Scholarly article on topic '813. The Combination of Antisense K-ras RNA and Interferon-Alpha Induces Synergistic Cytotoxicity Against Pancreatic Cancer Cells'

813. The Combination of Antisense K-ras RNA and Interferon-Alpha Induces Synergistic Cytotoxicity Against Pancreatic Cancer Cells Academic research paper on "Biological sciences"

CC BY-NC-ND
0
0
Share paper
Academic journal
Mol Ther
OECD Field of science
Keywords
{""}

Academic research paper on topic "813. The Combination of Antisense K-ras RNA and Interferon-Alpha Induces Synergistic Cytotoxicity Against Pancreatic Cancer Cells"

a synergistic pro-apoptotic effect on transduction with both constructs that appears to induce apoptosis via a caspase9-mediated pathway. Furthermore, we show that the pro-apoptotic effect of survivinT34A can be enhanced significantly by transduction with a smac expressing adenoviral construct. We suggest that a combination gene therapy using adenoviral vectors that significantly depletes endogenous survivin effectivity whilst also delivering high levels of pro-caspase3 allows efficient proteolytic cleavage and activation of the terminal caspase leading to tumor cell death.

810. Effects of HSV Amplicon Vectors Mediate TIMP-3 Gene Transfer in Human Glioma Cell Lines

Paula Y. P. Lam,1 ChuJun Yuan,1 Kam Man Hui.1

1Ceiiuiar and Molecular Research, National Cancer Centre, S//7grapore.

One of the difficulties encountered in current therapeutic strategies of glioblastoma multiforme is that the tumor usually recurred within a few centimeters of the margins of the resection. Such invasion of malignantly transformed cells is dependent on their capacility to degrade basement membranes and extracellular matrix (ECM) in an effective and controlled manner. The turnover of ECM components is subsequently, controlled by a complex system of tightly regulated protease enzymes (matrix metalloproteinases, MMPs) and their endogenous inhibitors (tissue inhibitor of metalloproteinases, TIMPS). In particular, TIMP-3 appears to play a role in regulating malignant cell invasion and promoting malignant cell death. Overexpression of TIMP-3 has been demonstrated to induce apoptosis in several cancerous cell lines such as melanoma; breast carcinoma; colon cancer; retinas and smooth muscle cells. Majority of these studies was performed using recombinant adenoviral vector as a gene transfer vehicle. However, recent concern has been raised over the potential clinical utility of these vectors due to the elicitation of strong host immune responses. In this study, we examine if HSV-1 amplicon vectors mediated TIMP-3 overexpression exhibits similar cell death phenomenon in human glioma cells. Furthermore, we would like to assess whether gene therapy based on TIMP-3 may offer an advantage over conventional suicide gene therapy, as the effect of secreted TIMP-3 may not be limited by the transduction efficiency as dramatically as that of intracellular suicide genes.

Human TIMP-3 cDNA fragment was reversed transcribed from total RNA prepared from primary human dermal fibroblast cells and subcloned into backbone amplicon vector, pHGCX (Y Saeki et al., 2001 Mol Ther,3: 591-601). The DNA sequence was verified by restriction mapping and sequencing. The packaged amplicon vectors ranged in titre from 1.1 x 106 tu/ml for TIMP-3 and 1.2 x 107 tu/ml for pHGCX amplicon viral vectors. The transduction efficiency was assessed by scoring green fluorescence protein expressing cells and estimated to be 58% at an MOI of 1.0. Western blot analysis revealed elevated level of TIMP-3 expression. The effect of TIMP-3 overexpression on glioma cell viability was also assessed by trypan blue assay. Decrease in cell number was detected in Gli-36 cells, U87MG, U251 and SF767 cells by 19%; 25%; and 5% respectively for the latter two cell lines at 72 hours post infection at an MOI of 0.5. In contrast, transduction of cells with control vectors did not exhibit similar effect. In Gli-36 cells, as the MOI increases from 0.5 to 5.0, the cell number also decreases by a further 40%. Additional studies are underway to assess whether this decrease in cell number is due to programme cell death or perhaps, cytotoxicity of the viral vector and if the therapeutic implications may be enhanced on increasing the MOIs.

