Scholarly article on topic 'Altered KATP channel subunits expression and vascular reactivity in spontaneously hypertensive rats with age'

Altered KATP channel subunits expression and vascular reactivity in spontaneously hypertensive rats with age Academic research paper on "Biological sciences"

0
0
Share paper
OECD Field of science
Keywords
{""}

Academic research paper on topic "Altered KATP channel subunits expression and vascular reactivity in spontaneously hypertensive rats with age"

Journal of Cardiovascular Pharmacology Publish Ahead of Print DOI: 10.1097/FJC.0000000000000394

Manuscript Revised CLEAN

VASCULAR

Altered KATP channel subunits expression and vascular reactivity in spontaneously hypertensive rats with age

Xiaojing Liu1, Peng Duan1, Xingxing Hu1, Ruisheng Li2, Qinglei Zhu1

1. Department of Cardiology, Chinese PLA General Hospital, Beijing, 100853, China

2. Research and Technology Service Center, 302 Hospital of PLA, China.

Running title: Alteration of Katp channel subunits expression and function in SHR

This work was supported by the grant from the National Natural Science Foundation of China (81070200, 81570349).

Correspondence to: Qing-Lei Zhu, PhD., Department of Cardiology, Chinese PLA Hospital, 28 Fuxing Road, Beijing 100853, China. E-mail: qlzhu@yahoo.com Tel: +86-10-66936781 Fax: +86-10-66936781

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially.

lic state to regulate

Abstract

ATP-sensitive potassium (KATP) channels link membrane excitability to metabolic a series of biological activities including the vascular tone. However, their ability to influence hypertension is controversial. Here we aim to investigate possible alteration of KATP channel in vascular smooth muscle (VSM) during hypertension development process. In this study, we used sixteen-week-old spontaneously hypertensive rats (SHR), forty-nine-week-old SHR and their age-matched Wistar-Kyoto rats (WKY) to study the expression of VSM KATP subunits at mRNA and protein level as well as the function of VSM KATP by observing isolated aorta rings' relaxation reactivity to KATP modulators. We found the expression of VSM KATP subunits Kir6.1 and SUR2B decreased during hypertension. Moreover, the expression of SUR2B and Kir6.1 in 49 weeks SHR decreased much more than that in 16 weeks SHR. Furthermore, the aorta rings of 49 weeks showed lower reactivity to diazoxide than 16 weeks SHR. This study suggests that KATP channels in vascular smooth muscle subunit Kir6.1 and SUR2B contribute to modify the functionality of this channel in hypertension with age. Key Words: KATP channel, hypertension, mitoKATP, diazoxide, in vitro

INTRODUCTION

Hypertension, a worldwide cardiovascular disease affects over 30% of the population, defined as a complex, multifactorial, environmental, quantitative trait under a polygenic control.1 It is known that the contraction and relaxation of vascular smooth muscle (VSM) are related to membrane potential, which is critically determined by the activity of potassium channel.2 KATP channels exist in VSM beds and play an important role in the regulating vascular tone.3' 4 In addition, the channel openers result in the decrease of blood pressure.5, 6 Moreover, the channel blockers abolish the pharmacological function of channel openers to lower blood pressure.7, 8 The KATP channel is composed of a hetero-octameric complex constituted of an inward rectifier potassium channel (Kir6.1 and Kir6.2) and a sulfonylurea receptor (SUR1, SUR2A and SUR2B), which is characterized by the inhibition of ATP and the activation of MgADP.9 The Kir6.x, pore-forming subunit responses for the ATP sensitivity, while the SURx confers to sulfonylurea sensitivity and determines efficacy of potassium channel openers (KCOs).10 KATP in different tissue is composed of different Kir and SUR subunits "mix and match". Sarcolemmal KATP (sarcKATP) channel of VSM are mainly constituted by Kir6.1/SUR2B,11 which are activated by nucleoside diphosphates (NDPs) rather insensitive to ATP.

KATP channels act as important metabolic sensor and target of the response of VSM to a number of pharmacological and endogenous vasodilators: adenosine, prostacyclin, a-adrenoceptor agonist, Nitric Oxide (NO), neurotransmitters, calcitonin-gene related peptide (CGRP), vasoactive intestinal peptide, angiotensin II, vasopressin, noradrenaline, neuropeptide Y, endothelin and serotonin.12-14 Therefore, they probably participate in the process of hypertension. In this present study, we used sixteen-week-old SHR, forty-nine-week-old SHR and their age-matched WKY to study the expression of VSM KATP subunits at mRNA and protein level as

well as the function of VSM KATP by observing isolated aorta rings' relaxation reactivity to KATP modulators. We aim to clarify the alteration of the expression and the function of KATP channels in hypertension at different age.

