Effects of feeding whole linseed on ruminal fatty acid composition and microbial population in goats Academic research paper on "Animal and dairy science"

Accepted Manuscript

Effects of feeding whole linseed on ruminal fatty acid composition and microbial population in goats

Kamal Abuelfatah, Abu Bakar Zuki, Yeng Meng Goh, Awis Qurani Sazili, Abdelrahim Abubakr

S2405-6545(16)30042-7 10.1016/j.aninu.2016.10.004

Reference: ANINU 122

To appear in: Animal Nutrition Journal

Received Date: 20 March 2016 Accepted Date: 24 October 2016

Please cite this article as: Abuelfatah K, Zuki AB, Goh YM, Sazili AQ, Abubakr A, Effects of feeding whole linseed on ruminal fatty acid composition and microbial population in goats, Animal Nutrition Journal (2016), doi: 10.1016/j.aninu.2016.10.004.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1 Effects of feeding whole linseed on l uminal fatty acid composition and microbial

2 population in goats

5 Kamal Abuelfataha, Zuki Abu Bakarbc*, Goh Yeng Mengbd, Awis Qurani Sazilic,

6 Abdelrahim Abubakre

7 a Faculty of Animal Production, Khartoum University, Sudan

8 b Faculty of Veterinary Medicine, c Institute of Biosciences, d Department of Animal Science

9 Faculty of Agriculture, d Institute of Tropical Agriculture, University Putra Malaysia, 43400

10 UPM, Serdang, Selangor, Malaysia

11 e Department of Animal Nutrition, College of Animal Production, University of Bahri, 1660

12 Khartoum, Sudan.

13 Corresponding Author: Email: zuki@upm.edu.my. Tel: +60196046659

16 ABSTRACT

17 The objective of the present study was to evaluate the effect of feeding different levels of whole

18 linseed, as a source of n-3 polyunsaturated fatty acids (PUFA), on ruminal fatty acid composition

19 and microbial population in goat. Twenty-four crossbred Boer goats were assigned to three

20 dietary treatments: L0 (control), L10 and L20 containing 0%, 10%, or 20% whole linseed,

21 respectively. The ruminal pH and concentration of total volatile fatty acids (VFA) were not

22 affected by dietary treatments. The feeding of L10 and L20 diets produced higher (P < 0.05)

23 molar proportions of acetate and lower (P < 0.05) molar proportions of butyrate and valerate

24 than the L0 diet. Molar proportions of myristic acid (C14:0) and palmitic acid (C16:0) were

25 lower (P < 0.05) in the rumen of goats offered L10 and L20 diets than the control diet. However,

26 stearic acid (C18:0), vaccenic acid (C18:1 trans-11), conjugated linoleic acid (CLA, C18:2 trans-

27 10, cis-12) and a-lenolenic acid (C18:3 n-3) were higher (P < 0.05) in the rumen of goats fed

28 L10 and L20 than for L0. Both inclusion levels of linseed in the diet (L10 and L20) reduced the

29 ruminal total bacteria, methanogens, and protozoa compared with L0 (P < 0.05). The effect of

30 the dietary treatments on cellulolytic bacteria, varied between the individual species. Both

31 inclusion levels of linseed resulted in a significant decrease (P < 0.05) in the population of

32 Fibrobacter succinogenes, and Rumunococus flavefaciens compared with L0, with no significant

33 difference between the groups fed linseed diets. The population of Rumunococus albus was not

34 affected by the different dietary treatments. It was concluded that inclusion of whole linseed in

35 the diet of goats could increase the concentration of PUFA in the rumen, and decreased the

36 population of Fibrobacter succinogenes, Rumunococus flavefaciens, methanogens and protozoa

37 in rumen liquid of goats

39 Key words: Whole linseed, Rumen, Microbial population, Fatty acid, Goat.

45 1. Introduction

46 Feeding animals with sources of polyunsaturated fatty acids (PUFA) has been of interest in

47 animal nutrition to enhance these beneficial fatty in animal products, specifically n-3 PUFA,

48 which has been associated with significant physiological and health benefits in human

49 populations. Compared with monogastric animals, increasing PUFA in the ruminant products is

50 more challenging, since most of the PUFA in the animal diet are hydrogenated by the rumen

51 microorganisms. Yet, the inclusion of PUFA sources in the ruminant diets has been shown to

52 increase the concentration of n-3 PUFA in their meat (Palmquist, 2009). Furthermore,

53 incomplete biohydrogenation of linoleic acid (LA) and a-linolenic acid (ALA) results in

54 developing conjugated linoleic acids (CLA) isomers (Lee and Jenkins, 2011). CLA is now well

55 known as an anticarcinogenic, anti-atherosclerotic, antimutagenic, antioxidant, antibacteriogenic,

56 anti-diabetogenic, immunomodulator, and anti-obesity (Waghmare, 2013). Similar to CLA,

57 vaccenic acid is an intermediate product of the microbial biohydrogenation of LA and ALA

58 (Harfoot and Hazlewood, 1997). The increase of vaccenic acid in animal products is desirable

59 since it performs as a precursor in the biosynthesis of CLA (Griinari et al., 2000), and may exert

60 benefits similar to those related to CLA in humans (Field et al., 2009).