811. Ad-PTEN:A Novel Anti-MelanomaAgent In Vitro

Helena Yang,1 Abner Mhashilkar,1 Alexis Stewart,1 Su Ekmekcioglu,2 Yuji Saito,4 Kerry Seiger,1 Robert Schrock,1 Eric Onishi,1 Xin Swanson,1 Lou Zumstein,1 David Snary,3 Jack Roth,4 Rajagopal Ramesh,4 Elizabeth Grimm,2 Sunil Chada.1

1lntrogen Therapeutics Inc., Houston, TX, United States; 2Bioimmunotherapy, UT, MD Anderson Cancer Center, Houston, TX, United States; 3lmperiai Cancer Research Fund, London, United Kingdom; 4Thoracic and Cardiovascular Surgery, UT, MD Anderson Cancer Center, Houston, TX, United States.

Melanoma is an aggressive human cancer that metastasizes rapidly and responds poorly to conventional cancer therapies. PTEN is a novel tumor

suppressor on chromosome 10q23, a frequently mutated or deleted region in human cancers. The PTEN gene encodes a phosphatase with an unusual dual specificity for both proteins and lipids. Mutations of PTEN have been found in a variety of human cancers including glioblastoma, prostate, endometrial, breast, lung, and melanoma. We report here that adenoviral transfer of PTEN into melanoma cells containing wild-type PTEN alleles led to apoptosis and growth inhibition. Phosphorylation of AKT, a key molecule governing cell survival, was diminished following PTEN overexpression. Ad-PTEN transduction also suppressed cell invasion in metastatic melanoma cells. Concomitantly, the level of E-cadherin expression on the cell surface was also increased. Immunohistochemical analyses and confocal microscopy have localized PTEN to the cellular membrane and the cytoplasm. These studies indicate that Ad-PTEN has both pro-apoptotic and anti-metastatic properties, and may be a promising agent for the treatment of melanoma.

812. Exploiting Molecular Pathways for Breast Cancer Treatment:Ad-mda7 Enhances Activity of Conventional Cancer Agents

Abner Mhashilkar,1 Kerry Seiger,1 Alexis Stewart,1 Kelly Hunt,2 Sunil Chada.1

1lntrogen Therapeutics Inc., Houston, TX, United States; 2Surgicai Oncology, UT-Md Anderson Cancer Center, Houston, TX, United States.

Breast cancer is the most common type of cancer among women in the United States. Approximately 180,000 women are diagnosed with breast cancer each year. The treatment of breast cancer depends on the grade of cancer and can involve combinations of surgery, radiation therapy, hormone therapy, immunotherapy and chemotherapy. Novel approaches using drugs targeted against specific molecular signaling pathways are gaining popularity. We have developed a replication-defective adenoviral vector encoding the human melanoma differentiation associated gene 7 (mda-7) as a novel molecularly targeted agent against breast cancer. Ad-mda7 has shown potent anti-proliferative efficacy against a variety of cancer cell lines, including breast, lung, melanoma and colorectal. Induction of apoptosis and cell cycle arrest are seen selectively in tumor cell lines, whereas Ad-mda7 treatment of normal cells does not cause cell death.

We have evaluated the combination of Ad-mda7 with a number of agents commonly used to treat breast cancer. The anti-breast cancer drugs have different modes of action, varying from: interference of the cell's DNA replication (Adriamycin), damaging microtubules (Taxotere) and estrogen antagonist (Tamoxifen). In addition we evaluated the combination of Ad-mda7 with Herceptin, a humanized anti-Her2 monoclonal antibody, which has shown promising results in patients with advanced breast cancer tumors. We found that Ad-mda7, when combined with conventional anti-cancer drugs, such as Herceptin, Tamoxifen, Adriamycin and Taxotere, displayed additive or supra-additive effects in inhibiting breast cancer cell growth and inducing apoptosis. These combinatorial approaches employing drugs targeted to different molecular pathways may be important in further improving gene based therapeutics against breast cancer.

813. The Combination of Antisense K-ras RNA and Interferon-Alpha Induces Synergistic Cytotoxicity Against Pancreatic Cancer Cells

Kazuteru Hatanaka, Koichi Suzuki, Shumpei Ohnami, Teruhiko Yoshida, Kazunori Aoki.

