Scholarly article on topic 'Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt'

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt Academic research paper on "Veterinary science"

CC BY
0
0
Share paper
Academic journal
BMC Infect Dis
OECD Field of science
Keywords
{""}

Academic research paper on topic "Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt"

Zafer et al. BMC Infectious Diseases (2015) 15:122 DOI 10.1186/s12879-015-0861-8

Infectious Diseases

RESEARCH ARTICLE Open Access

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt

Mai Mahmoud Zafer1*, Mohamed Hamed Al-Agamy2,3, Hadir Ahmed El-Mahallawy4, Magdy Aly Amin5 and Seif El Din Ashour3

Abstract

Background: Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST).

Methods: Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done.

Results: The b/aVIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone.

Conclusions: The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

Keywords: Pseudomonas aeruginosa, Carbapenem resistance, b/aVIM-2, ST233, Egypt

Background

Pseudomonas aeruginosa, an opportunistic pathogen, is an important cause of infection in patients with impaired immune systems [1]. P. aeruginosa is a prime example of a species that has continually evolved such that many strains are extensively drug resistant—i.e., resistant to all standard anti-pseudomonal antibiotics (carbapen-ems and aminoglycosides) and sensitive only to colistin [2]. Nowadays, intensive clinical use of carbapenems has caused the presence of carbapenem resistant P. aeruginosa populations [3] and an increase in carbapenem resistance by acquisition of different mechanisms, such as

* Correspondence: mai_zafer@hotmail.com

department of Microbiology and Immunology, Faculty of Pharmacy, Ahram Canadian University, 4th Industrial Zone, Banks Complex' 6th of October, Giza, Egypt

Fulllist of author information is available at the end of the article

Bio Med Central

hyperproduction of chromosomal AmpC beta-lactamase, overexpression of efflux systems, alteration or lack of outer membrane proteins (such as porin OprD), and production of carbapenemases [4]. The advent of mobile MBL genes heralded a new chapter in resistance; class 1 integrons, the mobile genetic structures that carry MBL genes, also carry genes encoding determinants of resistance to aminoglycosides and other antibiotics, and thus confer extensive drug resistance [5]. MBL gene b/oyiM-2 was first reported in P. aeruginosa in France in 2000, but the earliest recorded case was in Portugal in 1995 [6]. VIM-2 has emerged as a dominant MBL variant worldwide. MultiLocus sequence typing (MLST) has identified international clonal complexes (CCs) responsible for the dissemination of MBL-producing P.aeruginosa,

© 2015 Zafer et al.; licensee BioMed Central. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

particularly in European countries [7], in Japan [8], Singapore, and Brazil.

The aim of this study was to examine the genetic re-latedness of MBL producing P. aeruginosa strains isolated from two hospitals in Cairo, Egypt.

Methods

Bacterial isolates

Forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were obtained from clinical specimens submitted for bacteriological testing from hospitalized in-patients admitted to Kasr Al Aini Hospital (KAA) and National Cancer Institute (NCI), Cairo University, Egypt from January 2011 to January 2012. KAA School of Medicine and NCI are tertiary hospitals belonging to Cairo University, Egypt. The study was approved by the Ethics Committee of Cairo University and an informed consent was obtained from all patients receiving treatment and participating in the study.

Isolate identification

Initial identification and susceptibility testing was done using VITEK 2 (bioMerieux, Marcy l'E'toile, France) automated machine. Genotypic identification was carried out by PCR amplification and sequence determination of 16S rDNA previously described by Spilker et al. [9]. The identified strains were stored in glycerol broth cultures at - 70°C.

Antimicrobial susceptibility testing

Susceptibility testing was done by the disc diffusion method of the Clinical and Laboratory Standards Institute, [10] with discs from Oxoid (Oxoid ltd., Basin Stoke, Hants, England). MICs were determined with E-test strips (bioMerieux, Marcy L'Etoile, France). P. aeruginosa ATCC 27853 was used as a control throughout.