61 However, the presence of excessive amounts of PUFA in the rumen has a potential to radically

62 disturb ruminal pH, volatile fatty acids (VFA) and microorganisms survivability, which perform

63 a principal role in the overall process of ruminal fermentation (Machmüller et al., 1998; Maia et

64 al., 2010). However, the type and sources of PUFA fed to ruminant might have different impacts

65 on rumen fermentation and microbial population (Ivan et al., 2012; Liu et al., 2012). Also,

66 feeding plant based PUFA in the form of whole seeds might have less adverse effects on rumen

67 fermentation than feeding free oils (Palmquist, 1995). The effect of PUFA on ruminal microbes

68 differs depending on the type of microorganisms. For example, protozoa are more sensitive to

69 dietary PUFA than bacteria. PUFA may cause either a total defaunation or significant reduction

70 of the rumen protozoa population (Ivan et al., 2001). Within the bacteria species, feeding fish oil

71 (Liu et al., 2012) or plant based PUFA found to have different effects on growth of variours

72 especies (Zhang et al., 2008; Ivan et al., 2012).

73 Linseed (Linum usitatissimum) is considered as a leading source of plant based n-3 fatty acids

74 (FA) (Legrand et al., 2010), because it contains about 40% oil, with a high level of ALA (50 -

75 60% of total FA) (Legrand et al., 2010). Moreover, linseed contains a lower concentration of LA

76 and saturated FA (SFA) compared with other oilseeds such as soybeans, cottonseed, corn, and

77 sunflowers (Maddock et al., 2005). Numerous studies have been undertaken to enhance n-3

78 PUFA content in ruminant meat and milk by feeding linseed (Abuelfatah et al., 2014). However,

79 reports documenting the effects of feeding whole linseed on ruminal microorganisms are rare.

80 Therefore, the objective of the present study was to evaluate the influence of feeding different

81 levels of whole linseed, as a source of ALA n-3 PUFA, on ruminal microbial population of

82 goats, using real time polymerase chain reaction (RT-PCR). We also tested the effect on ruminal

83 pH, FA and VFA.

85 2. Materials and methods

86 2.1. Experimental animals, housing, feeds and feeding

87 Ruminal samples in the present study were collected at the end of feeding trial conducted in

88 small ruminant research unit, University Putra Malaysia. The experimental procedures have been

89 described in details (Abuelfatah et al., 2013). Briefly, twenty four 5-month-old crossed Boer

90 bucks with initial body weight (means and SE) of 14.23 ± 0.33 kg, were housed in individual

91 pens. After three weeks of adaptation, goats were randomly divided into three equal groups of

92 eight animals each, and assigned to one of the three dietary treatments. The dietary treatments

93 contained either 0% (L0), 10% (L10) or 20% (L20) whole linseed. The diets, ingredients and

94 chemical and FA composition are presented in Table 1. At the end of the feeding experiment,

95 which last for 110 days, all animals were slaughtered after overnight fasting. Animal care,

96 handling techniques, and slaughter procedures were approved by the University Putra Malaysia

97 Animal Care and Use Committee.

98 2.2. Proximate analysis of feed

99 The proximate analysis of the experimental feed was performed following the standard methods

100 of the Association of Official Analytical Chemists (AOAC) (AOAC, 2007). Briefly, feed

101 samples were dried in a forced-air oven for 24 h at 105 °C to determine dry matter (DM).

102 Nitrogen was determined by Kjeltec Auto Analyzer and then converted to crude protein (CP = N

103 x 6.25). Ether extract (EE) was determined by extracting the sample with petroleum ether (40 -

104 60 °C) using a Soxtec Auto Analyzer. Neutral detergent fiber (NDF), acid detergent fiber (ADF)

105 and acid detergent lignin (ADL) were determined by the methods outlined by Van Soest et al

106 (Van Soest et al., 1991) without adding alpha amylase and sodium sulfite. Values for NDF and

107 ADF were expressed inclusive of residual ash. Samples were ashed in a muffle furnace at 550°C

108 for 4 h to determine the ash content. Each analysis was performed in triplicate.

110 2.3. Rumen content sampling and pH measurement

111 Following animal slaughter, the esophagus was tied with nylon strings to conserve the ruminal

112 environment until sampling time, which occurred directly upon evisceration. Rumen content

113 was taken and squeezed through double layered gauze to remove the feed particles. About 100

114 mL of liquor was obtained from each animal. The pH of rumen liquid was measured instantly

115 using a pH meter (Mettler-Toledo Ltd., England). The samples were stored at -80 °C for FA and

116 VFA analysis, and microbial quantification.

117 2.4. FA and VFA determination

118 For FA analysis of rumen liquor, 2 mL of sample was used. Ruminal fatty acid composition was

119 determined following the procedure described by (Abuelfatah et al., 2014). The VFA contents of

120 the rumen liquor were measured using gas-liquid chromatography. The fixed rumen liquor (using

121 metaphosphoric acid, 4:1, vol/vol) was centrifuged at 15000 / g at 25 C° for 20 min, and 0.5 mL

122 of the supernatant was taken and added to an equal volume of internal standard (4-methyl-n-

123 valeric acids, Sigma Chemical Co., St. Louis, Missouri, USA). The separation was conducted on

124 a bonded phase fused silica capillary column 15 m, 0.32 mm ID, 0.25 (im film thickness

125 (Quadrex 007 Series (Quadrex Corporation, New Haven, CT 06525 USA) in an Agilent 7890a

126 Gas-Liquid Chromatography (Agilent Technologies, Palo Alto A, USA). The injector and

127 detector temperature was programmed at 220 and 230 °C, respectively. The column temperature

128 was adjusted in the range of 70- 150 °C with temperature programming at the rate of 7 °C/min

129 increments to assist optimum separation. The peaks identification was achieved by comparison

130 with accurate commercial standards of acetic, propionic, butyric, isobutyric, valeric, and

131 isovaleric (Sigma Chemical Co., St. Louis, Missouri, USA).

