Scholarly article on topic '
            Activation of the
            Nkx2.5–Calr–p53
            signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish
          '

Activation of the Nkx2.5–Calr–p53 signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish Academic research paper on "Basic medicine"

CC BY
0
0
Share paper
Academic journal
Disease Models & Mechanisms
OECD Field of science
Keywords
{""}

Academic research paper on topic " Activation of the Nkx2.5–Calr–p53 signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish "

DMM Advance Online Articles. Posted 11 August 2017 as doi: 10.1242/dmm.026781 Access the most recent version at http://dmm.biologists.org/lookup/doi/10.1242/dmm.026781

Activation of Nkx2.5-Calr-p53 signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish

Sun Yanyi*, Wang Qiuyun*, Fang Yuehua, Wu Chunfang, Lu Guoping and Chen Zhenyue

Department of Cardiology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, 200025, China

*These authors contributed equally to this work.

Corresponding author: Zhenyue Chen, MD, PhD

Department of Cardiology

Ruijin Hospital, Shanghai Jiaotong University School of Medicine 197 Ruijin Er Road, Shanghai, China, 200025 Telephone number: 86-13611902069 Email address: zhenyue1224@163.com

Key words: Adult zebrafish, apoptosis, cardiomyopathy, echocardiography, hyperglycemia, Nkx2.5-Calr-p53

© 2017. Published by The Company of Biologists Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution and reproduction in any medium

provided that the original work is properly attributed.

Summary Statement: Induction of hyperglycemia gives rise to cardiac apoptosis and dysfunction in adult zebrafish via the Nkx2.5-Calr-p53 signaling pathway, resulting in adult cardiomyopathy.

Abstract

Hyperglycemia is an independent risk factor for diabetic cardiomyopathy in humans; however, the underlying mechanisms have not been thoroughly elucidated. Zebrafish (Danio rerio) was used in this study as a novel vertebrate model to explore the signaling pathways of human adult cardiomyopathy. Hyperglycemia was induced by alternately immersing adult zebrafish in a glucose solution or water. The hyperglycemic fish gradually exhibited some hallmarks of cardiomyopathy such as myocardial hypertrophy and apoptosis, myofibril loss, fetal gene reactivation, and severe arrhythmia. Echocardiography of the glucose-treated fish demonstrated diastolic dysfunction at an early stage and systolic dysfunction at a later stage, consistent with what is observed in diabetic patients. Enlarged hearts with decreased myocardial density, accompanied by decompensated cardiac function, indicated that apoptosis was critical in the pathological process. Significant upregulation of the expression of Nkx2.5 and its downstream targets calreticulin (Calr) andp53 was noted

in the glucose-treated fish. High-glucose stimulation in vitro evoked marked apoptosis of primary cardiomyocytes, which was rescued by the p53 inhibitor, Pifithrin-ц. In vitro experiments were performed using compound treatment and genetically via cell infection. Genetically, knockout of Nkx2.5 induced decreased expression of Nkx2.5, Calr, and p53. Upregulation of Calr resulted in increasedp53 expression, while Nkx2.5 level remained unchanged. An adult zebrafish model of hyperglycemia-induced cardiomyopathy was successfully established. Hyperglycemia-induced myocardial apoptosis was mediated, at least in part, by activation of the Nkx2.5-Calr-p53 pathway in vivo, resulting in cardiac dysfunction and hyperglycemia-induced cardiomyopathy.

Introduction

Diabetes mellitus has become a serious threat to public health in the 21st century. It is estimated that the number of adults diagnosed with diabetes worldwide will increase to 300 million by 2025 (Boudina and Abel, 2007; King et al., 1998). Patients with diabetes are at a higher risk for cardiovascular diseases, which have become the major cause of mortality in the diabetic population (Boudina and Abel, 2007; Garcia et al., 1974). Forty years ago, Rubler et al. (1972) first described diabetic cardiomyopathy, which could eventually develop in diabetic patients in the absence of any vascular pathogenesis (Huynh et al., 2014; Caiet al., 2002). Many studies have shown that hyperglycemia is an independent risk factor for cardiac damage, leading to diabetic cardiomyopathy (Caiet al., 2002; Devereux et al., 2000; Singh et al., 2000). Moreover, accumulating evidence has shown increased apoptosis in the hearts of diabetic patients (Caiet al., 2002; Palmieriet al., 2008; Frustaci et al., 2000) and streptozotocin-treated animals (Caiet al., 2002; Kajstura et al., 2001), and indicated its important role in the development of diabetic cardiomyopathy (Huynh et al., 2014; Huynh et al., 2013).

Zebrafish (Danio rerio) is a well-recognized vertebrate for studying cardiogenesis

and human genetic diseases. However, adult zebrafish are still underutilized to model human diseases such as cardiomyopathy and heart failure. Currently, only two adult zebrafish models of cardiomyopathy have been developed (Sun et al., 2009; Ding et al., 2011). Many studies with zebrafish have been performed for examining diabetes (Gleeson et al., 2007; Jiménez-Amilburu et al., 2015; Liang et al., 2010), but the effects of hyperglycemia on the heart of adult zebrafish have never been reported. Thus, the aim of the present study was to characterize the mechanism of cardiac remodeling due to hyperglycemia in an adult zebrafish diabetic model.

Nkx2.5, a cardiac homeobox transcription factor, is critical in the generation of cardiac hypertrophy (Akazawa et al., 2005). Calr, known as a major Ca2+-binding chaperone residing in the endoplasmic reticulum, is an important cardiac embryonic gene (Qiu et al., 2009). Fetal gene reactivation is one of the characteristic genetic alterations involved in the pathology of cardiovascular diseases. Calr upregulation induces dilated cardiomyopathy and heart failure in the hearts of adult transgenic mice (Lee et al., 2013). Furthermore, Calr--deficient cells exhibit impairedp53 expression (Mesaeli et al., 2004). Transcription factor p53, located in the cell nucleus, not only regulates cell cycle progression but also can induce apoptosis in a variety of cells (Allen et al., 2005). Fiordaliso et al. (2001) first proposed the role of p53 in high-glucose-induced ventricular myocyte apoptosis.

Nkx2.5, Calr, andp53 are important factors in cardiovascular diseases; however, their regulatory effects in the progression of cardiomyopathy have not been extensively studied. A hyperglycemia-induced cardiomyopathy model was developed in adult zebrafish in this novel study. The significant loss of myocardial fibers and impaired cardiac function were noted, suggesting that myocardial apoptosis is a profound cardiac remodeling mechanism involved in the pathogenesis of diabetic cardiomyopathy. Moreover, the Nkx2.5-Calr-p53 signaling pathway and its effects on cardiac apoptosis were illustrated in this model and studied via in vitro experiments on primary cultured cardiomyocytes (CMs) in adult zebrafish.