Phenotypic detection of MBLs

E-test MBL strips were in accordance with the manufacturer's instructions to seek MBL production. A no less than eight-fold reduction in imipenem MIC in the presence of EDTA, or a phantom zone, was taken as a positive result.

Detection of MBL-encoding genes and integrase genes

blaVIM-2 blaIMP-1> blaSIM> blaGIM> blaSPM> blaNDM-2 and

intI1 were amplified for P.aeruginosa isolates using primers listed in Table 1 according to the previous protocols [11-15]. Negative and positive controls were involved in all PCR experiments. Five microliters of reaction mix containing PCR product were analysed by electrophoresis in 0.8% (w/v) agarose (Fermentas, Lithuania).

DNA sequencing

Amplified products of blaVIM-2 were purified using a QIAquick PCR Purification Kit (Qiagen, Crawley, UK) and sequenced in both directions using the ABI Prism 3700 DNA Sequencer (Applied Biosystems, Foster City,

Table 1 List of primers used in this study

Primers Sequence 5'-3' Use Expected PCR product Reference

PA-SS-F GGGGGATCTTCGGACCTCA Identification 956 bp Spilker eta'. [9]

PA-SS-R TCCTTAGAGTGCCCACCCG

6/Oimp-1 TGAGCAAGTTATCTGTATTC WOimp-1 740 bp Yan et a'. [11]

TTAGTTGCTTGGTTTTGATG amplification

VIM-F1 ATGTTCAAACTTTTGAGTAAGTTATT b'aVIM-2 801 bp Frasson et a'. [12]

VIM-FK ATGTTAAAAGTTATTAGTAGTTTATTGKTC amplification and sequencing

VIMR1 CTACTCGGCGACTGAGC

VIMR2 CTACTCAACGACTGAGCGA

b/aNDM b'aNDM 984 bp Kaase et a'. [13]

PreNDM-A CACCTCATGTTTGAATTCGCC amplification

Pre-NDM-B CTCTGTCACATCGAAATCGC

b/öGIM TCGACACACCTT GGT CTG AA b'OGIM 477 bp Ellington et a'. [12]

AACTTCCAACTT TGCCATGC amplification

b/oSPM AAAATCTGGGTACGCAAA CG b'aSPM 271 bp Ellington et a'. [12]

ACATTATCCGCTGGAACAGG amplification

b/OSIM TAC AAG GGATTCGGCATCG b'üSjM 570 bp Ellington et a'. [12]

TAATGG CCTGT CCCATG TG amplification

intI1 intl 457 bp Shibata et a'. [15]

Int-1-F GCA TCC TCG GTT TTC TGG amplification and sequencing

Int-1-R GGT GTG GCG GGC TTC GTG

CA). The types of ^-lactamase genes were identified by comparison with the sequences in GenBank (http://blast. ncbi.nlm.nih.gov/Blast.cgi).

Multi-locus sequence typing (MLST)

PCR and sequencing of the recognized chromosomal markers (7 housekeeping genes) acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE were done [16]. The nucleotide sequences of these genes were compared with the sequences submitted to the MLST database to determine the allelic numbers and sequence types.

The collection of MLST data on P. aeruginosa is available on http://pubmlst.org/paeruginosa/. MLST was performed for twenty isolates, representatives of the blaVIM-2 gene identified. All these isolates were imipenem resistant, MBL producing and ViM-2 positive. An isolate from each hospital was selected randomly for comparison.

Results

Of the 48 carbapenem resistant P.aeruginosa isolates, 33 (68.7%) were confirmed to be MBL producers. Of the 48 P.aeruginosa isolates, 21 isolates were from wound, 12 were from urine, 9 were from sputum,4 were from blood and two were from ear swab; 16 (48.5%), 8 (24.2%), 6 (18.1%), 2 (6.1%) and 1 (3.0%) produced MBL, respectively.

Each of MBL positive strains and their MiC results are summarized in Table 2.