132 2.5. DNA extraction

133 The DNA was extracted from rumen liquor using the QIAamp DNA mini stool kit (Qiagen,

134 Hilden, GmbH, Germany) following the manufacturer's protocol with a few modifications as

135 described by (Abubakr et al., 2014). Real-time PCR was carried out using the BioRad CFX96

136 Touch (Bio-Rad laboratories, Inc., Hercules, CA, USA) with fluorescence detection of SYBR

137 Green dye using MicroAmp tube strips and MicroAmp Optical Cap Strips. Primers used to

138 quantify the population of various microbes groups are presented in Table 2. The PCR reaction

139 was achieved on a total volume of 25 mL using the iQTMSYBR Green Supermix assay (BioRad,

140 USA). Each reaction comprised 12.5 ¡iL SYBR Green Supermix, 1 ¡iL of each Primer, 2 ¡iL of

141 DNA samples and 8.5 ¡iL H20. The reaction settings for DNA amplification were one cycle at 95

142 °C for 5 min for initial denaturation followed by 40 cycles of 95 °C for 30 seconds then by

143 annealing temperatures for various primers as described in Table 2 for 30 sec and then at 72 °C

144 for 30 sec. For confirming the specificity of amplification, melting curve examination was

145 performed after each last amplification cycle. Detection of the fluorescent product was adjusted

146 at the last step of each cycle. Standards were prepared from Plasmid DNA from each microbial

147 group. The concentration of the extracted DNA was measured using a UV spectrophotometer.

148 The number of copies of a template DNA/mL of elution buffer was calculated online using the

149 web site (http://scienceprimer.com/copv-number-calculator-for-realtime-pcr ) based on the

150 following formula:

Amount of DNA (ng/mL) x 6.022 x 1023

Number of copies =---—-r—--—--——-

F length (bp) x 109 x 660

152 Standard curves were created by serial dilution of plasmid DNA of each microbial group

153 (Faseleh Jahromi et al., 2013).

154 2.7. Statistical analysis

155 Data of rumen fermentation parameters and microbial population were subjected to one-way

156 analysis of variance using the GLM procedure of SAS (SAS, 2003). Microbial data which did

157 not meet the normality requirement were subjected to loglO-transform before analysis. Least-

158 square means were computed and tested for differences by Duncan multiple range test.

159 Differences between least squared means were considered to be significant at P < 0.05, and data

160 were presented as means ± standard errors.

161 3. Results

162 3.1. Ruminal FA composition

163 The ruminal FA profile of goats fed diets containing different levels of whole linseed is

164 presented in Table 3. The most abundant FA in the rumen for all experimental groups was stearic

165 acid (C18:0). However, C18:0 was significantly (P < 0.05) higher in the animals fed linseed

166 (L10 and L120) than those in the control group (L0). The palmitic (16:0) acid represented the

167 second abundant FA in the rumen digesta in all experimental groups, and it was significantly (P

168 < 0.05) higher in L0 than in L10 and L20. Feeding linseed at the both inclusion levels (10% and

169 20%) significantly (P < 0.05) increased the proportions of vaccenic (C18:1 trans-11), CLA

170 C18:2 trans-10, cis-12, and ALA (C18:3 n-3). However, no significant effect P > 0.05 has been

171 observed in the proportion of oleic (C18:1 n-9), LA (C18:2 n-6), CLA isomer C18:2 cis-9, trans-

172 11, and arachidonic (C20:4 n-6). Feeding linseed also resulted in a significant decrease in the n-

173 6:n-3 ratio in rumen liquor compared with the control.

175 3.2. VFA and pH of rumen liquor

176 The VFA and the rumen pH of goats fed diets containing different levels of whole linseed are

177 presented in Table 4. The concentration of total VFA in the rumen and pH was not affected by

178 dietary treatments. However, whole linseed inclusion in the diet of goats significantly increased

179 (P < 0.05) the molar proportion of acetate and decreased (P < 0.05) the molar proportion of

180 butyrate and valerate with no effects on the other individual VFA.

182 3.3. Rumen microbial populations

183 The effects of feeding different levels of whole linseed as a source of ALA n-3 PUFA on rumen

184 microbial populations of goats are presented in Table 5. In the present study, the total bacteria in

185 the rumen were significantly affected by the dietary treatments. The concentration of total

186 bacteria was lower (P < 0.05) in the rumen of goats fed linseed diets (L10 and L20 diets) than in

187 those fed control diet (L0). However, no significant difference (P > 0.05) was observed between

188 L10 and L20. Among the individual cellulolytic species, Rumunococus albus was not affected by

189 dietary treatments, whereas the concentration of Fibrobacter succinogenes, and Rumunococus

190 flavefaciens were lower (P < 0.05) in goats that received L10 and L20 than in those fed L0.

191 Similar to total bacteria and cellulolytic bacteria species, the population of total methnogens and

192 protozoa were reduced (P < 0.05) in both inclusion levels (L10 and L20) compared with L0 with

193 no differences between L10 and L20.

195 4. Discussion

196 Inclusion of sources of PUFA in animal diets comes mainly to increase these beneficial FA in

197 animal products. In our previous studies, it has been reported that inclusion of whole linseed in

198 diets resulted in increasing the proportion of ALA and total n-3 PUFA in goat muscles and

199 adipose tissues as the inclusion level of linseed increased (Abuelfatah et al., 2014). The growth

200 performance and apparent digestibility were not affected by inclusion of linseed in level of 10%

201 or 20%; however, at the level of 20%, the feed intake was negatively affected (Abuelfatah et al.,

202 2013). The objective of this study was to examine the effects of feeding different levels (0%,

203 10% or 20%) of whole linseed, as a source of n-3 PUFA, FA composition of ruminal digesta and

204 some microbial population.