Nonstandard Abbreviations and Acronyms

BL body length HR heart rate

BM body mass IVCT isovolumic contraction time

BMI body mass index IVRT isovolumic relaxation time

Calr Calreticulin SV stroke volume

CM Cardiomyocyte VA ventricular area

CO cardiac output VET ventricular ejection time

EF ejection fraction VV ventricular volume

FAC fractional area change VW ventricular weight

Results

Induction of hyperglycemia led to alterations of metabolism

Fish blood-glucose levels fluctuated dramatically depending on the glucose concentration after treatment by alternately immersing adult zebrafish in a glucose solution or water (Figure 1A and 1B). The average blood-glucose value following exposure to 2% glucose was in the hyperglycemic range, while it approached baseline levels following exposure to 0% glucose, which was similar to the response of diabetic individuals to dietary glucose uptake and insulin injections. Complementarily, glucose transporter-1 (GLUT1), which facilitates the transport of glucose across plasma membranes of mammalian cells, was detected by real-time polymerase chain reaction (PCR). GLUT1 in cell membranes is increased by reduced glucose levels and decreased by increased glucose levels (Olson et al., 1996). Hyperglycemia was accompanied by a marked reduction in GLUT1 expression in this study (Figure 1C), demonstrating impaired glucose utilization in the treated group from week 12. Moreover, increased body mass (BM) and body mass index (BMI) were noted in the glucose-treated fish after 8 weeks of treatment (Figure 1D and 1E), which was accompanied by increasing triglyceride levels from week 12 (Figure 1F). This finding, at least, partially indicated impaired lipid metabolism. Body length (BL) was not

different between the two groups throughout the whole study (Figure 1G). Moreover, significant mortality was detected in glucose-treated zebrafish especially in the first 4 weeks (Figure 1H).

Hyperglycemia induced cardiac remodeling in adult zebrafish

Significantly enlarged hearts were noted in the hyperglycemic fish in week 20 of treatment, as evidenced by markedly higher ratios of ventricular area to body mass (VA/BM) and ventricular area to body length (VA/BL) (Figure 2A-C). However, the ratio of ventricular weight to body mass (VW/BM) was not different between groups (Figure 2D). Histological staining and transmission electron microscopy (TEM) were performed to further assess myocardial alterations. The examination of ventricles with the anti-sarcomeric alpha-actinin antibody (Figure 2F-G") suggested an enlarged heart (Figure 2G), hypertrophic myocardium (Figure 2G'), and CMs (Figure 2G'') in the treated fish in week 32. Quantification of CM area revealed increased CM size from week 20 (Figure 2E). Hematoxylin and eosin (H&E) staining showed muscular disarray and myofibril loss in the treated fish in week 32 (Figure 3A') and dramatically reduced myocardial density (Figure 3A''). Myocardial nuclei density was calculated using the number of myocardial nuclei per field to myocardial density

(Supplementary Figure 1A), showing no difference in the two groups in week 32. This meant no increased number of myocardial cells in the enlarged heart. Besides, no interstitial fibrosis was detected by Masson's staining in the two groups (Supplementary Figure 1B and 1B').

The ratio of apoptotic myocardial nuclei (yellow, green plus red) to total myocardial nuclei (red) was measured, indicating significant apoptosis in the hyperglycemic fish compared with the wild type in week 32 (Figure 3B-B''). Longitudinal TEM images (Figure 3C and 3C') verified muscular disarray and myofibril loss, and transverse images (Figure 3C'') revealed myofibril loss in the hearts of treated fish. Moreover, no significant difference was observed in proliferating cell nuclear antigen (PCNA) staining of the two groups (Supplementary Figure 1C), suggesting that myocardial hyperplasia had no effect on heart enlargement. Taken together, these results led to the conclusion that myocardial apoptosis and hypertrophy were involved in cardiac remodeling of hyperglycemic zebrafish.

Hyperglycemia induced cardiac dysfunction in adult zebrafish

Electrocardiogram (ECG) performed to study hyperglycemia-induced myocardial electrophysiological changes revealed significantly decreased heart rate (HR) from week 18 (Figure 4A) and increased P-wave and QRS-wave amplitudes from week 32 (Figure 4B and 3C) in the hyperglycemia group. However, P-R and Q-T intervals, adjusted by HR, showed no significant changes (data not shown). The incidence of ST-T change from week 20 markedly increased (Figure 4D). Representative T-wave inversion is shown Figure 4F-b. The incremental occurrence of "voltage alternation" began in week 32 in the hyperglycemic fish (Figure 4E). A representative diagram is shown in Figure 4F-c. Other abnormal ECG changes, such as a prolonged P-P interval, were only detected in the treated fish (Figure 4F-d). A normal ECG recorded from the untreated fish is shown in Figure 4F-a.

Real-time PCR showed that fetal genes nppa and nppb were activated in the treated fish in week 32, with a 1.6-fold increase in nppa expression and 3.1-fold increase in nppb expression compared with the untreated fish (Figure 4G).

Cardiac function was dynamically monitored by echocardiography to determine how long zebrafish should be treated with glucose to establish this model. No significant

differences were noted in cardiac function after 12 weeks of treatment. The ventricular end-diastolic area and volume in the treated group were greater than those in the untreated group in week 20 (1.624 ± 0.396 vs 1.231 ± 0.321 mm2, P < 0.05; 1.457 ± 0.575 vs 0.933 ± 0.356 ^L, P < 0.05). Isovolumic relaxation time adjusted by HR (IVRTa) was dramatically shortened in the treated group (6.2 ± 3.4 vs 12.0 ± 3.6%, P < 0.01) and accompanied by reduced peak velocity of the atrioventricular (AV) valve (122.1 ± 20.4 vs 155.6 ± 32.7 mm/s, P < 0.05).

Echocardiographic parameters differed significantly between the two groups in week 32 of treatment (Table 1). Typical B-mode echocardiography images in week 32 are shown in Figure 4H and 4I. Data to evaluate ventricular morphology and function were automatically generated using the Vevo 2100 Workstation Software package (Supplementary Data: Video S1, wild type and treated). Representative images (Figure 4H' and 4I') were derived from Doppler echocardiography (Supplementary Data: Video S2, wild type and treated). The hyperglycemic fish showed a significantly increased BM. Both VA and ventricular volume (VV) increased at diastole and systole in the treated group, and after BM correction, the marked increase was still present compared with the untreated fish. Diastolic parameters showed that the peak velocity across the AV valve was slower in the treated fish. The differences in IVRT and IVRTa between the two groups were significant. Systolic indices showed shortened

ventricular ejection time adjusted by HR (VETa) and IVCTa in the hyperglycemic fish. Moreover, a markedly reduced HR and stroke volume (SV) resulted in decreased cardiac output (CO). The sharp decline in fractional area change (FAC) and ejection fraction (EF), two key indicators used to estimate cardiac function, demonstrated impaired systolic function in the hyperglycemic fish in week 32.

Hyperglycemia induced alterations of the Nkx2.5-Calr-p53 signaling pathway in zebrafish hearts

The expression levels of Nkx2.5, Calr, andp53 evaluated by real-time PCR were approximately 3.8-fold, 8.9-fold, and 3.6-fold higher, respectively, in hyperglycemic hearts than in untreated hearts (Figure 5A), which was consistent with the protein levels determined using Western blotting (Figure 5B). Moreover, double-staining of Calr orp53 with Mef2 on cryosections of adult zebrafish hearts indicated increased expression of Calr orp53 on CMs (Supplementary Figures 2 and 3).