MATERIALS AND METHODS

Animals

All experimental animals were purchased from Vital River Laboratories (Beijing, China). WKY and SHR were randomly divided into four groups: 16-week-old WKY, 16-week-old SHR, 49-week-old WKY, and 49-week-old SHR. Conscious rats were instrumented with tail-cuff system (Kent Scientific, USA) to record blood pressure. Systolic blood pressure, diastolic blood pressure, and mean blood pressure were measured when rat tails at 31°C as previously described.15 The investigation conforms to the Guidelines for the Care and Use of Laboratory Animals and the procedures for care and use of animals were approved by the Ethics Committee of Chinese PLA General Hospital. Vessel Contractility and Reactivity Measurement

Male rats were intraperitoneally anesthetized with 1% pelltobarbitalum natricum (Solarbo, China) 1 ml/100 g, the aorta was rapidly dissected out, placed in Krebs Henseleit solution (KHS, in mmol/l: NaCl 115, CaCl2 2.5, KCl 4.6, KH2PO4 1.2, MgSO4-7H2O 1.2, NaHCO3 25, glucose 11.1, pH of 7.4) at 4°C and cleaned of connection tissue and blood vessel endothelium. The isolated arteries were cut into 3-4 mm in length. Pass through the lumen of the vessel segment by two parallel steel triangles: one was fixed to the organ bath, and the other connected to a tension transducer (TSD125B; Biopac, USA), which linked to AcqKnowledge software (MP150; Biopac,

USA). Vessel segments were bathed in 15 ml of KHS continuously saturated with a 95% O2-5% CO2 mixture at 37°C. The aortic rings were equilibrated for 90 min with 2.0 g basal tension. Arterial viability was measured using KCl solution (final concentration of 60 mmol/l, the same below), and arterial maximum contractility was determined using phenylephrine (PE, 1 ^mol/l). Endothelial denudation was confirmed by acetylcholine (Ach, 10 ^mol/l).16 Diazoxide (10-9 mol/l-10 mol/l) or pinacidil (10-9 mol/l-10-5 mol/l) was added to aorta ring in the plateau phase of PE (1 ^mol/l) to describe the concentration-response curves. To study the participation of specific KATP channel on vasodilator response, the specific KATP channel blocker glibenclamide (Gli) or the mitoKATP channel blocker 5-hydroxydecanoate (5-HD) was added 30 min before the concentration-response curves were figured. Gli (10 ^mol/l) was used to block the vasodilator response of pinacidil and 5-HD (10 ^mol/l) was used to block the vasodilator response of diazoxide respectively. All the changes in tension were recorded, and relaxation expressed as a percent of the precontraction.

Quantitative Relative Real-time Polymerase Chain Reaction

Total RNA was extracted from aorta arteries with TRIzol agent (Invitrogen, CA), and the concentration was determined by Nano Drop 2000 (Thermo Scientific, USA). Reverse transcription polymerase chain reaction (RT-PCR) were performed using iScript cDNA Synthesis Kit (Bio-Rad, USA), and Quantitative Relative Real-time Polymerase Chain Reaction (Q-PCR) was performed with the Power SYBR Green PCR Master Mix Kit (ABI, USA) on ABI prism 7900 instrument, according to the manufacturer's instructions. Primers were based upon published researches: (Sequence 5' to 3') F: CAGAGGTGCTGGACATCACAGAG, R: GCAACAGTCGGGTAGCCAATC for 36ß4; F: GGAGTGCGATACTGGTCCAAACCT, R:

CCCGATGCAGAGAACGAGACACT for SUR2A; F: CATAGCTCATCGGGTTCACACCATT, R: GCATCGAGACACAGGTGCTGTTGT for SUR2B; F: AGCTGGCTGCTCTTCGCTATCA, R: CCCTCCAAACCCAATGGTCACT for Kir6.1; F: CAACGTCGCCACAAGAACATC, R: CCAGCTGCACAGGAAGGACATG for Kir6.2. Q-PCR was consisted of two steps: hold at 95 °C for 10 min; 40 cycles at 95°C for 15 second and at 60°C for 60 second. Relative expression was normalized to 36P4. Western Blot