205 The proportions of palmitic acid (C16:0) in the rumen digesta of experimental groups mirror that

206 of their diets (Tables 1 and 3). The greatest concentration of C16:0 in the rumen coming from

207 animals fed the diet with the highest C16:0 concentrations was also reported by (Kim et al.,

208 2007). However, stearic (C18:0) was offered in the diets at a low proportion (3.23% to 5.92% of

209 total FA), but it represented the major FA in the rumen digesta (48.69% to 67.32% of total FA)

210 (Table 2). However, the 18-carbon UFA (C18:3 n-3, C18:2 n-6, and C18:1 n-9), which represent

211 the major FA in experimental diets, were detected in low proportion in the rumen digesta. The

212 increase in C18:0 and decrease in 18-carbon unsaturated FA (UFA) indicated that a considerable

213 amount of 18-carbon UFA was subjected to biohydrogenation since C18:0 is the end product of

214 biohydrogenation of these FA (Harfoot and Hazlewood, 1997; McKain et al., 2010). However,

215 the significantly higher proportion of ALA in the rumen digesta of goats fed linseed compared

216 with L0 can indicate that feeding whole linseed as a source of ALA was provided partial

217 protection from biohydrogenation, even though the digesta were collected after 24 h of animals

218 feeding. The significant increment in the proportion of vaccenic (C18:1 trans-11), and C18:2

219 trans-10, cis-12 CLA in animal fed linseed diets was expected since these trans-FA are

220 intermediate products in biohydrogenation of unsaturated 18-carbon FA (Harfoot and

221 Hazlewood, 1997; Kim et al., 2007; Lee and Jenkins, 2011). However, the cis-9 trans11 CLA

222 was not significantly affected by level of linseed, because the cis-9 trans-11 CLA is the main

223 CLA isomer during the biohydrogenation of LA rather than ALA (Lee and Jenkins, 2011). We

224 noted that the pattern of FA composition of ruminal digesta of the experimental animals in this

225 study resembles the pattern of FA composition of muscles taken from the same animals. The data

226 related to FA composition of muscles has been published (Abuelfatah et al., 2013; Abuelfatah et

227 al., 2016).

228 It is well known that ruminal pH is an important characteristic for assessing the fermentation in

229 the rumen (Liu et al., 2012). In the present study, the absence of any influence of feeding whole

230 linseed on ruminal pH and total concentration of VFA in goats (Table 4) agrees with previous

231 studies in lactating dairy cows fed diets containing about 10% (wt/wt) of crushed sunflower, flax,

232 or canola seeds (Beauchemin et al., 2009), and in sheep fed diets containing linseed oil (Ueda et

233 al., 2003; Kim et al., 2007). In contrast, (Czerkawski et al., 1975) reported decreased total VFA

234 concentration when the diet supplemented with 90 g linseed oil/d. The different effect of PUFA

235 on the proportions of individual VFA is also reported by (Machmuller et al., 2000; Soder et al.,

236 2012). The reduction in molar proportion of butyrate in this study agrees with what concluded

237 previously by Beauchemin et al. (2009) that the molar proportion of butyrate decreases with

238 oilseed supplementation.

239 Ruminal microorganisms (bacteria, protozoa, and fungi) establish the key link between the diets

240 and the ruminant animal (Weimer et al., 1999). The VFA result from the fermentation activity of

241 these microorganisms as well as the microbial protein are digested and absorbed by the host for

242 growth and production. Therefore, the study of rumen microbiology is fundamental for a greater

243 understanding of the feed utilization and metabolic disorders of ruminants. Studies on the effects

244 of lipids, especially PUFA on rumen microbes have attracted considerable interest not only due

245 to the human health aspects, but also for environmental issues. In this study, the reduction in

246 population of the total bacteria in L10 and L20 compared with L0 can be attributing to their high

247 lipid content. Dietary lipids could inhibit the growth of bacteria in the rumen (Harfoot and

248 Hazlewood, 1997; Maia et al., 2010). The total rumen bacteria were not affected by feeding

249 oilseeds containing high concentrations of LA, ALA in cattle (Ivan et al., 2012), or linseed oil in

250 goats (Ebrahimi, 2012) when the lipid content of the diet was similar to or less than the control,

251 but the effect of PUFA on bacterial populations is not the same. Bacterial populations that are

252 relevant for fiber digestion and biohydrogenation have been found to be sensitive to PUFA.

253 Therefore, the impact of PUFA supplementation on ruminal bacteria should be made by

254 examining specific bacterial species rather than the total number of bacteria (Liu et al., 2012).

255 The results of the present experiment indicated different effects of feeding whole linseed on the

256 selected strains of rumen bacteria. Fibrobacter succinogenes, Rumunococus flavefaciens, and

257 methanogen are strongly inhibited by inclusion of whole linseed, whereas the population of

258 Rumunococus albus was not affected negatively by the treatment diets. The reduction in the

259 population of Fibrobacter succinogenes has been reported previously in cattle fed dietary PUFA

260 (Ivan et al., 2012; Liu et al., 2012). The effect of PUFA on Rumunococus flavefaciens varied

261 among comparable studies. Ebrahimi (2012) reported a reduction in Rumunococus flavefaciens

262 in goat fed linseed oil. In contrast, Ivan et al. (2012) reported an increase in Rumunococus

263 flavefaciens population in dairy cattle. The different findings can be attributed to level

264 concentration of PUFA in the rumen. The growth of Rumunococus flavefaciens increases when

265 PUFA in the rumen were at a low level, but decreases when these acids were fed higher levels

266 (Zhang et al., 2008). The Rumunococus albus, which is the most important cellulolytic bacteria,

267 was not affected negatively by the treatment diets. This finding is in agreement with Zhang et al.