In vitro high-glucose incubation of CMs induced apoptosis and alterations of the Nkx2.5-Calr-p53 signaling pathway

CMs were incubated with a high-glucose medium to explore whether myocardial apoptosis was directly related to hyperglycemia. The TUNEL assay results showed that CMs incubated with 20mM glucose for 24 h (Figure 5C-b) exhibited increased apoptosis compared with the wild-type group (Figure 5C-a). Incubation for 24 h with the addition of 10pM pifithrin-p (a specific inhibitor of p53) reduced CM apoptosis (Figure 5C-c). Thus, apoptosis in this model could be directly attributed to hyperglycemia via p53. The ratio of apoptotic CMs to the total number of CMs is shown in Figure 5D. The mRNA and protein expression of Nkx2.5, Calr, andp53 was consistently upregulated in CMs exposed to glucose (Figure 6A-D). To confirm the interactions of the Nkx2.5-Calr-p53 signaling pathway, CMs were harvested with 2.5pM Shz-1 for 72 h and 1pM retinoic acid (RA) for 96 h and analyzed by real-time PCR. Shz-1, used to upregulate Nkx2.5, activated not only Nkx2.5 but also its downstream target genes Calr and p53, and incremental mRNA expression was detected in the hyperglycemic fish compared with the untreated fish and dimethyl sulfoxide (DMSO) control (Figure 6E). The addition of RA, a compound used to

inhibit Calr, reduced the expression of Calr to 56% and the expression ofp53 to 63% within 96 h, but did not affect the expression of Nkx2.5 (Figure 6F). No differences in expression were detected compared with the untreated fish and DMSO control groups. Cell infection in vitro was used to inhibit the expression of Nkx2.5 or upregulate the expression of Calr genetically. Downregulation of Nkx2.5 induced decreased mRNA expression of Nkx2.5, Calr, andp53 (Figure 6G). Upregulation of Calr resulted in the increased expression ofp53, but the Nkx2.5 level remained unchanged (Figure 6H). Taken together, the results indicated that the Nkx2.5-Calr-p53 signaling pathway played an important role in the development of diabetic cardiomyopathy.

Discussion

Several diabetic models such as the db/db mouse model and the Zucker diabetic fatty rat model have been developed to study cardiomyopathy (Bugger et al., 2009). An adult zebrafish model of hyperglycemia-induced cardiomyopathy was established in this study after 32 weeks of glucose treatment. Hyperglycemia in fish was accompanied by abnormal lipid metabolism, characterized by obesity and hypertriglyceridemia, which was consistent with metabolic disturbances in diabetes. The glucose-treated fish also exhibited many other similar characteristics of human

diabetic cardiomyopathy.

Noninvasive echocardiography dynamically detects cardiac function in vivo. Diastolic dysfunction prior to systolic dysfunction was well characterized in the present model, which was consistent with the majority of evidence on diabetic cardiomyopathy (Huynh et al., 2014). Diastolic dysfunction was characterized by an enlarged ventricle, impaired IVRT, and reduced peak velocity across the AV valve in the hyperglycemic fish in week 20. Echocardiographic data revealed both diastolic and systolic dysfunction in the hyperglycemic fish in week 32, and SV, CO, FAC, and EF all declined dramatically, similar to what was seen in human adult diabetic cardiomyopathy. Markedly reduced IVCTa and VETa, to some extent, suggested decreased myocardial contractility of hyperglycemic hearts. The development of systolic dysfunction in experimental diabetic settings might be model dependent; systolic function was preserved in FVB/N mice when using multiple low doses of streptozotocin (Huynh et al., 2010; Ritchie et al., 2012; Huynh et al., 2013), yet decreased in streptozotocin-treated C57Bl/6 mice (Westermann et al., 2007). Moreover, as illustrated in Figure 4H', the dramatically small maximal early diastolic flow velocity (peak E) and E/A ratio, and the relatively large maximal late diastolic/atrial flow velocity (peak A), are opposite to what is seen in humans and other higher vertebrates. Thus, assessing cardiac diastolic function via E/A ratio

alteration in zebrafish has limitations.

The reduced HR seen in hyperglycemic fish was consistent with rodent models but different from what was seen in many diabetic humans (Boudina et al., 2007). The obvious decline in HR began in week 18, and no structural abnormalities or other functional alterations of the heart were identified at this stage. The increased frequency of ST-T change from week 20 indicated increased myocardial ischemia in the hyperglycemic fish. A previous study (Stern et al., 2009) reported that myocardial ischemia was more often painless in patients with diabetes (Raman et al., 1996), and resting ECG abnormalities could predict silent ischemia in asymptomatic diabetic individuals (Dweck et al., 2009). Schannwell et al. (2002) proposed the viewpoint that subtle ECG alterations might be the only way to diagnose early diabetic cardiomyopathy. ECG changes occurred at a much early stage in the present fish model, which is promising for the early diagnosis of diabetic cardiomyopathy. Voltage alternation is similar to the alternating pulse commonly seen in patients with heart failure. The increased occurrence provided evidence of impaired cardiac function in hyperglycemic fish in week 32 as assessed by echocardiography. Moreover, increased P- and QRS-wave amplitudes in week 32 reflected enlarged atrium and ventricle in the hyperglycemic heart, which was verified by echocardiography. QRS-wave changes in diabetic patients have been reported, but little attention has been given to

P-wave changes. Atrial enlargement usually occurs secondary to ventricular enlargement in diabetes. However, zebrafish atrium and human atria might play a different role in the cardiovascular system because in zebrafish the atrium has a similar size as the ventricle (Hu et al., 2001; Sun et al., 2008). Whether an early or late relationship exists between atrial enlargement and ventricular enlargement has not been shown by the present study.

Natriuretic peptides, such as nppa and nppb, have been considered hallmarks of increased ventricular dimensions and impaired systolic function (Raymond et al., 2003). The increased expression of nppa and nppb in the hyperglycemic fish in week 32 was another finding indicating ventricular enlargement and cardiac dysfunction.

Functional alterations are closely related to molecular and histopathological evidence of myocardial apoptosis in the hyperglycemic heart. Increased CM apoptosis is related to the transformation process from the compensated to decompensated state in the diabetic heart (Frustaci et al., 2000). Apoptosis induced by hyperglycemia caused the loss of contractile fibers and cardiac dysfunction in the present study, eventually resulting in diabetic cardiomyopathy.

The present study focused on Nkx2.5, Calr, and p53 to explore the underlying mechanism of the aforementioned findings. The increased expression of Nkx2.5 in

circulating cells was detected in patients with hypertrophic cardiomyopathy (Kontaraki et al., 2007). The significant increase in the expression of Nkx2.5 in the hyperglycemic group in the present study suggested its potential role in hyperglycemia-induced cardiomyopathy. The expression of Calr, an important fetal gene, sharply declined after birth and was at a negligible level in the adult heart (Mesaeli et al., 1999). The overexpression of Calr in CMs promoted apoptosis (Michalak et al., 2002). Calr reactivation reflected impaired cardiac function in the treated fish in week 32 in the present study. Interestingly, the overexpressed Calr in the mouse heart induced sinus bradycardia and complete heart block (Hattori et al., 2007), indicating that Calr abnormalities might be associated with the dysfunction of the conduction system. The hyperglycemic fish with overexpressed Calr had a markedly reduced HR and prolonged P-P interval; however, the detailed mechanisms by which Calr influenced the conduction required further study. A previous study showed that p53 was required for glucose-induced apoptosis (Keim et al., 2001) and could downregulate GLUT1 (Schwartzenberg-Bar-Yoseph et al., 2004). The increased expression ofp53 together with apoptosis and decreased GLUT1 were all involved in hyperglycemic cardiomyopathy, as shown in the present study.

It is important to discern whether upregulation of Nkx2.5, Calr, andp53 is a compensatory change to protect against cardiomyopathy. What is also necessary to

emphasize is that hyperglycemia in the present fish model was accompanied by obesity and high triglyceride levels, which might have additive effects with hyperglycemia. Therefore, in vitro study of zebrafish CMs was performed to determine the direct effects of high glucose and the roles of Nkx2.5, Calr, andp53.