Of the 33 MBL isolates, MBL encoding genes blaVIM was identified in 28(85%) isolates, blaNDM was identified in 2 (6.1%) isolates and blaIMP was identified in only one (3.0%) isolate. in this work MBL blaGiM, blaSIM, and blaSPM allele were not detected. Twenty nine (87.8%) of the MBL-producing isolates were positive for class 1 integron. All the VIM-2 producing isolates had the class 1 integron. All isolates were resistant to imipenem (MIC > 8 ^g/ml). Sequencing of intrinsic blaVIM confirmed that the nucleotide sequences obtained were identical to genes for VIM-2 for P.aeruginosa. Similarly, the nucleotide sequences of class I integron also coincided with the results predicted by the PCR analyses. Eleven distinct STs were identified. Results of STs analyzed are recorded in Table 2. Antibiotic susceptibility result for 33 MBL producing P.aeruginosa is given in Table 3.

Discussion

This study clearly demonstrates that carbapenem non-susceptible P. aeruginosa is present in Egypt in isolates of different origins mainly isolated from surgical wards with high prevalence of VIM-2 positivity in MBL producing P.aeruginosa isolates. The ability of MBL-producing P. aeruginosa to reach high level endemicity in certain settings has, indeed, been established, [5] and in these cases, MBLs can outpace loss of oprD and up-regulated

efflux pumps as leading factors causing reduced carba-penem susceptibility; distinct clones even unfolding their potential for causing outbreaks [17]. Our results revealed that 33 (68.7%) of 48 carbapenem resistant P.aeruginosa isolates produced MBL. This study demonstrated an increasing prevalence of MBL. Similarly high prevalence of MBL producing P.aeruginosa was detected in the Egyptian study where 82% were MBL producers [18]. In another Egyptian study 32.3% MBL producing P.aeruginosa was observed which is lower than our findings [19]. In the present study, VIM-2 was the most frequently detectable gene among the different MBL genes investigated; the percent of 85% among carbapenem-resistant MBL producing P. aeruginosa was detected. This finding was supported by results of previous studies demonstrating VIM-2 as the most dominant MBL implicated in imipenem resistant P. aeruginosa and confers the greatest clinical threat [20]. Worldwide, VIM-2 is the dominant MBL gene associated with nosocomial outbreaks due to MBL-producing P. aeruginosa [21]. Since MBL-producing isolates can cause serious infections that are difficult to treat, their presence in various hospitals in Egypt is of nationwide concern. The absence of new agents for the treatment of infections caused by these bacteria may lead to treatment failures with increased morbidity and mortality. A class 1 integron carries the integrase gene (intI1), which encodes the site-specific recombinase responsible for cassette insertion. In our study class 1 integron was confirmed in 29 (87.8%) of MBL producing P.aeruginosa. This result is consistent with findings from Malaysia in which they suggested that the class 1 integron is the most abundant type of integron present among the clinical isolates of P.aeruginosa in Malaysia [22].

MDR P.aeruginosa isolates, resistant to almost all ß-lactams, aminoglycosides and quinolones, often ascribed to epidemic clones (ST235 or ST111), have been detected in hospitals worldwide, mainly within ICU [23]. The increasing prevalence of MDR P. aeruginosa isolates is a global health problem, because of the limitation in clinical treatment options. All the VIM-producing isolates in this study belonged to international clones. In this study the results of MLST showed that VIM-2 type MBL car-bapenem resistant P. aeruginosa specimens isolated from surgical wards of Kasr Al Aini hospital showed similarity in which ST233 which was a part of the internationally dominant clonal cluster CC233 was detected in 7/15 isolates indicating health care acquired transfer of P. aeruginosa could occur and should be prevented, an increased risk of cross-transmission and high antimicrobial pressure might have favoured clonal spread. Additionally, patients who have the potential to facilitate dissemination of MDR organisms between hospitals subsequently, might serve as important reservoirs and transmission sources, stressing the importance of hand hygiene compliance, and

Table 2 Isolation details, VIM-2 gene results, MICs and sequence type of 33 P.aeruginosa MBL positive isolates