268 (2008) and Liu et al. (2012). However, Ivan et al. (2012) and Ebrahimi (2012) reported

269 increasing in population of Rumunococus albus when cattle and goats were fed PUFA,

270 respectively.

271 The production of methane during fermentation in the rumen is an energy loss to ruminants but

272 also has a potential impact on the environment (Moss et al., 2000). Therefore, decreasing

273 methane production in ruminants has significance for efficient animal production and for global

274 environmental protection (Zhang et al., 2008). Methane is produced by the metabolic activity of

275 the methanogens in the rumen (Tan et al., 2011). Protozoa are also involved in methanogenesis,

276 because protozoa produce H2, which is utilized by methanogens to produce methane (Vogels et

277 al., 1980). In this study, both inclusion levels of linseed in the diets significantly decreased the

278 population of methanogens and protozoa in rumen liquid of goats. In general, adding lipids to the

279 diets of ruminants is a promising strategy to decrease the methane emissions due to the toxic

280 effects of free FA on both methanogens and protozoa (Van Nevel and Demeyer, 1996; Maia et

281 al., 2010). The limited ability of methanogens and protozoa to absorb and transform lipids leads

282 to swelling and consequent rupture of the protozoa cells (Girard and Hawke, 1978).

284 5. Conclusion

285 Inclusion of linseed in the diet of goats at either 10% or 20% increases the molar proportion of

286 acetate and decreased molar proportion butyrate and valerate. Feeding linseed also promotes

287 changes in rumen microbial populations, such that both inclusion levels significantly decreased

288 the population of Fibrobacter succinogenes, Rumunococus flavefaciens, methanogens and

289 protozoa in rumen liquid of goats.

291 References

292 Abubakr A, Alimon AR, Yaakub H, Abdullah N. & Ivan M. Effect of Feeding Palm Oil By-

293 Products Based Diets on Total Bacteria, Cellulolytic Bacteria and Methanogenic Archaea

294 in the Rumen of Goats. PloS one. 2014; 9(4): e95713.

295 Abuelfatah K, Zakaria MZAB, Meng, G. Y. & Sazili A. Q. Changes in Fatty Acid Composition

296 and Distribution of N-3 Fatty Acids in Goat Tissues Fed Different Levels of Whole

297 Linseed. The Sci. World J. 2014; 2014.

298 Abuelfatah K, Zuki, A, Goh, Y. & Sazili A. Effects of Enriching Goat Meat with n-3

299 Polyunsaturated Fatty Acids on Meat Quality and Stability. Small Rumin. Res.: 2016.

300 Abuelfatah K, Zuki ABZ, Goh, Y. M. & Sazili A. Q. Effects of dietary n-3 fatty acids on growth

301 performance, apparent digestibility, and carcass characteristics of crossbred Boer goat

302 under tropical conditions. Asian J. Anim. Vet. Adv. 2013; 8(6): 775-785.

303 AOAC (2007). Official Methods of Analysis, edited by K. Herlick, Association of Official

304 Analytical Chemists, Arlington, Va, USA, 15th edition.

305 Beauchemin K, McGinn S, Benchaar C. & Holtshausen L. Crushed sunflower, flax, or canola

306 seeds in lactating dairy cow diets: effects on methane production, rumen fermentation,

307 and milk production. J. dairy Sci. 2009; 92(5): 2118-2127.

308 Czerkawski J, Christie W, Breckenridge G. & Hunter M. L. Changes in the rumen metabolism of

309 sheep given increasing amounts of linseed oil in their diet. Br. J. Nutr: 1975; 34: 25-44.

310 Denman SE. & McSweeney CS. Development of a real-time PCR assay for monitoring

311 anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microb.

312 Ecol. 2006; 58(3): 572-582.

313 Ebrahimi M. Production of Omega-3 Polyunsaturated Fatty Acids Enriched Choven Using

314 Treated Oil Palm (Elaeis guineensis jacq) Fronds. Vol. Ph.D: 2012; Universiti Putra

315 Malaysia.

316 Faseleh Jahromi M, Liang JB, Mohamad R, Goh YM, Shokryazdan P. & Ho YW. Lovastatin-

317 enriched rice straw enhances biomass quality and suppresses ruminal methanogenesis.

318 2013; BioMed Res. International.

319 Field CJ, Blewett HH, Proctor S. & Vine D. Human health benefits of vaccenic acid. Appl.

320 Physiol., Nutr., Met. 2009; 34(5): 979-991.

321 Girard V. & Hawke J. The role of holotrichs in the metabolism of dietary linoleic acid in the

322 rumen BBA-Lipid Lipid Met. 1978; 528(1): 17-27.

323 Griinari J, Corl B, Lacy S, Chouinard P, Nurmela K. & Bauman D. Conjugated linoleic acid is

324 synthesized endogenously in lactating dairy cows by A9-desaturase. J. Nutr. 2000;

325 130(9): 2285-2291.

326 Harfoot C. & Hazlewood G. (1997).Lipid metabolism in the rumen. In The rumen microbial

327 ecosystem, 382-426 (Eds P. N. Hobson and C. S. Stewart). London: Springer.