Total proteins were isolated from aorta tissues with RIPA buffer (Solarbo, China) and the concentration was measured by BCA protein assay kit (Solarbo, China). Protein samples (60 ^g each well) were loaded on 8% SDS-PAGE and transferred onto nitrocellulose filter (NC) membranes. The membranes was blocked in 5% nonfat milk (BD, USA) for 2 h, incubated overnight at 4°C in primary antibodies, and then incubated with appropriate secondary antibodies at room temperature for 50 min. The primary antibody dilutions were 1:300 for Kir6.1 (ABcam, Britain), 1:500 for Kir6.2 (Alomone, Israel), 1:300 for SUR2B (Santa, Japan), 1:30000 for GAPDH (ABcam, Britain) antibodies. Signals were detected with the electrochemiluminescence (ECL) Plus (Applygen, China). All experiments were measured in triplicate. Statistical Analysis

Statistical analysis was performed with SPSS17.0 and Graph Pad Prism5.0 software. All data showed in figures was expressed as mean ± SEM. Two groups' unpaired data were analyzed with Student's t-tests. Differences in means among groups and treatments were compared by the repeated-measure ANOVA, when appropriate. Differences with two-tailed P values <0.05 were considered to be statistically significant.

RESULTS

Body Weight and Blood Pressure

Figure 1 shows the mean of body weight and blood pressure of all groups. There was no difference in body weight between 16 weeks SHR (314.2±4.36 g) and 16 weeks WKY (307.6±2.41 g) (P>0.05), so as to 49 weeks SHR (384.3±10.69 g) versus 49 weeks WKY (358.5±6.74 g) (P>0.05) (Figure1A).

Blood pressure was increased in SHR groups when compared with the respective controls (P<0.01). However, no difference in blood pressure level was observed between 16 weeks (198.2±3.86/152.3±6.02 mmHg) and 49 weeks SHR (184.8±5.89/136.0±4.08 mmHg) (Figure1B-1C).

mRNA Expression of Kir6.1 and SUR2B Is Reduced in Aorta SM from SHR

In aorta smooth muscle, the mRNA expression of Kir6.1 subunits was decreased by 35% in 16 weeks SHR (0.65±0.11) when compared with 16 weeks control (1.00±0.16, P<0.05). Moreover, it was decreased to an even lower extent of 38% in 49 weeks SHR (0.49±0.11) compared with 49 weeks control (0.79±0.08, P<0.05). Furthermore, compared with 16 weeks SHR, there was a reduction about 25% in 49 weeks SHR. Similarly, VSM mRNA expression of KATP SUR2B subunits showed 26% reduction in 16 weeks SHR (0.74±0.06) when compared with 16 weeks control (1.00±0.11, P<0.05), and a further reduction of 61% in 49 weeks SHR (0.36±0.14) compared with 49 weeks control (0.92±0.18, P<0.05). Moreover, SUR2B subunits was decreased by 51% in 49 weeks SHR when compared with 16 weeks SHR (P<0.05). However, there were no differences in the Kir6.2 and SUR2A of the mRNA expression between

16 weeks and 49 weeks SHR when compared with respective controls (Figure 2A-2D). Protein Expression of Kir6.1 and SUR2B is Reduced in Aorta SM from SHR

To examine whether the KATP expression is altered in the SHR, we used Western blotting to measure protein expression. Consistent with the mRNA data above, in both 16 weeks SHR and 49 weeks SHR, the protein expression of Kir6.1 and SUR2B was decreased than the respectively controls. For Kir6.1, there was an almost 22% reduction in 16 weeks SHR (0.78±0.02, P<0.05), and an about 54% reduction in 49 weeks SHR (0.45±0.05, P<0.01). For SUR2B, 20% reduction in 16 weeks SHR (0.80±0.02), and 34% reduction in 49 weeks SHR (0.66±0.06, P<0.01). Moreover, there was significantly difference in Kir6.1 and SUR2B between 16 weeks and 49 weeks SHR. Compared with 16 weeks SHR, Kir6.1 decreased 44%, and SUR2B reduced 25% in 49 weeks SHR (P<0.01) (Figure 3A-3C). Vascular Reactivity to Diazoxide Is Reduced in Aorta SHR

To evaluate KATP channel functional condition, tissue bath myography was determined in this study. Diazoxide and pinacidil both evoked concentration-dependent relaxation response in PE preconstricted aortic segments isolated from either WKY or SHR groups. The relaxation response of diazoxide apparently lowered than pinacidil. No difference was observed in 16 weeks SHR aorta response to diazoxide compared with 16 weeks control. However, diazoxide caused marked lower relaxation in 49 weeks SHR compared with 49 weeks WKY in concentration of 10-6 mol/l (12.06±0.61 vs 20.87±2.92, P<0.05) and 10-5 mol/l (16.82±0.26 vs 48.72±4.31, P<0.001). The area under curve (AUC) to diazoxide response of 49 weeks SHR decreased when compared with 49 weeks WKY (P<0.05). Furthermore, the AUC to diazoxide response of 49 weeks SHR also showed a greater decrease than 16 weeks SHR (P<0.05). MitoKATP channel

inhibitor 5-HD blocked diazoxide-induced relaxation to a similar extent in SHR and normotensive rats. Thus, the delta area under curve (dAUC) of 5-HD ranged from 13.14% to 16.50% and there was no statistical differences in both strains (Figure 4E, 4G).