First, a series of experiments were performed to explore the optimal conditions for glucose treatment of zebrafish CMs, as this had not been previously studied. Glucose concentrations of 5mM, 10mM, 20mM, 30mM, 40mM, and 50mM and exposure times of 12, 24, and 48 h were studies. The results showed that exposure at a concentration from 10mM to 30mM for 24 h was the most appropriate treatment condition. Finally, treatment with 20mM glucose for 24 h was performed in the present study. The mRNA expression of Nkx2.5, Calr, and p53 was determined when CMs were stimulated with glucose for 24 h at different concentrations, or 20mM glucose for different times (Supplementary Figure 4). Although a previous study showed that Nkx2.5 directly regulated the Calr-1 promoter and activated Calr in rat models and humans, little was known about the regulatory effect of Nkx2.5 and Calr in a fish model. Hence, CMs were incubated with Shz-1, which significantly induced the expression of Nkx2.5, and the expression of both Calr and p53 notably increased. Genetically, knockout of Nkx2.5 gave rise to the decreased levels of both Calr and p53. This suggested that Nkx2.5had a positive regulatory effect, at least on Calr, in the

present model. One study investigated the role of Calr in the regulation of apoptosis via modulating p53 expression; however, regulatory evidence of Calr and p53 in the hyperglycemic heart is still scarce. RA, a Calr inhibitor that has been shown to reduce Calr in human myeloid cells by 60% within 4 days, was used in the present study (Clark et al., 2002). RA treatment led to a prominent decline in Calr as well asp53 expression, indicating that reduced p53was directly associated with the expression of Calr. To support this, cell infection was performed to specifically upregulate Calr, leading to the increased expression ofp53. Importantly, Nkx2.5 was not affected by Calr orp53 expression. In summary, the data suggested that Nkx2.5 positively regulated Calr, and Calr was also an upstream activator of p53 and vital in the progression of hyperglycemia-induced cardiomyopathy of adult zebrafish.

In conclusion, this study indicated that an adult zebrafish model of diabetic cardiomyopathy was a novel and promising vertebrate model, complementing existing rodent models. A novel molecular pathway of Nkx2.5-Calr-p53 was shown in hyperglycemia-induced apoptosis, which might greatly benefit future study of therapeutic interventions for diabetic cardiomyopathy.

Materials and Methods Hyperglycemic zebrafish model

Zebrafish (D. rerio), AB-line, 18-month-old female adults were used and divided into wild-type (n = 200) and treated groups (n = 200). Fish were maintained under constant conditions of 14-h light/10-h dark at 28°C and fed twice every day. Every 40 fish, random adults from different clutches, were placed in the same 2.5-L tanks. The water used for wild-type and treated fish was identical (same mineral content) except for the addition of glucose. Zebrafish were exposed to freshly prepared 2%/0% glucose (Sangon Biotech Co., Ltd. Shanghai, China) solution to induce hyperglycemia. Fish were alternately placed in the two solutions every 24 h. Following alternative treatment, three fish of each group were randomly chosen for blood-glucose measurement using a blood-glucose monitor (One-Touch Ultra) every day for the first week, then every week until week 32. The procedures were performed as previously described, and glucose concentrations more than 11.11 mmol/L were considered hyperglycemic (Gleeson et al., 2007).

Measurement of zebrafish and ventricular size

Zebrafish were anesthetized with 0.16 mg/mL of tricaine (Western Chemical Industries) solution and semi-dried, and then BM in mg and BL in mm were measured. The BMI (in mg/mm2) was determined by BM to the square of BL for assessing obesity. VA/BM, VA/BL, and VW/BM were chosen as three indexes to assess the ventricle size. The dissected hearts were placed next to a millimeter ruler and imaged using SPOT Software attached to a Zeiss Stereomicroscope to measure VA. The largest projection of a ventricle was outlined using the ImageJ software. VW (in mg) was also measured on a digital scale. VA/BM or VA/BL was then determined from the ratio of the largest projection area of the ventricle (in mm2) divided by BM (in g) or BL (in mm). The VW (in mg) was divided by body mass (in mg) to determine VW/BM.

Survival curve

The number of fish was counted weekly, and the total number in each group before treatment represented 100% survival. The number of fish in each group every 2 weeks was recorded.

Triglyceride measurement

Blood samples were withdrawn from zebrafish after an overnight fast, measured using enzymatic kits (KeHua Bio-engineering, Shanghai, China), and detected using a Multiskan MK3 instrument (Thermo Electron Corporation) at 550 nm absorbance.

Histological staining and quantification

Paraffin sections of hearts were prepared and stained with H&E (Sangon Biotech Co., Ltd.) or Trichrome Stain Masson Kit (Baso Diagnostics Inc. Zhuhai, China) using standard protocols and then photographed using an Olympus DP70 microscope. Myocardial pixel density and myocardial nuclei density were measured on H&E sections of the entire ventricle using Adobe Photoshop 7.0 imaging software as previously published (Sun et al., 2015). The formula used was as follows: myocardial density (%) = pixel (area of myocardium)/pixel (total area of ventricle). Myocardial nuclei density = number of myocardial nuclei per field/myocardial density.

Immunofluorescence and TUNEL assay

Cryostat-sectioned ventricles (10 [m thickness) or primary cultured CMs were incubated with primary antibody for 2 h and secondary antibody for 30 min at 37°C and imaged using a Zeiss AxioCam MRm microscope equipped with AxioVision software (Carl Zeiss). Apoptosis was detected using a TUNEL kit (Sangon Biotech Co., Ltd.) and sequentially stained with Mef2 antibody to identify myocardium or CMs. For quantification, the percentages of apoptotic myocardial nuclei to total myocardial nuclei and PCNA-positive area to total myocardial area were measured in stained tissue sections, and the percentage of apoptotic CMs to total number of CMs was determined in stained CMs. Primary antibodies included anti-sarcomeric alpha-actinin antibody (1:200, Abcam), Nkx2.5 (1:500, LifeSpan), Calr (1:1000, Abcam), p53 (1:200, Abcam), Mef2 (1:200, Santa Cruz Biotechnology), PCNA (1:1000, Abcam). Secondary antibodies included AlexFluor-conjugated anti-mouse immunoglobulin G (IgG) (1:200, Abcam) and AlexFluor-conjugated anti-rabbit IgG (1:100, Invitrogen).

Transmission electron microscopy

Dissected fish ventricles were fixed in 2% glutaraldehyde at 4°C for at least 2 h, and then dehydrated, embedded, sectioned, and imaged by the Electron Microscopy Core Facility using a Philips CM-120 transmission electron microscope.

Electrocardiogram

ECG was recorded using the BIOPAC ECG100C System (CA, USA) as previously described (Sun et al., 2015; Milan et al., 2006). Fish were anesthetized for 5 min, and each ECG was stabilized for 2 min and then recorded. ECG intervals, segments, and HR were measured and statistically analyzed. ST-T depression or T-wave inversion was collectively referred to as ST-T change in the present study, suggesting myocardial ischemia in humans. The amplitude of the QRS-wave alternating between high and low was defined as voltage alternation, which was similar to the alternating pulse in humans. The prolonged P-P interval in fish equated to sinus arrest in human ECG.

Echocardiography

Echocardiography was performed as in a previous study (Sun et al., 2015). Ventricular dimensions were estimated using area (mm2) and volume (mm3), and calculated using the area-length (A-L) formula. SV (^L) and CO (цЬ/min) were assessed via Doppler measurement. FAC and EF were used to evaluate systolic function. FAC was defined as (end-diastolic area minus end-systolic area)/end-diastolic area. EF was defined as (end-diastolic volume minus end-systolic volume)/end-diastolic volume. Time parameters including isovolumic relaxation time (IVRT), ventricular ejection time (VET), and isovolumic contraction time (IVCT) were calculated and adjusted by HR, representing the percentage to a heartbeat time, referred to as IVRTa, VETa, and IVCTa, respectively. Velocity parameters such as the blood flow velocity across the atrioventricular (AV) valve and bulboventricular (BV) valve were also recorded. Each measurement was analyzed with an average of three consecutive heartbeats.