Isolate Duration of episode in days Sample Hospital VIM-2 NDM-1 IMP-1 PM PTc TZ TZL CI AK GM IP CT Sequence type (ST)

1 21 Wound KAA + - - >256 16 >256 >256 2 12 3 >32 >256

2 9 Blood KAA + - - 12 64 8 3 >32 16 >256 >32 >256

3 36 Wound KAA + + - 8 64 64 24 >32 >256 12 >32 >256 233

4 30 Wound KAA + - - 4 3 6 2 >32 >256 >256 >32 32 233

5 13 Wound KAA + - - 4 3 6 1.5 >32 >256 >256 >32 32

6 8 Wound KAA + + - 64 >256 >256 >256 >32 >256 >256 >32 >256 233

7 5 Wound KAA + - - 24 >256 >256 192 >32 >256 12 >32 >256

8 10 Wound KAA + - - 6 96 96 24 0.094 4 2 >32 >256

9 10 Urine KAA + - - >256 3 >256 >256 >32 32 12 >32 >256 303

10 9 Blood KAA + - - 2 4 1.5 >32 2 2 >32 16 >256

11 75 Sputum KAA + - - >256 >256 >256 >256 >32 >256 32 >32 >256

12 4 Wound KAA + - - 6 24 8 16 >32 >256 1.5 >32 >256 198

13 30 Urine NCI + - - >256 >256 >256 >256 >32 >256 >256 >32 >256 629

14 10 Sputum NCI - - - >256 24 >256 >256 1 6 2 >32 >256

15 30 Wound NCI - - + 16 24 16 4 >32 12 >256 >32 >256

16 46 Wound NCI + - - >256 >256 48 8 >32 96 >256 >32 >256 233

17 22 Sputum NCI + - - 6 12 12 2 >32 6 >256 >32 >256 507

18 70 Sputum NCI - - - >256 4 >256 >256 >32 96 32 >32 >256

19 65 Sputum NCI + - - >256 >256 >256 96 0.094 96 32 >32 >256 406

20 120 Sputum NCI + - - 64 32 12 2 >32 16 >256 >32 >256 303

21 54 Wound KAA + - - 8 16 24 4 >32 48 >256 >32 >256 233

22 27 Wound KAA + - - 16 >256 >256 >256 >32 128 32 >32 >256 274

23 7 wound KAA + - - 256 >256 >56 256 >32 >256 32 >32 >256 884

24 45 Urine KAA + - - 8 12 >256 4 0.064 8 >256 >32 >256 738

25 150 urine KAA + - - >256 >256 >256 128 >32 48 32 >32 >256 274

26 75 Wound KAA + - - >256 >256 >256 >256 >32 >256 >256 >32 >256 683

27 21 Urine KAA + - - 16 >256 >256 32 0.064 8 32 >32 >256 990

28 45 Urine KAA - - - 64 >256 >256 >256 0.064 32 32 >32 >256

29 240 Urine KAA + - - 2 4 12 2 0.125 4 2 >32 >256 233

30 180 Urine KAA + - - 2 4 8 1.5 0.125 4 2 >32 >256 233

31 21 Wound KAA + - - 8 128 6 24 0.094 6 2 >32 >256

32 30 Wound KAA - - - 12 32 2 8 0.064 6 2 >32 >256

33 21 Ear swab KAA + - - 6 6 >256 8 3 >32 128 16 >32 233

PM = cefepime, PTc = CT= cefotaxime.