Pinacidil elicited similar concentration-dependent relaxation curves in denuded aorta segments from SHR and normotensive rats (both 16 weeks and 49 weeks SHR). The AUC to pinacidil showed no difference in both strains. Furthermore, the pinacidil-induced relaxation was abolished by the KATP blocker Gli (10 mmol/l) to a similar extent. Thus, the dAUC kept no change by Gli in both strains about 86.65-98.11% in both strains (Figure 4F, 4H).

DISCUSSION

In this study, we present the following findings: (1) At mRNA and protein level, expression of Kir6.1 and SUR2B is reduced in the aorta from 16 weeks and 49 weeks old SHR rats. (2) Moreover, the expression of Kir6.1 and SUR2B in 49 weeks SHR decreases much more than that in 16 weeks SHR. (3) The vasodilator response to diazoxide decreases in 49 weeks SHR, although this tend of decline is not observed in 16 weeks SHR. (4) The vasodilator response to pinacidil remains unchanged and its inhibition by Gli is also similar in both strains of WKY and SHR rats.

KATP channel is a tetrameric complex of Kir and SUR. In rat aorta, KATP channel has been demonstrated to be Kir6.1 and SUR2B.11' 17 In this study, we found that at mRNA and protein level, expression of Kir6.1 and SUR2B is reduced in the aorta from 16 weeks and 49 weeks old SHR rats, which is consistent with previous studies.18' 19 However, in this study, we found that the protein expression of Kir6.1 and SUR2B in 49 weeks SHR showed a much larger decrease

than that in 16 weeks SHR, although, the blood pressure kept unchanged between 49 weeks and 16 weeks SHR. This is the first time we reported that the expression of Kir6.1 and SUR2B was reduced with age in SHR. Although this different expression of VMS KATP channel subunits did not directly relate to the regulating of blood pressure, it probably affected other functions such as the channel subunits affinity and the channel gating-dynamic, etc.

KATP channels which act as targets of many vasoactive molecules are widely distributed in various tissues and cells with different subunits, and participate in both physiological and pathophysiological conditions including insulin-resistance, hyperglycemia, hypoglycemia, hypoxia, and ischemia.20 Activation of KATP channel in VSM leads to a diminution of intracellular Ca2+ levels, an increase in vascular diameter, and thus lowers the vascular resistance.3 In this study, we evaluated vasorelaxant response to KCOs pinacidil and diazoxide in thoracic aorta from 16 and 49 weeks SHR. We found pinacidil elicited similar concentration-dependent relaxation curves in both SHR and WKY rats, and the relaxation was abolished by the KATP blocker Gli to a similar extent. However, the relaxant response to diazoxide was evidently declined in 49 weeks SHR. 5-HD abolished the diazoxide induced relaxation to a similar extent. These results indicated that the response to pinacidil, Gli and 5-HD seems to be preserved, whereas the response to diazoxide diminishes in 49 weeks SHR.

SUR2B subunit is mainly responsible for channel affinity with KATP channel openers and blockers.21, 22 The SUR2B possesses 3 transmembrane domains (TMD0, TMD1 and TMD2), 2 cytoplasmic nucleotide binding domains (NBD1 and NBD2), and the Walker A, Walker B as well as Linker L consensus sequences.23 It functions as a regulatory subunit to mediate gating of the Kir6.1 pore by sulfonylurea drugs, such as Gli. Uhde et al identified two regions, KCOI and