328 Ivan M, Mr P, Koenig K, Rode L, Neill L, Entz T. & Mir Z. Effects of dietary sunflower seed

329 oil on rumen protozoa population and tissue concentration of conjugated linoleic acid in

330 sheep. Small Rumin. Res. 2001; 41(3): 215-227.

331 Ivan M, Petit H, Chiquette J. & Wright A-D. Rumen fermentation and microbial population in

332 lactating dairy cows receiving diets containing oilseeds rich in C-18 fatty acids. Br.J.

333 Nutr. 2012; 1(1): 1-8.

334 Kim S, Adesogan A, Badinga L. & Staples C. Effects of dietary n-6: n-3 fatty acid ratio on feed

335 intake, digestibility, and fatty acid profiles of the ruminal contents, liver, and muscle of

336 growing lambs. J. Anim. Sci. 2007; 85(3): 706-716.

337 Koike S. & Kobayashi Y. Development and use of competitive PCR assays for the rumen

338 cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus

339 flavefaciens. FEMS Microbiol. Lett. 2001; 204(2): 361-366.

340 Lee YJ. & Jenkins TC. Biohydrogenation of linolenic acid to stearic acid by the rumen microbial

341 population yields multiple intermediate conjugated diene isomers. J. Nutr. 2011; 141(8):

342 1445-1450.

343 Legrand P, Schmitt B, Mourot J, Catheline D, Chesneau G, Mireaux M, Kerhoas N. & Weill P.

344 The consumption of food products from linseed-fed animals maintains erythrocyte

345 omega-3 fatty acids in obese humans. Lipids. 2010; 45(1): 11-19.

346 Liu S, Bu D, Wang J, Liu L, Liang S, Wei H, Zhou L, Li D. & Loor J. Effect of incremental

347 levels of fish oil supplementation on specific bacterial populations in bovine ruminal

348 fluid. J.Anim. physiol. Anim. Nutr. 2012; 96(1): 9-16.

349 Machmuller A, Ossowski D. & Kreuzer M. Comparative evaluation of the effects of coconut oil,

350 oilseeds and crystalline fat on methane release, digestion and energy balance in lambs.

351 Anim. Feed Sci. Technol. 2000; 85(1): 41-60.

352 Machmuller A, Ossowski D, Wanner M & Kreuzer M. Potential of various fatty feeds to reduce

353 methane release from rumen fermentation in vitro (Rusitec). Anim. Feed Sci. Technol.

354 1998; 71(1): 117-130.

355 Maddock TD, Anderson VL. & Lardy GP. (2005). Using flax in livestock diets. NDSU Extension

356 Service.

357 Maia MR, Chaudhary LC, Bestwick CS, Richardson AJ, McKain N, Larson TR, Graham IA. &

358 Wallace RJ. Toxicity of unsaturated fatty acids to the biohydrogenating ruminal

359 bacterium, Butyrivibrio fibrisolvens. BMC microbiol. 2010; 10(1): 52.

360 McKain N, Shingfield KJ. & Wallace RJ. Metabolism of conjugated linoleic acids and 18: 1 fatty

361 acids by ruminal bacteria: products and mechanisms. Microbiol. 2010; 156(2): 579-588.

362 Moss AR, Jouany JP. & Newbold J. (2000).Methane production by ruminants: its contribution to

363 global warming. In Annales de Zootechnie, Vol. 49, 231-254: Paris: Institut national de la

364 recherche agronomique, 1960-2000.

365 Palmquist D. Omega-3 fatty acids in metabolism, health, and nutrition and for modified animal

366 product foods. Prof.Anim. Sci. 2009; 25(3): 207-249.

367 Palmquist, DL. Digestibility of cotton lint fiber and whole oilseeds by ruminal microorganisms.

368 Anim. Feed Sci. Technol. 1995; 56(3): 231-242.

369 SAS (2003). User's Guide: Statistics. 9.1 ed. Cary, NC.: SAS Institute Inc.

370 Soder K, Brito A, Rubano M. & Dell C. Effect of incremental flaxseed supplementation of an

371 herbage diet on methane output and ruminal fermentation in continuous culture. J. dairy.

372 Sci. 2012; 95(7): 3961-3969.

373 Sylvester JT, Karnati SK, Yu Z, Morrison M. & Firkins JL. Development of an assay to quantify

374 rumen ciliate protozoal biomass in cows using real-time PCR. J. Nutr. 2004; 134(12):

375 3378-3384

376 Tan HY, Sieo CC, Abdullah N, Liang JB, Huang XD. & Ho YW. Effects of condensed tannins

377 from Leucaena on methane production, rumen fermentation and populations of

378 methanogens and protozoa in vitro. Anim. Feed Sci. Technol. 2011; 169(3-4): 185-193.

379 Ueda K, Ferlay A, Chabrot J, Loor J, Chilliard Y. & Doreau M. Effect of linseed oil

380 supplementation on ruminal digestion in dairy cows fed diets with different forage:

381 concentrate ratios. J. dairy Sci. 2003; 86(12): 3999-4007.

382 Van Nevel C. & Demeyer D. Influence of pH on lipolysis and biohydrogenation of soybean oil

383 by rumen contents in vitro. Reprod. Nutr. Dev. 1996; 36: 53-63.

384 Van Soest PJ, Robertson J. & Lewis B. Methods for dietary fiber, neutral detergent fiber, and

385 nonstarch polysaccharides in relation to animal nutrition. J. dairy Sci. 1991; 74(10):

386 3583-3597.