Quantitative real-time PCR

RNA isolation and real-time PCR protocols were used as described in a previous study (Sun et al., 2015). The formula 2"AACt was used to determine the fold-change in target-gene expression normalized with 18S. Gene primers are listed in Supplementary Table 1.

Western blot analysis

Dissected hearts were manually homogenized and lysed in SDS sample buffer containing protease inhibitor (Roche). Protein was extracted and subjected to Western blotting following a standard protocol (Ding et al., 2011). Primary antibodies included Nkx2.5 (1:200, LifeSpan), Calr (1:1000, Abcam), p53 (1:200, Abcam), and beta-actin (1:5000, Sigma).

Primary cardiomyocyte culture and drug treatment

CMs from ventricles were dissociated as described in a previous study (Sander et al., 2013) and cultured at 28.5°C for 24 h in L-15 media with 10% fetal bovine serum

(Invitrogen) before being exposed to drugs. Shz-1 (a compound for upregulating Nkx2.5), RA (a compound for inhibiting Calr), and pifithrin-[ (a specific inhibitor of p53) were purchased from Sigma-Aldrich (Shanghai, China) and dissolved in DMSO for storage. Drug treatment conditions included 20mM glucose for 24 h, 2.5[M Shz-1 for 72 h, 1[M RA for 96 h, and 10[M pifithrin-[ for 24 h. The final DMSO concentration was kept at 0.1%.

Plasmid construction production of lentivirus and cell infection

The production of lentivirus and cell infection was performed as described in previous studies (Ruokun et al., 2016; Song et al., 2016). The expression of Zebrafish Calr plasmid was based on the lentivirus vector pCDH-CMV-MCS-EF1-Puro. First, the DNA fragment of Calr was obtained by PCR using the forward primer F, 5'-GACTCAGATCTCGAGATGCGGATCACTGCTGCAGT-3' and reverse primer R, 5'- TCGACTGCAGAATTCTTACAATTCATCTTTAGGGAGCGCATCAT-3', and cloned into the XhoI/EcoRI sites. Nkx2.5-specific and control short-hairpin RNA was constructed into the AgeI/EcoRI sites of lentivirus vector pLKO.1. Short-hairpin RNA was synthesized by GenePharma (Shanghai, China): sense: 5' GCAAAGACAGATGACACATTT 3'; antisense: 5' AAATGTGTCATCTGTCTTTGC

3'. Shuttle vectors combined with helper plasmids were transfected into the 293T cells using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen, USA). The virus was harvested and infected the CMs of zebrafish.

Statistical analysis

Continuous variables were presented as means ± standard deviations, and differences between two groups were compared using the Student t test. Categorical variables were presented as counts or percentages, and the chi-square test was used to examine differences. Statistical significance was considered at P < 0.05.

Acknowledgments

The authors thank members of the Cell Biology and Histology Department for their technical assistance.

Competing Interests

The authors do not have any competing or financial interests.

Author Contributions

Sun Yanyi designed and performed the experiments, analyzed data, and wrote and edited the manuscript. Wang Qiuyun carried out the experiments and analysis. Fang Yuehua provided technical assistance with echocardiography. Wu Chunfang took responsibility for zebrafish maintenance. Lu Guoping edited the manuscript. Chen Zhenyue designed the experiments and edited the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (81370331) and the project from the Science and Technology Commission of Shanghai Municipality (15140901500) to Z. Chen.

References

Akazawa H, Komuro I. (2005). Cardiac transcription factor Csx/Nkx2-5: Its role in cardiac development and diseases. Pharmacol Ther 107, 252-268.

Allen DA, Yaqoob MM, Harwood SM. (2005). Mechanisms of high glucose-induced apoptosis and its relationship to diabetic complications. J Nutr Biochem 16, 705-713.

Boudina S, Abel ED. (2007).Diabetic cardiomyopathy revisited.Circulation115, 3213-3223.

Bugger H, Abel ED. (2009). Rodent models of diabetic cardiomyopathy. Dis Models Mech2, 454-466.

Cai L, Li W, Wang G, Guo L, Jiang Y,Kang YJ. (2002). Hyperglycemia-induced apoptosis in mouse myocardium mitochondrial cytochrome c-mediated caspase-3 activation pathway. Diabetes51, 1938-1948.

Clark RA, Li SL, Pearson DW, Leidal KG, Clark JR, Denning GM, Reddick R, Krause KH, Valente AJ. (2002). Regulation of calreticulin expression during

induction of differentiation in human myeloid cells. Evidence for remodeling of the endoplasmic reticulum. J Biol Chem277, 32369-32378.

Devereux RB, Roman MJ, Paranicas M, O'Grady MJ, Lee ET, Welty TK,Fabsitz RR,Robbins D,Rhoades ER,Howard BV. (2000). Impact of diabetes on cardiac structure and function the strong heart study. CirculationlOl, 2271-2276.

Ding Y, Sun X, Huang W, Hoage T, Redfield M, Kushwaha S, Sivasubbu S, Lin X, Ekker S, Xu X. (2011). Haploinsufficiency of target of rapamycin attenuates cardiomyopathies in adult zebrafish. Circ Res109, 658-669.

Dweck M, Campbell IW, Miller D, Francis CM. (2009). Mechanisms of silent myocardial ischaemia: with particular reference to diabetes mellitus. Brit J Diabetes Vasc Dis9, 99-102.

Fiordaliso F, Leri A, Cesselli D, Limana F, Safai B, Nadal-Ginard B, Anversa P, Kajstura J. (2001). Hyperglycemia activates p53 and p53-regulated genes leading to myocyte cell death. Diabetes 50, 2363-2375.

Frustaci A, Kajstura J, Chimenti C,Jakoniuk I, Leri A, Maseri A, Nadal-Ginard B,AnversaP. (2000). Myocardial cell death in human diabetes. Circ Res 87, 1123-1132.

Frustaci A, Kajstura J, Chimenti C, Jakoniuk I, Leri A, Maseri A, Nadal-Ginard

B, Anversa P. (2000). Myocardial cell death in human diabetes. Circ Res87, 1123-1132.

Garcia MJ, McNamara PM, Gordon T, Kannel WB. (1974). Morbidity and mortality in diabetics in the Framingham population: sixteen year follow-up study. Diabetes23, 105-111.

Gleeson M, Connaughton V, Arneson LS. (2007). Induction of hyperglycaemia in zebrafish (Danio rerio) leads to morphological changes in the retina. Acta Diabetol44, 157-163.

Hattori K, Nakamura K, Hisatomi Y, Matsumoto S, Suzuki M, Harvey RP, Kurihara H, Hattori S, Yamamoto T, Michalak M, et al. (2007). Arrhythmia induced by spatiotemporal overexpression of calreticulin in the heart. Mol Genet Metab91, 285-293.

Hu N, Yost HJ, Clark EB. (2001). Cardiac morphology and blood pressure in the adult zebrafish. Anat Rec264, 1-12.

Huynh K, Bernardo BC, McMullen JR, Ritchie RH. (2014). Diabetic cardiomyopathy: Mechanisms and new treatment strategies targeting antioxidant signaling pathways. Pharmacol Ther142, 375-415.