Pancreatic cancer is one of the most difficult cancers to diagnose early and cure, and no effective therapy for this cancer has been established so far. However, the cancer has a characteristically high incidence of K-ras point mutation and thus would be a good target for K-ras suppression strategy. We previously reported that the transduction of antisense K-ras RNA-expressing vector suppressed the growth of pancreatic and colon cancer cells in vitro and in vivo. On the other hand, the growth inhibitory effect of recombinant interferon-alpha (IFN) protein has been documented in a wide variety of tumor cell types including pancreatic cancer cells. In this study, we first examined the effect of adenovirus-mediated gene transfer of IFN in pancreatic cancer, and found that it effectively induced cell death in pancreatic cancer cells. It is known that IFN-inducible enzyme 2', 5'-oligoadenylate synthetase (2-5AS) is activated

Molecular Therapy Vol. 5, No. 5, May 2002, Part 2 of 2 Parts Copyright © The American Society of Gene Therapy

with double strand RNA and the activation of 2-5AS -dependent RNase L induces apoptosis of cells. Therefore, the double strand RNA formed by the binding of antisense and endogeneous K-ras RNA might activate 2-5AS and enhance the cell death induction in pancreatic cancer cells, which prompt us to investigate the synergistic effect of IFN and antisense K-ras RNA in pancreatic cancer. Adenovirus expressing antisense K-ras RNA and IFN were infected at moi 10 into 3 pancreatic cancer cell lines (AsPC-1, Panc-1 and PSN-1), and 4 days later, cell death was examined by Annexin-V and ApopTag assays. Although the combination of antisense K-ras and IFN transduction produces same levels of IFN and 2-5AS with that obtained by the transduction of antisense K-ras or IFN alone, the RNase L activity was enhanced by the combination than the transduction of antisense K-ras or IFN alone, and the combination significantly enhanced the induction of cell death compared with IFN in pancreatic cancer cells (1.3 - 4 folds). This study demonstrates the novel utility of antisense RNA for cancer gene therapy, and the combination of gene transfer of IFN and antisense K-ras may be a promising gene therapy for pancreatic cancer.

814. A Phase I Dose-Escalation Pharmacokinetic and Pharmacodynamic Study of Ad-mda7 (INGN 241) in Patients with Advanced Carcinoma

Sunil Chada,1 John Nemunitis,2 Alex Tong,3 Yuan Zhang,3 Dan Su,3 Abner Mhashilkar,1 Helena Yang,1 Karen Parker,1 Deborah Wilson,1 Casey Cunningham,2 James Merritt,1 Keith Coffee.1

1Introgen Therapeutics Inc., Houston, TX, United States; 2US Oncology, Dallas, TX, United States; 3BaylorSammons Cancer Center, Dallas, TX, United States.

The mda-7 gene is a novel tumor suppressor gene. The objective of this study is to determine the safety and pharmacokinetics of a single intratumoral injection of INGN 241 (Ad-mda7). Patients with advanced carcinoma who had a surgically resectable lesion received a single injection of INGN 241 at doses ranging from 2x1010-2x1012 viral particles (vp). At specific times after injection, the lesions were excised, serially sectioned, and analyzed for vector distribution, MDA-7 protein expression, and apoptosis induction. Blood was also sampled for viral DNA.

DNA PCR of the injected lesion exhibited a dose-dependent response in the number of Ad-mda7 vector copies/ug DNA ranging from 7x106 at the 2x1010 vp (low dose) up to 4x108 at 2x1012 vp (high dose). DNA PCR also revealed that the highest number of Ad-mda7 vector copies was located at the center of the injected lesion. Both MDA-7 protein and vector DNA could be detected in sections up to 1 cm from the point of injection. RT-PCR and IHC analyses showed that both vector RNA and MDA-7 protein levels had a similar correlation with both dose and distance from the injection site. Strong MDA-7 staining was found in all injected lesions, whereas non-injected lesion controls were negative. Low dose INGN 241 injection resulted in up to 20% MDA-7 positive cells at the center of the tumor; high dose injection resulted in up to 80% of MDA-7 positive cells. Apoptotic TUNEL staining was most intense in the center of the lesions, with up to 70% of cells being positive; sections in the periphery of the tumor also showed a markedly stronger TUNEL reaction as compared with uninjected lesions. INGN 241 appears to be safe with with pain at the injection site, transient low-grade fever and mild flu-like symptoms being the primary toxicities observed. This is the first study to evaluate distribution of INGN 241 within tumors and suggests that INGN 241 can induce apoptosis in a large percentage of tumor volume following intratumoral administration.