387 Vogels GD, Hoppe WF. & Stumm CK. Association of methanogenic bacteria with rumen

388 ciliates. Appl. Environ. Microbiol. 1980; 40(3): 608-612.

389 Waghmare JS. Conjugated linoleic acid: a significant review. Ind. J. Sci. 2013; 2(3): 8-12.

390 Weimer PJ, Waghorn GC, Odt CL. & Mertens DR. Effect of Diet on Populations of Three

391 Species of Ruminal Cellulolytic Bacteria in Lactating Dairy Cows. J. dairy Sci. 1999;

392 82(1): 122-134.

393 Zhang CM, Guo YQ, Yuan ZP, Wu YM, Wang JK, Liu JX. & Zhu WY. Effect of octadeca

394 carbon fatty acids on microbial fermentation, methanogenesis and microbial flora in

395 vitro. Anim. Feed Sci. Technol. 2008; 146(3-4): 259-269.

396 Table 1. Ingredients and composition of diets fed to goats.

Experimental diets1

Ingredient, % DM L0 L10 L20

Whole linseed - 10 20

PKC 40 30 20

Soybean meal 11 9 6

Corn 20 20 20

Rice straw 20 20 20

Molasses 4 9 5

Palm oil 3 - -

Caco3 1 1 1

Salt 0.5 0.5 0.5

Mineral and vitamin mix 0.5 / 0.5 0.5

Chemical composition, % of DM

Dry matter 89.79 89.22 90.17

Crude protein 14.25 14.45 14.69

Ether extract ^ 4.86 5.09 7.38

NDF 48.58 46.63 48.30

ADF 30.10 27.34 27.09

Ash 10.19 9.32 9.14

Metabolizable energy , MJ/kg 11.30 11.00 11.00

Fatty acid composition, g/100 g fatty acids

C12:0, lauric 5.28 3.17 1.97

C14:0, myristic 2.46 1.03 0.31

C16:0, palmitic 28.07 9.61 7.89

C16:1, palmitoleic 0.25 0.21 0.17

C17:0, heptadecanoic 0.72 0.39 0.38

C18:0, stearic 5.92 3.23 4.93

C18:1 n-9, oleic 33.48 27.67 27.06

C18:2 n-6, linoleic 21.88 21.25 18.00

C18:3 n-3, linolenic 1.92 33.42 39.27

397 L0 = control diet, containing 0% whole linseed; L10 = diet containing 10% whole

398 linseed; L20 = diet containing 20% whole linseed.

ACCEPTED MANUSCRIPT

401 Table 2. Rumen microbial primer sequences used for real-time PCR assay.

Target microorganism Primer sequence (5'- 3') Annealing temperature Reference

Total bacteria F Total bacteria R CGGCAACGAGCGCAACCC CCATTGTAGCACGTGTAGCC 60 °C (Denman and McSweeney, 2006)

Rumunococus albus F Rumunococus albus R CCCTAAAAGCAGTCTTAGTTGG CCTCCTTGCGGTTAGAACA 55 °C (Koike and Kobayashi, 2001)

Rumunococus flavefaciens F Rumunococus flavefaciens R CGAACGGAGATAATTTGAGTTTACTTAGG CGGTCTCTGTATGTTATGAGGTATTACC 60 °C (Koike and Kobayashi, 2001)

Fibrobacter succinogenes F Fibrobacter succinogenes R GTTCGGAATTACTGGGCGTAAA CGCCTGCCCCTGAACTATC 55 °C (Koike and Kobayashi, 2001)

Methanogens F Methanogens R TTCGGTGGATCDCARAGRGC GBARG TCGWA WCCGT AGAAT CC 58 °C (Zhang et al., 2008)

Total protozoa F Total protozoa R CTTGCCCTCYAATCGTWCT GCTTTCGWTGGTAGTGTATT 55 °C (Sylvester et al., 2004)