Huynh K, Kiriazis H, Du XJ, Love JE, Gray SP, Jandeleit-Dahm KA, McMullen

JR, Ritchie RH. (2013). Targeting the upregulation of reactive oxygen species subsequent to hyperglycemia prevents type 1 diabetic cardiomyopathy in mice. Free Radic Biol Med60, 307-317.

Huynh K, Kiriazis H, Du XJ, Love JE, Gray SP,Jandeleit-Dahm KA,Mcmullen JR, Ritchie RH. (2013). Targeting the upregulation of reactive oxygen species subsequent to hyperglycemia prevents type 1 diabetic cardiomyopathy in mice. Free Radic BiolMed60, 307-317.

Huynh K, McMullen JR, Julius TL, Tan JW, Love JE, Cemerlang N, Kiriazis H, Du XJ, Ritchie RH. (2010). Cardiac-specific IGF-1 receptor transgenic expression protects against cardiac fibrosis and diastolic dysfunction in a mouse model of diabetic cardiomyopathy. Diabetes59, 1512-1520.

Jiménez-Amilburu V, Jong-Raadsen S, Bakkers J, Spaink HP, Marín-Juez R.

(2015). GLUT12 deficiency during early development results in heart failure and a diabetic phenotype in zebrafish. J Endocrinol224, 1-15.

Kajstura J, Fiordaliso F, Andreoli AM, Li B, Chimenti S, Medow MS, Limana F, Nadal-Ginard B, Leri A, Anversa P. (2001). IGF-1 overexpression inhibits the development of diabetic cardiomyopathy and angiotensin II-mediated oxidative stress. Diabetes50, 1414-1424.

Keim AL, Chi MM, Moley KH. (2001). Hyperglycemia - induced apoptotic cell death in the mouse blastocyst is dependent on expression of p53. Mol Reprod Dev60, 214-224.

King H, Aubert RE, Herman WH. (1998). Global burden of diabetes, 1995-2025: prevalence, numerical estimates, and projections. Diabetes care21, 1414-1431.

Kontaraki JE, Parthenakis FI, Patrianakos AP, Karalis IK, Vardas PE. (2007). Altered expression of early cardiac marker genes in circulating cells of patients with hypertrophic cardiomyopathy. Cardiovasc Pathol 16, 329-335.

Lee D, Oka T, Hunter B, Robinson A, Papp S, Nakamura K, Srisakuldee W, Nickel BE, Light PE, Dyck JR, et al. (2013). Calreticulin induces dilated cardiomyopathy. PLoS one8, e56387.

Liang J, Gui Y, Wang W, Gao S, Li J, Song H. (2000). Elevated glucose induces congenitalheart defects by altering the expression of tbx5, tbx20, and has2 in developing zebrafish embryos. Birth Defects Res A Clin Mol Teratol88, 480-486.

Mesaeli N, Nakamura K, Zvaritch E, Dickie P, Dziak E, Krause KH, Opas M, MacLennan DH, Michalak M. (1999). Calreticulin is essential for cardiac development. J Cell Biol 144, 857-868.

Mesaeli N, Phillipson C. (2004). Impaired p53 expression, function, and nuclear

localization in calreticulin-deficient cells. Mol Biol Celll5, 1862-1870.

Michalak M, Lynch J, Groenendyk J, Guo L, Robert Parker JM, Opas M. (2002). Calreticulin in cardiac development and pathology. Biochim Biophys Acta1600, 32-37.

Milan DJ, Jones IL, Ellinor PT, MacRae CA. (2006). In vivo recording of adult zebrafish electrocardiogram and assessment of drug-induced QT prolongation. Am J Physiol Heart Circ Physiol291, H269-H273.

Olson AL, Pessin JE. (1996). Structure, function, and regulation of the mammalian facilitative glucose transporter gene family. Annu Rev Nutr16, 235-256.

Palmieri V, Capaldo B, Russo C,Iaccarino M, Pezzullo S,Quintavalle G,Di MG,Riccardi G,Celentano A. (2008). Uncomplicated type 1 diabetes and preclinical left ventricular myocardial dysfunction: insights from echocardiography and exercise cardiac performance evaluation. Diabetes Res Clin Pract79, 262-268.

Qiu Y, Michalak M. (2009). Transcriptional control of the calreticulin gene in health and disease. Int JBiochem CellBiol41, 531-538.

Raman M, Nesto RW. (1996). Heart disease in diabetes mellitus. Endocrinol Metab Clin North Am25, 425-438.

Raymond I, Groenning BA, Hildebrandt PR, Nilsson JC, Baumann M, Trawinski J, Pedersen F. (2003). The influence of age, sex and other variables on the plasma level of N-terminal pro brain natriuretic peptide in a large sample of the general population. Heart89, 745-751.

Ritchie RH, Love JE, Huynh K, Bernardo BC, Henstridge DC, Kiriazis H, Tham YK, Sapra G, Qin C, Cemerlang N, et al. (2012). Enhanced phosphoinositide 3-kinase (p110a) activity prevents diabetes-induced cardiomyopathy and superoxide generation in a mouse model of diabetes. Diabetologia55, 3369-3381.

Rubler S, Dlugash J, Yuceoglu YZ,Kumral T,Branwood AW,Grishman A.

(1972). New type of cardiomyopathy associated with diabetic glomerulosclerosis. Am J Cardiol30, 595-602.

Chen R, Xue Y, Yang F, Wei X, Song L, Liu X. (2016). Lentivirus-mediated silencing of HSDL2 suppresses cell proliferation in human gliomas. Tumour Biol, 1-13.

Sander V, Sune G, Jopling C, Morera C, Izpisua Belmonte JC. (2013). Isolation and in vitro culture of primary cardiomyocytes from adult zebrafish hearts. Nat Protoc8, 800-809.

Schannwell CM, Schneppenheim M, Perings S, Plehn G, Strauer BE. (2002). Left

ventricular diastolic dysfunction as an early manifestation of diabetic cardiomyopathy. Cardiology98, 33-39.

Schwartzenberg-Bar-Yoseph F, Armoni M, Karnieli E. (2004). The tumor suppressor p53 down-regulates glucose transporters GLUT1 and GLUT4 gene expression. Cancer Res64, 2627-2633.

Singh JP, Larson MG, O'Donnell CJ, Wilson PF, Tsuji H, Lloyd-Jones DM, Levy D. (2000). Association of hyperglycemia with reduced heart rate variability (The Framingham Heart Study). Am J Cardiol86, 309-312.

Song M, He G, Wang Y, Pang X, Zhang B. (2016). Lentivirus-mediated Knockdown of HDAC1 Uncovers Its Role in Esophageal Cancer Metastasis and Chemosensitivity. J Cancer7(12), 1694-1700.

Stern S, Sclarowsky S. (2009). The ECG in diabetes mellitus. Circulation 120, 1633-1636.

Sun L, Lien CL, Xu X, Shung KK. (2008). In Vivo Cardiac Imaging of Adult Zebrafish Using High Frequency Ultrasound (45-75 MHz). Ultrasound Med Biol34, 31-39.

Sun X, Hoage T, Bai P, Ding Y, Chen Z, Zhang R, Huang W, Jahangir A, Paw B,

Li YG, et al. (2009). Cardiac hypertrophy involves both myocyte hypertrophy and

hyperplasia in anemic zebrafish. PLoS One4, e6596.

Sun Y, Fang Y, Xu X, Lu G, Chen Z. (2015). Evidence of an Association between Age-Related Functional Modifications and Pathophysiological Changes in Zebrafish Heart. Gerontology61, 435-47.