KCOII in rat SUR2B. Region KCOI was located from Thr1059 to Leu1087 and region KCOII was located from Arg1218 to Asn1320.24 The simultaneous presence of two regions was necessary for high-affinity binding of SUR2B suggesting that the opener site could be made up of association of both regions. The down-regulation of SUR2B expression in hypertension could directly affect the open situation of channel, gating regulation and the affinity with modulators. KCOs exhibit an extreme chemical diversity and comprise a number of different structural classes such as the benzopyrans (cromakalim), cyanoguanidines (pinacidil), benzothiadiazines (diazoxide), and nicotinamides (nicorandil).25' 26 Diazoxide and pinacidil has recognized as the first generation KATP channel modulators, and both can act on Kir6.1/SUR2B. Basically, diazoxide activates mitoKATP channel, and pinacidil nonselectively activates both mitoKATP and sarcKATP channel. The potency of pinacidil is much stronger than diazoxide. Diazoxide activates the channel in a concentration-dependent manner with a half maximal effective concentration (EC50) of 30-60 ^mol, while pinacidil with an EC50 of 2 ^mol.27 Notablely, diazoxide possesses a high-affinity with SUR2B in cardiovascular system, SUR2B (dissociation constant, Kd=18 ^mol) >SUR2A (Kd=76 ^mol).28 Researchers have also found that the transmembrane helix 16 and 17 in TMD2 and section of the cytosolic loop linking helix 13 and 14 of SUR2B are required for the action of pinacidil, levocromakalin and P1075, rather than diazoxide.24, 29 Furthermore, the present regions such as TMD1, TMD2 and NBD1 cannot totally explain the binding site of diazoxide. Although the detailed binding mechanism remains to be studied, it is clear that diazoxide has a binding site distinct from all other openers.23, 30

Taking the above into account, the reason that the response to diazoxide diminished while the response to pinacidil preserved may be explained as follows. Firstly, diazoxide shows higher

potency and efficacy to open mitoKATP than pinacidil. The expression of Kir6.1which is also a subunit of mitoKATP31-33 in 49 weeks SHR decreases much more than that in 16 weeks SHR, hence the response to diazoxide diminished in 49 weeks SHR. Secondly, both diazoxide and pinacidil are able to bind to SUR2B, and activate KATP channel. Pinacidil is reported to binding to TMD2 domains of SUR2B. Different from pinacidil, diazoxide is potent to have a more complex binding site, which SUR2B C-terminal domains involved.34 Furthermore, diazoxide has a fourfold higher affinity for SUR2B than SUR2A.35' 36 Therefore, the much more decreased expression of SUR2B in 49 weeks SHR maybe another reason. Thirdly, opening sarcKATP channel play much more important role in the vasodilation than mitoKATP.37' 38 Compared with diazoxide, pinacidil extraly activates sarcKATP channel. The function of mitoKATP channel is mainly based on the modulation of mitochondrial function, including changes in mitochondrial matrix volume, mitochondrial potential, and oxygen consumption.27 In this study, we also found that pinacidil induced the stronger relaxation than diazoxide. Although the mitoKATP decreased in 49 weeks SHR, the response of pinacidil to sarcKATP channel seemed to be preserved in 49 weeks.

In brief, this study found that (1) the expression of Kir6.1 and SUR2B reduced in SHR, and the decrease in 49 weeks SHR was much more than that in 16 weeks SHR. (2) The response to diazoxide diminished while the response to pinacidil, Gli and 5-HD seems to be preserved in 49 weeks SHR. Although the detailed mechanisms is still need to be clarified, this study demonstrated that the decreased expression of VSM KATP subunits Kir6.1 or SUR2B correlate with the functional changes of KATP channel in hypertension with age.

Acknowledgements

This work was supported by the grant from the National Natural Science Foundation of China

(81070200, 81570349).

References

1. Go AS, Mozaffarian D, Roger VL, Benjamin EJ, Berry JD, Blaha MJ, Dai S, Ford ES, Fox CS, Franco S, Fullerton HJ, Gillespie C, Hailpern SM, Heit JA, Howard VJ, Huffman MD, Judd SE, Kissela BM, Kittner SJ, Lackland DT, Lichtman JH, Lisabeth LD, Mackey RH, Magid DJ, Marcus GM, Marelli A, Matchar DB, McGuire DK, Mohler ER, 3rd, Moy CS, Mussolino ME, Neumar RW, Nichol G, Pandey DK, Paynter NP, Reeves MJ, Sorlie PD, Stein J, Towfighi A, Turan TN, Virani SS, Wong ND, Woo D, Turner MB. Heart disease and stroke statistics--2014 update: a report from the American Heart Association. Circulation. 2014 Jan 21;129(3):e28-e292.

2. Chen LJ, Wu TP, Yang JJ, Yin LT, Yang YL, Chiang TA, Lu HL, Wu MC, Novokhatska T, Tishkin S, Dosenko V, Boldyriev A, Ivanova I, Strielkov I, Soloviev A. Correction of vascular hypercontractility in spontaneously hypertensive rats using shRNAs-induced delta protein kinase C gene silencing. BioMed research international. 2013 Oct 15;718(1-3):401 -7.