404 F = forward; R = reverse.

408 Table 3. Effect of feeding different levels of whole linseed on goat's rumen fatty acid profiles.1

Fatty acids _Experimental diets_P-value

L0 L10 L20

C12:0, lauric 3.02 ± 0.25 ND ND -

C14:0, myristic 3.99a ± 0.40 0.67b ± 0.40 0.95b ± 0.34 <0.01

C14:1, myristoleic 0.70 ± 0.04 0.27 ± 0.04 0.66 ± 0.30 0.17

C15:0, pentadecanoic 0.61a ± 0.06 0.44b ± 0.06 ND 0.01

C15:1, pentadecanoic 0.63 ± 0.10 ND ND -

C16:0, palmitic 25.12a ± 0.36 11.95b ± 0.36 9.58b ± 1.47 0.00

C16:1, palmitoleic 1.52 ± 0.85 1.05 ± 0.85 0.57 ± 0.22 0.45

C17:0, heptadecanoic 1.36 ± 0.54 0.78 ± 0.54 0.63 ± 0.12 0.27

C17.1, heptadecenoic ND ND 0.10 ± 0.03 -

C18:0, stearic 48.69b ± 2.28 66.34a ± 2.28 67.32a ± 3.72 <0.01

C18:1 n-9 cis, oleic 7.75 ± 3.28 8.09 ± 3.28 10.60 ± 2.59 0.70

C18:1 trans-11, vaccenic 2.53b ± 0.42 3.91a ± 0.42 3.49a ± 0.78 0.04

C18:2 n-6, linoleic 1.56 ± 0.42 2.26 ± 0.42 2.35 ± 0.60 0.39

C18:2 cis-9, trans-11. CLA 0.50 ± 0.24 0.96 ± 0.34 0.82 ± 0.26 0.39

C18:2 trans-10, cis-12, CLA 0.29b ± 0.15 0.65a ± 0.15 0.88a ± 0.30 0.07

C18:3 n-3, a-linolenic 0.75b ± 0.14 1.44a ± 0.14 1.59a ± 0.16 0.04

C20:4 n-6, arachidonic 0.78 ± 0.10 0.98 ± 0.10 0.46 ± 0.17 0.47

SFA2 82.80 ± 2.92 80.41 ± 2.92 78.49 ± 2.63 0.48

UFA3 17.20 ± 2.92 19.59 ± 2.92 21.51 ± 2.63 0.48

MUFA4 12.53 ± 3.29 13.71 ± 3.29 15.42 ± 2.74 0.73

PUFA n-35 0.75b ± 0.14 1.44a ± 0.14 1.59a ± 0.16 0.06

PUFA n-66 2.34 ± 0.34 3.24 ± 0.34 2.80 ± 0.50 0.32

Total CLA7 0.79b ± 0.30 1.61a ± 0.30 1.70a ± 0.55 0.06

PUFA n-6/n-3 ratio 3.63a ± 0.14 2.44b ± 0.19 1.75b ± 0.16 0.01

UFA/SFA 0.21 ± 0.04 0.24 ± 0.02 0.28 ± 0.04 0.49

PUFA/SFA 0.04 ± 0.001 0.06 ± 0.001 0.06 ± 0.01 0.17

410 L0 = control diet, containing 0% whole linseed; L10 = diet containing 10% whole linseed; L20 =

411 diet containing 20% whole linseed; ND = not detected; SFA = saturated fatty acids; UFA =

412 unsaturated fatty acids; MUFA = monounsaturated fatty acids; PUFA =; CLA =.

413 a,b,c Values with different superscripts within a row differ significantly at P < 0.05

414 1 Data are presented as means ± SEM of total fatty acids (g/100 g).

415 2 SFA = C12:0 C14:0+C15:0+C16:0+C17:0+ C18:0.

416 3 UFA = C14:1 + C16:1 + C17:1 + C18:1n-9 trans + C18:2 + C18:3 + C20:4, C22:6, C20:5n-3 +

417 C22:5-3 + C22:6n-3.

418 4 MUFA = C14:1+C15:1+C16:1+C17:1+C18:1 n-9 trans+C18:1 n-9 cis+C18:1 n-7+C20:1 n-9.

419 5 PUFA n-3 = C18:3n-3 + C20:5n-3 + C22:5n-3 + C22:6n-3.

420 6 PUFA n-6 = C18:2 n-6+C20:2 n-6+C20:3 n-6.

421 7 Total CLA = C18:2 cis-9, trans-11+ C18:2 trans-10, cis-12, CLA.

422 Table 4. Effect of feeding different levels of whole linseed on ruminal volatile fatty acid

423 concentration and pH in goats

Item Treatment diets P-value

L0 L10 L20

Total VFA, mmol/L Acetate, mol/100 mol 69.72 ± 3.02 36.98b ± 1.02 65.09 ± 4.03 38.57ab ± 071 70.37 ± 2.54 39.99a ± 0.45 0.47 0.04

Propionate, mol/100 mol 28.94 ± 0.89 30.22 ± 0.92 30.55 ± 1.02 0.64

Butyrate, mol/100 mol 23.89a ± 0.68 21.87b ± 0.65 20.31b ± 0.55 0.05

Isobutyrate, mol/100 mol 3.83 ± 0.44 3.01 ± 0.19 ^3.12 ± 0.17 0.79

Valerate, mol/100 mol 3.82a ± 0.26 3.06b ± 0.12 ^3.12b ± 0.08 0.02

Isovalerate, mol/100 mol 2.41 ± 0.21 2.20 ± 0.38 2.26 ± 0.08 0.83

Acetate: propionate 1.28 ± 0.06 1.28 ± 0.06 1.32 ± 0.03 0.89

pH 6.16 ± 0.04 6.28 ± 0.06 6.26 ± 0.04 0.13

426 L0 = control diet, containing 0% whole linseed; L10 = diet containing 10% whole linseed; L20 =

427 diet containing 20% whole linseed.

428 a,b Values with different superscripts within a row differ significantly at P < 0.05

446 Table 5. Effect of feeding different levels of whole linseed on rumen microbial population

447 (copies/mL) in goats

Microorganism ^ . ... . „ ,

Treatment diets P-value

L0 L10 L20

Total bacteria (x1010) 3.80a ± 0.82 0.84b ± 0.25 0.67b ± 0.13 <0.001

Rumunococus albus (*106) 2.20 ± 0.56 2.18± 0.68 2.14± 0.85 0.68

Rumunococus flavefaciens (*106) 1.42a ± 0.56 0.17b ± 0.06 0.15b± 0.07 0.016

Fibrobacter succinogenes (*104) 9.36a ±1.50 1.27b ± 0.57 1.62b±0.49 0.003

Total methanogens (*106) 5.86a ± 1.02 0.92b ± 0.15 0.87b ± 0.23 0.003

Total protozoa (x105) 2.81a ± 0.94 0.34b ± 0.03 0.23b ± 0.03 <0.001

450 L0 = control diet, containing 0% whole linseed; L10 = diet containing 10% whole linseed; L20 =

451 diet containing 20% whole linseed.

452 a,b Values with different superscripts within a row differ significantly at P < 0.05.