Westermann Dl, Rutschow S, Jäger S, Linderer A, Anker S, Riad A, Unger T, Schultheiss HP, Pauschinger M, Tschöpe C. (2007). Contributions of inflammation and cardiac matrix metalloproteinase activity to cardiac failure in diabetic cardiomyopathy the role of angiotensin type 1 receptor antagonism. Diabetes56, 641-646.

Tables

Table l. Zebrafish body mass and echocardiography parameters in week 32

Wild type (nontreated) Glucose treated (n = 20) (n = 20)

BM (g) 0.520 ± 0.061 0.575 ± 0.056*

HR (beats/min) 91 ± 22 69 ± 21*

VA (mm2)

End-diastolic End-systolic VA/BM (mm2/g) End-diastolic End-systolic VV (^L)

End-diastolic End-systolic VV/BM (^L/g) End-diastolic End-systolic

1.397 ± 0.155 0.949 ± 0.181

2.715 ± 0.305 1.694 ± 0.224

1.136 ± 0.248 0.616 ± 0.224

2.167 ± 0.428 1.209 ± 0.461

1.763 ± 0.411* 1.232 ± 0.226*'

3.261 ± 0.475* 2.282 ± 0.330*!

1.565 ± 0.504* 0.913 ± 0.247*

2.835 ± 0.704* 1.724 ± 0.339*

Atrioventricular valve

Mean velocity (mm/s) 115.9 ± 19.9 110.4 ± 26.8

Peak velocity (mm/s) 215.4 ± 31.0 178.1 ± 34.9*

Velocity integral 7.459 ± 1.774 7.314 ± 1.963

Peak E velocity (mm/s) 12.7 ± 7.9 10.9 ± 3.8

Peak A velocity (mm/s) 199.7 ± 34.1 192.6 ± 43.4

E/A ratio 0.065 ± 0.036 0.064 ± 0.027

Bulboventricular valve

Mean velocity (mm/s) 58.8 ± 18.7 53.7 ± 17.0

Peak velocity (mm/s) 89.4 ± 32.15 80.8 ± 27.9

Velocity integral 11.459 ± 3.991 10.967 ± 5.014

IVRT (ms) 56 ± 9 41 ± 12*

IVRTa (%) 8.3 ± 1.7 4.8 ± 2.0**

IVCT (ms) 58 ± 7 50 ± 8*

IVCTa (%) 8.9 ± 2.6 5.8 ± 2.4*

VET (ms) 177 ± 37 181 ± 30

VETa (%) 25.0 ± 3.3 20.3 ± 5.3*

SV (^L) 1.594 ± 0.530 1.094 ± 0.469*

CO (^L/min) 142 ± 65 73 ± 32**

FAC (%) 0.346 ± 0.064 0.264 ± 0.088*

EF (%) 0.525 ± 0.098 0.371 ± 0.115**

Values are expressed as mean ± standard deviation.

BM, Body mass; CO, cardiac output; E/A, E to A ratio; EF, ejection fraction, defined as (end-diastolic volume minus end-systolic volume)/end-diastolic volume; FAC, fractional area change, defined as (end-diastolic area minus end-systolic area)/end-diastolic area; HR, heart rate; IVCT, isovolumic contraction time; IVCTa, IVCT adjusted by a heartbeat time; peak A velocity, maximal late diastolic/atrial flow velocity; IVRT, isovolumic relaxation time; IVRTa, IVRT adjusted by a heartbeat time; peak E velocity, maximal early diastolic flow velocity. SV, stroke volume; VA, ventricular area; VET, ventricular ejection time; VETa, VET adjusted by a heartbeat time; VV, ventricular volume. *P < 0.05, **P < 0.01 compared with wild-type zebrafish.

Figures

Figure 1. Induction of hyperglycemia led to alterations of metabolism. (A and B)

Blood-glucose level was detected daily for the first week (A), and then weekly until

32 weeks (B). Levels fluctuated with the glucose levels in the environment. Values

higher than11.11 mmol/L (dashed line) were considered hyperglycemic.

Blood-glucose levels of treated zebrafish in glucose solutions alternated between 2%

(solid lines) and 0% glucose (dotted lines) for up to 32 weeks. (C) Downregulated

expression of GLUT1 mRNA in treated fish from week 12. (D) Increased body mass

in treated fish from week 8. (E) Increased BMI in treated fish from week 8. (F)

Increased triglyceride levels in treated fish from week 12. (G) Preserved body length. (H) Survival curves (Kaplan-Meier representation) of the wild-type (n = 200) and treated fish (n = 200) within 20 weeks. Values are mean ± standard deviation. *P < 0.05, **P < 0.01 compared with the wild-type group. n = Number of fish examined.

Wild-type Treated

Alpha-actinin — Alpha-actinin

Alpha-actinin Alpha-actinin

Alpha-actinin Alpha-actinin

Figure 2. Hyperglycemia induced heart enlargement and myocardial hypertrophy. (A) Enlarged heart in the treated fish compared with the control group in week 20 (n = 10 fish); scale bar = 1 mm. (B-D) Quantification of ventricular area to body mass (VA/BM) (B), ventricular area to body length index (VA/BL) (C), and ventricular weight to body mass (VW/BM) (D) at different time points after glucose treatment. (E) Quantification of cardiomyocyte (CM) area indicated that CM size increased in the hearts of the treated fish from week 20. (F, G) Alpha-actinin antibody staining showed enlarged ventricles in the treated fish (G) compared with that in the

wild-type group (F) in week 32 (n = 10 fish); scale bar = 100 p,m. (F' and G') Higher magnification images of ventricles in week 32 stained by alpha-actinin antibody showed hypertrophic myocardium in the treated fish (G') compared with that in the wild-type group (F') (n = 10 fish); scale bar = 10 p,m. (F'' and G'') Representative images of single CMs stained with alpha-actinin antibody, dissociated from the hearts of the wild-type (F'') and treated fish (G'') in week 32 (n = 10 fish); scale bar = 10 p,m. Values are mean ± standard deviation. *P < 0.05, **P < 0.01 compared with the wild-type group. n = Number of fish examined.

Figure 3. Hyperglycemia induced muscular disarray, myofibril loss, and apoptosis activation. (A and A') H&E staining of ventricle sections showed muscular disarray and myofibril loss in treated fish (A') compared with the wild-type group (A) after 32-week treatment (n = 20 field, repeated five times); scale bar = 100 p,m. (A'') Quantification analysis of ventricular myocardial density in H&E stained hearts between the two groups in weeks 8 and 32. (B and B') TUNEL (green) stained sectioned ventricles co-stained with Mef2 (red) of wild-type (B) and treated fish (B') in week 32 (n = 20 field, repeated five times); scale bar = 10 p,m. Arrows: TUNEL +

/Mef2+; arrowheads: TUNEL + /Mef2-. (B'') Measurement of the ratio of apoptotic nuclei (yellow, green plus red) to total myocardial nuclei (red) between the two groups in weeks 8 and 32. (C, C') Longitudinal TEM image verified muscular disarray and myofibril loss detected in the hearts of the treated fish (C') compared with that in the wild-type group (C) (n = 20 field, repeated five times); scale bar = 2 p,m. (C'') Transverse TEM image showed myofibril loss (arrows) in the hearts of treated fish. Inset is higher magnification image. Scale bar = 2 p,m. (A'' and B'') Values are mean ± standard deviation. **P < 0.01 compared with the wild-type group. n = Number of fish examined.