piperacillin/tazobactam, TZL = ceftazidime/clavulanic acid, TZ = ceftazidime, CI = ciprofloxacin, AK = amikacin, GM = gentamicin, IP = imipenem,

patient precautions, whereas diversity in sequence types is shown from specimens isolated from NCI where 5 distinct sequence types were observed. This diversity could be due to previous empirical intake of antibiotics or misuse. ST 233 VIM-2 producing P.aeruginosa was detected in one isolate imported from Ghana in a study done in Norway and Sweden in which the two international clonal complexes CC111 and CC235 associated with MBL-producing P. aeruginosa isolates were dominant [24]. In previous studies from different Russian states, VIM-2 positive ST 235 was the predominant isolated type that has rapidly

spread throughout Russia, Belarus and Kazakhastan via clonal dissemination. The authors were not able to prove the reason for spread of VIM-2 positive ST 235 but explained that inappropriate use of antibiotics and poor adherence to infection control practice could be among the reasons [25]. Although P.aeruginosa clinical isolates are seldom typed and therefore under-reported, ST235 association with VIM-2 seems Europe centered, and has been reported in Belgium, Croatia, Serbia, and, more recently, Greece [26]. In other parts of Europe ST 111 were the major sequence type detected in MBL producing

Table 3 Resistance patterns of 33 P. aeruginosa MBL positive strains

Isolate Type of specimen Antibiotic disk diffusion susceptibility test

Imipenem Augmentin Cefuroxime Cefoperzone Ceftazidime Ciprofloxacin Meropenem

1 Wound R R R R R R R

2 Blood R R R R R R R

3 Wound R R R R R R R

4 Wound R R R R R S R

5 Wound R R R R R R R

6 Wound R R R R R S R

7 Wound R R R R R R R

8 Wound R R R R R S R

9 Urine R R R R R R R

10 Blood R R R R R R R

11 Sputum I R R R R I R

12 Wound R R R R R R R

13 Urine R R R R R R R

14 Sputum R R R R R I R

15 Wound R R R R R R R

16 Wound R R R R R R R

17 Sputum R S R R S R R

18 Sputum R R R S S R R

19 Sputum R R R R R S R

20 Sputum R R R R R R R

21 Wound R R R R R R R

22 Wound R R R R R S R

23 wound R R R R R S R

24 Urine R R R R R R R

25 Urine R R R R R I R

26 Wound R R R R R I R

27 Urine R R R R R R R

28 Urine R R R R R S R

29 Urine R R R R R S R

30 Urine R R R R R R R

31 Wound R R R R R S R

32 Wound R R R R R R R

33 Ear swab R R R R R R R

Table 3 Resistance patterns of 33 P. aeruginosa MBL positive strains

Isolate Antibiotic disk diffusion susceptibility test

Amikacin Sulperazone Levofloxacine Gentamicin Norfloxacine Tazocin Ceftriaxone Polymixin B

1 R R R R R R R S

2 R I R R R R R S

3 R R R R R R R S

4 R R R R S R R S

5 R R R R R R R S

6 R R R R R S R S

7 R R R R R R R S

8 R R R R R R R S

9 R R R R R R R S

10 S R R S R R R S

11 R R R R R I R S

12 R R R R R R R S

13 S R R R R R R S

14 S R R S R S R S

15 S S R R R R R R

16 R R R R R R R S

17 R R R R R R R S

18 R R R R R R S S

19 S R R S R R R S

20 R R R R R R R S

21 R R R R R R R S

22 R R S R R R R S

23 R R S R R R R S

24 R R R S R R R S

25 R R R R R R R S

26 R R R R R R R S

27 R R R R R S R S

28 R R S R S R R S

29 R R R R R R R S

30 R R R R R R R S

31 R R S R R R R S

32 R R R S R S R R

33 S R R R R RR S

P.aeruginosa and ST 446 was detected but less widespread [27]. Thus it seems that different clones could be detected from different geographical areas.

Conclusions

The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies as none of our isolates revealed ST 235. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones. Similar ST seems to be transmitted due

to poor adherence to infection control policies which necessitate efforts for more strict abidance to infection control regulations. Different clones from different specialty hospitals in our study requiring further investigations to explain the relation of diversity of ST types to cause of resistance.

Competing interests

The authors declare that they have no competing interests. Authors' contributions

MZ carried out the phenotypic screening tests and drafted the manuscript. MHA carried out the molecular genetic studies, participated in sequence alignment. HAE participated in providing the clinicalspecimens and helped

to draft the manuscript. MA conceived of the study, and participated in its design and coordination. SA participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

The authors extend their appreciation to the Deanship of Scientific Research at King Saud University for funding the work through the research group project no. RGP-VPP-038.