815. Modified Antisense Oligonucleotide Specific for bcl-2 Gene Inhibit the Growth of Tumor Cells That Overexpress Bcl-2

Byung Joo Song, Seok Hyo Chang, Seung Kyu Yoon, Chung Ok Lee, Sung Hee Park, Yun Jung Kwon, Eu Bok Lee, Jin Seok Woo. department of Surgery, Ilsan Paik Hospital, Inje University Medical College, Koyang-Si, Kyunggi-do, Korea; 2Department of Medicine, Kangnam St Mary Hospital, Catholic University Medical College, Seoul Korea; 3Pharmaceutical Screening Laboratory Korea Research Institute of Chemical Technology, DaeJeon, Korea; 4GeneChem Inc., Seoul, Korea.

The bcl-2 gene is a proto-oncogene which contributes to neoplastic progression by enhancing tumor cell survival through inhibition of apoptosis. Accumulating data suggest that tumor overexpressed Bcl-2 is related to the resistance to chemotherapy or radiotherapy. In this regard, new anticancer strategy which suppresses Bcl-2 anti-apoptotic protein expression should be achieved for more therapeutic advances against cancer. In recent years the conjugate molecule composing antisense oligonucleotides coupling with alkylating agent have been developed to improve more targeting selective and less toxic than ordinary anticancer alkylating agent. In the present study, we synthesized site-specific gene targeting agent (SGTA) composing antisense oligonucleotide with alkylating agent to enhance tumor cell killing via stronger covalent bonding between the base of nucleic acids and alkylating agent. We investigated the ability of SGTA to inhibit the expression of bcl-2 and to inhibit the growth and induce apoptosis in cancer cell line. Antisense oligonucleotide (0DN-2009) sequences, which targets codon 141 - 147 of the bcl-2 mRNA, were as follows: 5' - AATCCTCCCCCAGTTCACCCCGT - 3'. 0DN-2009-001 (SGTA) were synthesized 0DN-2009 with alkylating agent (001) by conjugation. After H69 (human small-cell lung cancer cell lines) cells in which 0.15, 0.3, 0.6 |lM ODNs reacted with DOTAP was added, the cytotoxicity of ODN was measured through MTT assay. There were no significant differences in cell growth in the test groups treated by SC-12 (scrambled 0DN-2009), SC-12-001 (scrambled 0DN-2009-001) in comparison with the control group. 0n the other hand, cell growth rates in the H69 cells treated by 0DN 2009 were 61%, 63%, and 75% of the control group respectively, and showed its weak cytotoxicity. The cell growth rates of H69 cells treated by 0DN-2009-001 were 12%, 15%, and 15% of the control group respectively, and showed its strong cytotoxicity compared to that of 0DN-2009. The cell cycle distributions and apoptosis in the H69 according to the variable 0DNs with different concentration were assayed by flow cytometry. The DNA content in G0/G1, S and G2/ M of the H69 was 31%, 37% and 32% treated with the same concentration of 0.3 |lM of 0DN-2009, and 25%, 48% and 27% treated with 0DN-2009-001 compared with those of the control 52%, 23% and 25%, respectively. The number of cells with DNA content in the sub G0/G1 fraction was significantly decreased but increased in S and G2/M fraction. However, the DNA content distribution in cell cycle treated with 0.15 ^M of 0DN did not show significant discrepancy between variable 0DN and control. Also, morphologic cell change of apoptosis in H69 was demonstrated by PI staining. The 0DN-2009-001, 0DN-2009 treated cells show an increased frequency of apoptotic nuclei. These nuclei condensation suggest that the apoptosis of cancer cell line might be more induced by 0DN-2009-

001 than 0DN-2009. We examined the effect of SGTA treatment on expressing of the Bcl-2 protein in H69 treated with 0DN-2009, 0DN-2009-001 for 24 and 96 hours. Inhibition of Bcl-2 protein was 3%, 23.09%, and 44.03% at 0.15M, 0.3M, and 0.45M of 0DN-2009, but 26.84%, 48.29%, and 88.53% at 0.15M, 0.3M, and 0.45M of SGTA 0DN-2009-001. As above result, 0DN-2009-001 have highly inhibition effect of expression of Bcl-

2 protein and highly cytotoxicity effect in tumor cell compared with 0DN-2009. This observation suggests that this conjugate molecule SGTA (0DN-2009-001) were the most cytotoxic of all 0DNs tested and might be more effective inhibitors of small-cell lung cancer growth.

Molecular Therapy Vol. 5, No. 5, May 2002, Part 2 of 2 Parts Copyright © The American Society of Gene Therapy