receptor mRNAs in rat brain. Molecular Brain Research, 28(2), 296—310.

Weinstock, M. (2008). The long-term behavioural consequences of prenatal stress. Neuroscience & Biobehavioral Reviews, 32(6), 1073—1086.

Weir, E. C., Brines, M. L., Ikeda, K., Burtis, W. J., Broadus, A. E., & Robbins, R. J. (1990). Parathyroid hormone-related peptide gene is expressed in the mammalian central nervous system. Proceedings of the National Academy of Sciences of the United States of America, 87(1), 108—112.

Wurtsbaugh, W., & Cech, J. (1983). Growth and activity of juvenile Mosquitofish: Temperature and ration effects. Transactions of The American Fisheries Society, 112(5), 653—660.

Wysolmerski, J. J., & Stewart, A. F. (1998). The physiology of parathyroid hormone-related protein: An emerging role as a developmental factor. Annual Review of Physiology, 60(1), 431—460.

Yi-Lin, Y., Poulomi, B., Xin Jun, H., Bhaskar, P., Ben, M., Jason, L., et al. (2012). Duplicated zebrafish co-orthologs of parathyroid hormone-related peptide (PTHrP, Pthlh) play different roles in craniofacial skeletogenesis. Journal of Endocrinology, 214(3), 421—435.