3. Standen NB, Quayle JM, Davies NW, Brayden JE, Huang Y, Nelson MT. Hyperpolarizing vasodilators activate ATP-sensitive K+ channels in arterial smooth muscle. Science (New York, NY). 1989 Jul 14;245(4914):177-80.

4. Seino S, Miki T. physiological and pathophysiological roles of atp-sensitive k channels. Progress in biophysics and molecular biology. 2003 Feb;81(2):133-76.

5. Coetzee WA. Multiplicity of effectors of the cardioprotective agent, diazoxide. Pharmacology & therapeutics. 2013 Nov;140(2):167-75.

6. Pan Z, Huang J, Cui W, Long C, Zhang Y, Wang H. Targeting hypertension with a new adenosine triphosphate-sensitive potassium channel opener iptakalim. Journal of cardiovascular pharmacology. 2010 Sep;56(3):215-28.

7. Kamata Y, Fujita T, Kato T, Hayashi I, Kurosaka M, Katori M, Fujita Y, Majima M. An ATP-sensitive potassium channel blocker suppresses sodium-induced hypertension through increased secretion of urinary kallikrein. Hypertension research : official journal of the Japanese Society of Hypertension. 2009 Mar;32(3):220-6.

8. Dudek M, Razny K, Bilska-Wilkosz A, Iciek M, Sapa J, Wlodek L, Filipek B. Hypotensive effect of alpha-lipoic acid after a single administration in rats. Anatolian journal of cardiology. 2015 Jun 30.

9. Flagg TP, Kurata HT, Masia R, Caputa G, Magnuson MA, Lefer DJ, Coetzee WA, Nichols CG. Differential structure of atrial and ventricular KATP: atrial KATP channels require SUR1. Circulation research. 2008 Dec 5;103(12):1458-65.

10. de Wet H, Proks P. Molecular action of sulphonylureas on KATP channels: a real partnership between drugs and nucleotides. Biochemical Society transactions. 2015 Oct 1;43(5):901-7.

11. Inagaki N, Gonoi T, Clement JP, Wang CZ, Aguilar-Bryan L, Bryan J, Seino S. A family of sulfonylurea receptors determines the pharmacological properties of ATP-sensitive K+ channels. Neuron. 1996 May;16(5):1011-7.

12. Kulkarni-Chitnis M, Njie-Mbye YF, Mitchell L, Robinson J, Whiteman M, Wood ME, Opere CA,

Ohia SE. Inhibitory action of novel hydrogen sulfide donors on bovine isolated posterior ciliary arteries. Experimental eye research. 2015 May;134:73-9.

13. Chen X, Han W, Zhang Y, Cui W, Pan Z, Jin X, Long C, Wang H. The molecular pathway of ATP-sensitive potassium channel in endothelial cells for mediating arteriole relaxation. Life sciences.

2015 Sep 15;137:164-9.

14. Brayden JE. Functional roles of KATP channels in vascular smooth muscle. Clinical and experimental pharmacology & physiology. 2002 Apr;29(4):312-6.

15. Li A, Knutsen RH, Zhang H, Osei-Owusu P, Moreno-Dominguez A, Harter TM, Uchida K, Remedi MS, Dietrich HH, Bernal-Mizrachi C, Blumer KJ, Mecham RP, Koster JC, Nichols CG. Hypotension due to Kir6.1 gain-of-function in vascular smooth muscle. Journal of the American Heart Association. 2013 Aug;2(4):e000365.

16. Belin de Chantemele EJ, Muta K, Mintz J, Tremblay ML, Marrero MB, Fulton DJ, Stepp DW. Protein tyrosine phosphatase 1B, a major regulator of leptin-mediated control of cardiovascular function. Circulation. 2009 Sep 1;120(9):753-63.

17. Flagg TP, Enkvetchakul D, Koster JC, Nichols CG. Muscle KATP channels: recent insights to energy sensing and myoprotection. Physiological reviews. 2010 Jul;90(3):799-829.

18. Shih H, Lee B, Lee RJ, Boyle AJ. The aging heart and post-infarction left ventricular remodeling. Journal of the American College of Cardiology. 2011 Jan 4;57(1):9-17.

19. Xi Q, Cheranov SY, Jaggar JH. Mitochondria-derived reactive oxygen species dilate cerebral arteries by activating Ca2+ sparks. Circulation research. 2005 Aug 19;97(4):354-62.

20. Kohtaro Minami TM, Takashi Kadowaki, Susumu Seino. Roles of ATP-Sensitive K Channels as Metabolic Sensors-Studies of Kir6.x Null Mice. Diabetes. 2004;53(SUPPLEMENT 3): 167-80.