Figure 4. Hyperglycemia induced cardiac dysfunction. (A) Analysis of heart rate at different time points. (B) Analysis of P-wave amplitude at different time points. (C) Analysis of QRS-wave amplitude at different time points. (D) Percentage of ST-T change (T-wave inversion or ST-T depression). (E) Percentage of voltage alteration. (F) Typical ECG diagrams: a, normal ECG; b, T-wave inversion; c, voltage alteration; and d, prolonged P-P interval (sinus arrest). (G) Real-time PCR analysis of the expression of nppa and nppb in wild-type and treated zebrafish in week 32. (H, I) Typical B-mode echocardiography images of wild-type (H) and treated fish (I) to evaluate ventricular morphology and function (n = 20 fish). (H' and I') Doppler-derived images of atrioventricular (AV) valve velocity of the wild-type (H') and treated fish (I') (n = 20 fish). (A-F) Values are reported as mean ± standard deviation. (H-I') Image data were automatically generated using the Vevo 2100 Workstation Software package. *P < 0.05, **P < 0.01 compared with the wild-type group. n = Number of fish examined.

Figure 5. High-glucose induced alterations of the Nkx2.5-Calr-p53 signaling pathway and apoptosis. (A) Real-time PCR analysis of the expression of Nkx2.5, Calr, andp53 in the wild-type and treated fish in week 32 (n = 8 fish per group). (B) Western blot analysis of the expression of Nkx2.5, Calr, andp53 in the wild-type and treated fish in week 32 (n = 8 fish, repeated three times). (C) Merged images of cardiomyocytes co-stained with Mef2 (red) and TUNEL (green) in the wild-type group (a), CMs exposed to 20mM glucose (b), and CMs exposed to 20mM glucose together with 10pM pifithrin-p (c) (n = 20 field, repeated five times). Arrows: TUNEL + /Mef2 + CMs. Scale bar = 0.1 mm. (D) Quantitation of apoptotic CMs to

total number of CMs in vitro of the three groups. CMs without any treatment, with 20mM glucose, with 20mM glucose plus 10pM pifithrin-p (n = 20 field per group, repeated five times). (A, D) Bars represent mean ± standard error of the mean. **P < 0.01 compared with the wild-type group. #P < 0.05 compared with 20mM glucose group.

Figure 6. Effects of high glucose, drugs, and cell infection on cardiomyocytes.

(A-D) Cardiomyocytes (CMs) were incubated with 20mM glucose for 24 h for analysis. (A and A') Nkx2.5 antibody staining showing increased Nkx2.5 level in glucose-treated CMs (A') compared with the wild-type group (A) (n = 20 field, repeated five times); scale bar = 0.1 mm. (B and B') Calr antibody staining showed increased Calr level in glucose-treated CMs (B') compared with the wild-type group (B) (n = 20 field, repeated five times); scale bar = 0.1 mm. (C and C') p53 Antibody staining showed increased p53 levels in glucose-treated CMs (C') compared with the wild-type group (C) (n = 20 field, repeated five times); scale bar = 0.1 mm. (D)

Expression levels of Nkx2.5, Calr, andp53 determined by real-time PCR. (E) Real-time PCR analysis of Nkx2.5, Calr, andp53 in CMs exposed to 2.5pM Shz-1 compared with the wild-type fish and DMSO control. (F) Real-time PCR analysis of Nkx2.5, Calr, and p53 in CMs exposed to 1pM retinoic acid compared with the wild-type fish and DMSO control. (G) Changes in Calr andp53 levels in CMs with altered expression of Nkx2.5. (H) Upregulation of Calr expression increased p53 levels in CMs. (D-H) Bars represent mean ± standard error of the mean (n = 5-6 fish per group). *P < 0.05, **P < 0.01compared with the wild-type group. #P < 0.05, ##P < 0.01compared with the DMSO control (0.1%).

Supplementary Table 1

Table S1. Gene-specific primers for real-time PCR

Primer sequence (5'-3')

Nkx2.5-F GGGATGGTAAACCGTGTCTGG Nkx2.5-R TAGTTGCTGTTGGACTGTGAAGG Calr-F AAACAGATTGACAACCCCTCCT

Calr-R CAGCCTCCTCAACATCATCGG

p53-F ATAAGAGTGGAGGGCAATCAGC

p53-R AGTGATGATTGTGAGGATGGGC

GLUT1-F CCTGTTGCCCTTCTGTCCTG GLUT1-R CCTCATCATCTGTCTGCTCTCG nppa-F GATGTACAAGCGCACACGTT

nppa-R TCTGATGCCTCTTCTGTTGC nppb-F CATGGGTGTTTTAAAGTTTCTCC nppb-R CTTCAATATTTGCCGCCTTTAC 18S-F CACTTGTCCCTCTAAGAAGTTGC

18S-R GGTTGATTCCGATAACGAACGA

F, forward; R, reverse.

Supplementary Figures

Supplementary Figure 1. (A) Myocardial nuclei density, defined as number of myocardial

nuclei per field to myocardial density, showing no difference in two groups at week 32 (p >

0.05). (B) Masson's staining did not show any interstitial fibrosis in the two groups (n = 15

field, repeated five times); scale bar = 100^m. (C) Co-staining of PCNA (green), Mef2 (red)

with DAPI (blue) on cryosections of adult zebrafish hearts, indicating no significant

difference in PCNA staining between wild-type and treated group (n = 15 field, repeated five times); scale bar = 10p,m; Arrows: PCNA+/Mef2+/DAPI+. (A) Bars represent mean ±

standard error of the mean, n = number of fish examined.

Wild type

Treated

< Y, — » » • V • ' Y tr. 'V —

• _ • ; • * 1 • « »»V . * , f 'A \ - > « » ■ f. •

Supplementary Figure 2. Co-staining of Calr (green), Mef2 (red) with DAPI (blue) on cryosections of adult zebrafish hearts, indicating increased Calr expression on cardiomyocytes of treated fish compared with the wild-type (n = 15 field, repeated five times); scale bar = 10^m; Arrows: Calr+/Mef2+/DAPI+ (white, green and red plus blue).

Wild type

Treated

» • i i* « » * ■ % * " » • «* * ' w , ■ « i t ' } ' ' > " • '-' V 1 "** * . / * »

Supplementary Figure 3. Co-staining of p53 (green), Mef2 (red) with DAPI (blue) on cryosections of adult zebrafish hearts, indicating increased p53 expression on cardiomyocytes of treated fish compared with the wild-type (n = 15 field, repeated five times); scale bar = 10^m; Arrows: p53+/Mef2+/DAPI+ (white, green and red plus blue).

Supplementary Figure 4. Determination of the optimal conditions for glucose treatment

of cardiomyocytes. (A) Real-time PCR analysis of Nkx2.5, calreticulin, and p53 in

cardiomyocytes (CMs) exposed to glucose for 24 h at different concentrations (5, 10, 20, 30,

40, 50 mM), compared with the wild-type group. (B) Real-time PCR analysis of Nkx2.5,

calreticulin, and p53 in CMs exposed to 20 mM glucose for different times (12, 24, 48 h).

(A-B) Bars represent mean ± standard error of the mean (n = 5-6 fish per group). *p < 0.05

**p < 0.01 as compared with the wild-type group.

Supplementary Videos

Video S1 (wild type). Ventricular morphology of the wild-type zebrafish at week 32, derived

from B-mode echocardiography.

Video S1 (treated). Ventricular morphology of the treated zebrafish at week 32, derived

from B-mode echocardiography.

Video S2 (wild type). Atrioventricular (AV) valve velocity of the wild-type zebrafish at

week 32, derived from Doppler echocardiography.

Video S2 (treated). Atrioventricular (AV) valve velocity of the treated zebrafish at week 32,

derived from Doppler echocardiography.