Author details

1Department of Microbiology and Immunology, Faculty of Pharmacy, Ahram Canadian University, 4th Industrial Zone, Banks Complex' 6th of October, Giza, Egypt. 2Department of Pharmaceutics and Microbiology, College of Pharmacy, King Saud University, 11451 Riyadh, Saudi Arabia. 3Department of Microbiology and Immunology, Faculty of Pharmacy, Al-Azhar University, Cairo, Egypt. 4Department of Clinical Pathology, National Cancer Institute, Cairo University, Cairo, Egypt. 5Department of Microbiology and Immunology, Faculty of pharmacy, Cairo University, El Aini, As Sayedah Zeinab, Cairo, Egypt.

Received: 27 September 2014 Accepted: 2 March 2015 Published online: 12 March 2015

References

1. Coggan KA, Wolfgang MC. Global regulatory pathways and cross-talk control Pseudomonas aeruginosa environmental lifestyle and virulence phenotype. Curr Issues Mol Biol. 2012;14:47-70.

2. Cabot G, Ocampo-Sosa AA, Dominguez MA, Gago JF, Juan C, Tubau F, et al. Spanish Network for Research in Infectious Diseases (REIPI): genetic markers of widespread extensively drug-resistant Pseudomonas aeruginosa high-risk clones. Antimicrob Agents Chemother. 2012;56:6349-57.

3. Oikonomou O, Panopoulou M, Ikonomidis A. Investigation of carbapenem heteroresistance among different sequence types of Pseudomonas aeruginosa clinical isolates reveals further diversity. J Med Microbiol. 2011;60:1556-8.

4. Lister PD, Wolter DJ, Hanson ND. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev. 2009;22:582-610.

5. Cornaglia G, Giamarellou H, Rossolini GM. Metallo-ß-lactamases: a last frontier for ß-lactams? Lancet Infect Dis. 2011;11:381-93.

6. Cardoso O, Leitao R, Figueiredo A, Sousa JC, Duarte A, Peixe LV. Metallo-ß-lactamase VIM-2 in clinical isolates of Pseudomonas aeruginosa from Portugal. Microb Drug Resist. 2002;8:93-7.

7. Lepsanovic Z, Libisch B, Tomanovic B, Nonkovici Z, Balogh B, Fuzi M. Characterisation of the first VIM metallo-ß-lactamase-producing Pseudomonas aeruginosa clinical isolate in Serbia. Acta Microbiol Immunol Hung. 2008;55:447-54.

8. Kouda S, Ohara M, Onodera M, Fujiue Y, Sasaki M, Kohara T, et al. Increased prevalence and clonal dissemination of multidrug-resistant Pseudomonas aeruginosa with the b/aIMP-1 gene cassette in Hiroshima. J Antimicrob Chemother. 2009;64:46-51.

9. Spilker T, Coenye T, Vandamme P, LiPuma JJ. PCR-based assay for differentiation of Pseudomonas aeruginosa from other pseudomonas species recovered from cystic fibrosis patients. J Clin Microbiol. 2004;42:2074-9.

10. Clinical and Laboratory Standards Institute. Performance standards for Antimicrobial Susceptibility testing;Twenty-Fourth Informational Supplement. M100-S24 and eM100 CLSI. 2014.

11. Yan JJ, Hsueh PR, Wen-Chien K, Kwen-Tay L, Shu-Huei T, Hsiu-Mei W, et al. Metallo-ß-Lactamases in clinical Pseudomonas isolates in Taiwan and identification of VIM-3, a novel variant of the VIM-2 Enzyme. Antimicrobial Agents Chemother. 2001;45(8):2224-8.

12. Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-betalactamases. J Antimicrob Chemother. 2007;59:321-2.

13. Kaase M, Nordmann P, Wichelhaus TA, Gatermann SG, Bonnin RA, Poirel L. NDM-2 Carbapnemase in Acinetobacter baumannii from Egypt. J Antimicrob Chemother. 2011;10:1093-135.