21. de Araujo ED, Alvarez CP, Lopez-Alonso JP, Sooklal CR, Stagljar M, Kanelis V. Phosphorylation-dependent changes in nucleotide binding, conformation, and dynamics of the first nucleotide binding domain (NBD1) of the sulfonylurea receptor 2B (SUR2B). The Journal of biological chemistry. 2015 Sep 11;290(37):22699-714.

22. Li CG, Cui WY, Wang H. Sensitivity of KATP channels to cellular metabolic disorders and the underlying structural basis. Actapharmacologica Sinica. 2016 Jan;37(1):134-42.

23. Babenko AP, Gonzalez G, Bryan J. Pharmaco-topology of sulfonylurea receptors. Separate domains of the regulatory subunits of K(ATP) channel isoforms are required for selective interaction with K(+) channel openers. The Journal of biological chemistry. 2000 Jan 14;275(2):717-20.

24. Uhde I, Toman A, Gross I, Schwanstecher C, Schwanstecher M. Identification of the potassium channel opener site on sulfonylurea receptors. The Journal of biological chemistry. 1999 Oct

1 ;274(40):28079-82.

25. Mannhold R. KATP channel openers: structure-activity relationships and therapeutic potential. Medicinal research reviews. 2004 Mar;24(2):213-66.

26. Bouider N, Fhayli W, Ghandour Z, Boyer M, Harrouche K, Florence X, Pirotte B, Lebrun P, Faury G, Khelili S. Design and synthesis of new potassium channel activators derived from the ring opening of diazoxide: study of their vasodilatory effect, stimulation of elastin synthesis and inhibitory effect on insulin release. Bioorganic & medicinal chemistry. 2015 Apr 15;23(8): 1735-46.

27. Foster MN, Coetzee WA. KATP Channels in the Cardiovascular System. Physiological reviews.

2016 Jan;96(1):177-252.

28. Schwanstecher M, Sieverding C, Dorschner H, Gross I, Aguilar-Bryan L, Schwanstecher C, Bryan J. Potassium channel openers require ATP to bind to and act through sulfonylurea receptors. The

EMBO journal. 1998 Oct 1;17(19):5529-35.

29. Hambrock A, Loffler-Walz C, Russ U, Lange U, Quast U. Characterization of a mutant sulfonylurea receptor SUR2B with high affinity for sulfonylureas and openers: differences in the coupling to Kir6.x subtypes. Molecular pharmacology. 2001 Jul;60(1): 190-9.

30. Moreau C, Jacquet H, Prost AL, D'Hahan N, Vivaudou M. The molecular basis of the specificity of action of K(ATP) channel openers. The EMBO journal. 2000 Dec 15;19(24):6644-51.

31. Choma K, Bednarczyk P, Koszela-Piotrowska I, Kulawiak B, Kudin A, Kunz WS, Dolowy K, Szewczyk A. Single channel studies of the ATP-regulated potassium channel in brain mitochondria. Journal of bioenergetics and biomembranes. 2009 Aug;41(4):323-34.

32. Fancher IS, Dick GM, Hollander JM. Diabetes mellitus reduces the function and expression of ATP-dependent K(+) channels in cardiac mitochondria. Life sciences. 2013 Mar 28;92(11):664-8.

33. Waza AA, Andrabi K, Hussain MU. Protein kinase C (PKC) mediated interaction between conexin43 (Cx43) and K(+)(ATP) channel subunit (Kir6.1) in cardiomyocyte mitochondria: Implications in cytoprotection against hypoxia induced cell apoptosis. Cellular signalling. 2014 Sep;26(9):1909-17.

34. Matsuoka T, Matsushita K, Katayama Y, Fujita A, Inageda K, Tanemoto M, Inanobe A, Yamashita S, Matsuzawa Y, Kurachi Y. C-terminal tails of sulfonylurea receptors control ADP-induced activation and diazoxide modulation of ATP-sensitive K(+) channels. Circulation research. 2000 Nov 10;87(10):873-80.

35. Isomoto S, Kondo C, Yamada M, Matsumoto S, Higashiguchi O, Horio Y, Matsuzawa Y, Kurachi Y. A novel sulfonylurea receptor forms with BIR (Kir6.2) a smooth muscle type ATP-sensitive K+ channel. The Journal of biological chemistry. 1996 Oct 4;271(40):24321-4.

36. Hambrock A, Loffler-Walz C, Kloor D, Delabar U, Horio Y, Kurachi Y, Quast U. ATP-Sensitive K+ channel modulator binding to sulfonylurea receptors SUR2A and SUR2B: opposite effects of MgADP. Molecular pharmacology. 1999 May;55(5):832-40.

37. Aziz Q, Thomas AM, Gomes J, Ang R, Sones WR, Li Y, Ng KE, Gee L, Tinker A. The ATP-sensitive potassium channel subunit, Kir6.1, in vascular smooth muscle plays a major role in blood pressure control. Hypertension. 2014 Sep;64(3):523-9.

38. Antoine MH, Berkenboom G, Fang ZY, Fontaine J, Herchuelz A, Lebrun P. Mechanical and ionic response of rat aorta to diazoxide. European journal ofpharmacology. 1992 Jun 5;216(2):299-306.

Figure Legend

FIGURE 1. Body weight and blood pressure of rats. A. Body weight; B. Systolic blood pressure (SBP); C. Diastolic blood pressure (DBP). Data shown are the means ± SEM of 6 separate experiments. *P<0.05, SHR groups compared with the respective WKY controls. FIGURE 2. Relative expression of Kir6.1, Kir6.2, SUR2A, SUR2B mRNA. A. Kir6.1; B. SUR2B; C. Kir6.2; D. SUR2A. Data shown are the means ± SEM of 6 separate experiments. *P<0.05, SHR groups compared with the respective group compared with 16 weeks SHR group.

FIGURE 3. Representative Western blots for Kir6.1 and SUR2B expression. A. Western Blot of Kir6.1, SUR2B and GAPDH; B. Analysis of relative grey intensity of Kir6.1; C. Analysis of relative gray intensity of SUR2B. Results are expressed as the ratio between the signal for the Kir6.1/SUR2B expression and the signal for GAPDH. Data shown are the means ± SEM of 3 separate experiments. **P<0.01, SHR groups compared with the respective WKY controls; ##P<0.01, 49 weeks SHR group compared with 16 weeks SHR group.

FIGURE 4. Vascular reactivity to KATP channel openers and blocker. Aorta rings were saturated in KHS and accumulatively added diazoxide or

mol/l, 10-6 mol/l, 10-5 mol/l). A. Concentration-relaxation curves of diazoxide in presence or absence of 5-HD in 16 weeks WKY and 16 weeks SHR groups; B. Concentration-relaxation curves of diazoxide in presence or absence of 5-HD in 49 weeks WKY and 49 weeks SHR groups; C. Concentration-relaxation curves of pinacidil in presence or absence of glibenclamide in 16 weeks WKY and 16 weeks SHR groups; D. Concentration-relaxation curves of pinacidil in presence or absence of glibenclamide in 49 weeks WKY and 49 weeks SHR groups; E. The area

under curve (AUC) to diazoxide; F. AUC to pinacidil. G. dAUC is expressed as the difference between AUC to diazoxide and corresponding AUC for aortic segments in presence of 5-HD; H. dAUC is expressed as the difference between AUC to pinacidil and corresponding AUC for aortic segments in presence of glibenclamide. Results are expressed as percent of previous contraction with phenylephrine. Data shown are the means ± SEM of 4-8 separate experiments. *P<0.05,

*P<0.01 , SHR groups compared with the respective WKY controls; #P >.05, 49 weeks SHR group compared with 16 weeks SHR group.

Blood Pressure(mmHg)

1 | I |

XI ^ XI ^

o Iw r'n

о. 0.5-

Relative expression of Kir6.1 mRNA

О 16wWKY ■ 16wSHR

□ 49wWKY

? 2.0-1

S- 0.5-

CM * 0.0

Relative expression of SUR2B mRNA

O 16wWKY ■ 16wSHR m 49wWKY ЕЕЭ 49wSHR

Kir6.1(48KDa) GAPDH(37KDa) ^^^ «

SUR2B(175KDa) ?

GAPDH(37KDa) I

| 16wWKY o)

| 16wSHR to

| 49wWKY o

| 49wSHR w

2 2 0.0-

** a 16WWKY

< ■ 16wSHR

a 49wWKY Q 49wSHR

^ cT J? J? / / / / Relative expression of Kir6.1 protein

^ # ^ # Relative expression of SUR2B protein

Copyright © 2016 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.

Relaxation%

Diazoxide

Pinacidil

o 4(H <

□ 16wWKY ■ 16wSHR ED 49wWKY E3 49wSHR

F 250-

O <100-

□ 16wWKY ■ 16wSHR ED 49wWKY ^ 49wSHR

Glibenclamide

H 150-,

□ 16wWKY ■ 16wSHR ED 49wWKY EE3 HR