14. Frasson I, Biasolo MA, Bartolini A, Cavallaro A, Richter SN, Palu G. Rapid detection of blaVIM-1 -37 and blaKPC1/2-12 alleles from clinical samples by multiplex PCR-based assays. Int J Antimicrob Agents. 2013;42:68-71.

15. Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, et al. PCR typing of genetic determinants for Metallo-ß-Lactamases and Integrases carried by Gram-Negative bacteria isolated in Japan, with focus on the class 3 Integron. J Clin Microbiol. 2003;41(12):5407-13.

16. Curran B, Jonas D, Grundmann H, Pitt T, Dowson CG. Development of a multilocus sequence typing scheme for the opportunistic pathogen Pseudomonas aeruginosa. J Clin Microbiol. 2004;42:5644-9.

17. Tsakris A, Poulou A, Kristo I, Pittaras T, Spanakis N, Pournaras S, et al. Large dissemination of VIM-2-metallo-{beta}-lactamase-producing Pseudomonas aeruginosa strains causing health care-associated community-onset infections. J Clin Microbiol. 2009;47:3524-9.

18. Diab M, Fam N, El-Said M, El-Dabaa E, El-Defrawy I, Saber M. Occurrence of VIM-2 Metallo-ß- Lactamases in imipenem resistant and susceptible Pseudomonas aeruginosa clinical isolates from Egypt. Afr J Microbiol Res. 2013;7(35):4465-72.

19. Mansour SA, Eldaly O, Fatani AJ, Mohamed ML, Ibrahim EM. Epidemiological characterization of P. aeruginosa isolates of intensive care units in Egypt and Saudi Arabia. East Mediterr Health J. 2013;19:1-8.

20. Walsh TR, Li H, Toleman MA, Bennett PM, Jones RN. Complete sequence of p 07-406, a 24,179-base-pair plasmid harboring the blaVIM-7 Metallo-ß-Lactamase gene in a Pseudomonas aeruginosa isolate from the United States. Antimicrob Agents Chemother. 2008;52(9):3099-105.

21. Elias J, Schoen C, Heinze G, Valenza G, Gerharz E, Riedmiller H, et al. Nosocomial outbreak of VIM-2 metallo-ß-lactamase-producing Pseudomonas aeruginosa associated with retrograde urography. Clin Microbiol Infect. 2010;16(9):1494-500.

22. Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo-ß-lactamase-positive Pseudomonas aeruginosa in Malaysia. J Med Microbiol. 2011;60:988-94.

23. Woodford N, Turton JF, Livermore DM. Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance. FEMS Microbiol Rev. 2011;35:736-55.

24. Samuelsen O, Toleman MA, Sundsfjord A, Rydberg J, Leegaard TM, Walder M, et al. Molecular epidemiology of metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from Norway and Sweden shows import of international clones and local clonal expansion. Antimicrob Agents Chemother. 2010;54(1):346-52.

25. Edelstein MV, Skleenova EN, Shevchenko OV, D'souza JW, Tapalski DV, Azizov IS, et al. Spread of extensively resistant VIM-2-positive ST235 Pseudomonas aeruginosa in Belarus, Kazakhstan, and Russia: a longitudinal epidemiological and clinical study. Lancet Infect Dis. 2013;13:867-76.

26. Koutsogiannou M, Drougka E, Liakopoulos A, Jelastopulu E, Petinaki E, Anastassiou ED, et al. Spread of multidrug-resistant Pseudomonas aeruginosa clones in a university hospital. J Clin Microbiol. 2013;51:665-8.

27. Van der BijAK, Van der Zwan D, Peirano G, Severin JA, Pitout JDD, Westreenen MV, et al. Metallo-ß-lactamase-producing Pseudomonas aeruginosa in the Netherlands: the nationwide emergence of a single sequence type. Clin Microbiol Infect. 2012;18:E369-72.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

BioMed Central