CC BY
0Research Notes
SHORT REPORT Open Access
Germ-line DICER1 mutations do not make a major contribution to the etiology of familial testicular germ cell tumours
Nelly Sabbaghian1,21, Amin Bahubeshi1,2,8+, Andrew Y Shuen3, Peter A Kanetsky4,6, Marc D Tischkowitz1,2,9, Katherine L Nathanson5,6 and William D Foulkes1,2,3,7*
Abstract
Background: The RNase III enzyme DICER1 plays a central role in maturation of microRNAs. Identification of neoplasia-associated germ-line and somatic mutations in DICER! indicates that mis-expression of miRNAs in cancer may result from defects in their processing. As part of a recent study of DICER1 RNase III domains in 96 testicular germ cell tumors, a single RNase IIIb domain mutation was identified in a seminoma. To further explore the importance of DICER! mutations in the etiology of testicular germ cell tumors (TGCT), we studied germ-line DNA samples from 43 probands diagnosed with familial TGCT.
Findings: We carried out High Resolution Melting Curve Analysis of DICER! exons 2-12, 14-19, 21 and 24-27. All questionable melt curves were subjected to confirmatory Sanger sequencing.
Sanger sequencing was used for exons 13, 20, 22 and 23. Intron-exon boundaries were included in all analyses. We identified 12 previously reported single nucleotide polymorphisms and two novel single nucleotide variants. No likely deleterious variants were identified; notably no mutations that were predicted to truncate the protein were identified.
Conclusions: Taken together with previous studies, the findings reported here suggest a very limited role for either germ-line or somatic DICER! mutations in the etiology of TGCT.
Keywords: microRNA, Germ cell tumors, Dicer, Mutation analysis, High-resolution melt analysis
Introduction
Animals and plants express hundreds of miRNAs, which are predicted to target and regulate at least 60% of protein-coding mRNAs and are integral to almost all known biological processes. DICER1 is highly conserved throughout evolution, and contains several functionally important domains. We and others have identified both germ-line and somatic mutations in DICER1 that are associated with a range of mainly childhood-onset cancers and dysontogenic or hyperplastic conditions, notably "blastoma"-type tumors such as pleuropulmonary blastoma (PPB), ovarian Sertoli- Leydig cell tumor
* Correspondence: william.foulkes@mcgill.ca tEqualcontributors
1Program in Cancer Genetics, Department of Oncology and Human Genetics, McGill University, Montreal, QC, Canada
2Lady Davis Institute and SegalCancer Centre, Jewish General Hospital, McGill University, Montreal, QC, Canada
Fulllist of author information is available at the end of the article
(SLCT), embryonal rhabdomyosarcoma and Wilms tumor, as well as benign tumors such as cystic nephroma [1-10]. Despite a detailed study of hundreds of cancer cell lines [4], the full extent and limit of the involvement of both germ-line and somatic DICER1 mutations in rarer types of human cancer is currently unknown.
A large study of all exons of DICER1, conducted using DNA from 4 microsatellite-stable testicular germ cell tumor (TGCT) cell lines and germ-line DNA from 185 persons with a germ cell tumor (of whom 71 had a seminoma and 128 of whom had a family history of TGCT) revealed one germ-line mutation, c.4740G>T, p.Q1580H, in a man with a past personal history of seminoma [4]. The mutation is of unknown significance, but according to Polyphen2 [11], this mutation is predicted to be probably damaging with a score of 0.996 (sensitivity: 0.55; specificity: 0.98), and in agreement with
© 2013 Sabbaghian et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Central Creative Commons Attribution License (http://creativecommons.Org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
this, SiftBLink [12] indicates that substitution at position 1580 from Q to H is predicted to affect protein function with a score of 0.00 (less than 0.05 is usually regarded as evidence for a deleterious effect on protein function).
Recurrent "hotspot" somatic mutations exist in the RNase Illb domain of DICER1 [10]. These hotspot mutations were mainly identified in SLCT, but of 26 TGCT analysed for the hotspots, a single non-seminomatous TGCT was found to possess c.5125G>A, p.D1709N. It could not be determined if the mutation was germ-line or somatic in nature [10], but this mutation is functionally deleterious [13] and therefore could be etio-logically related to the occurrence of the TGCT. Another study did not identify a DICER1 mutation in a man with a seminoma, who was the relative of a patient with a PPB [5].
Recently, de Boer et al. reported finding only one presumed somatic RNase Illb domain mutation (c.5174G > A; p.R1725Q) among 96 TGCT for mutations in this domain [14]. Bioinformatic analysis of this variant gives varying results; whereas Polyphen2 [11] suggests that this mutation is predicted to be probably damaging with a score of 1.000 (sensitivity: 0.00; specificity: 1.00), SiftBLink [12] reports that substitution at position 1725 from R to Q is predicted to be tolerated with a score of 0.18.
In view of these previous studies, we wished to establish if germ-line DICER1 mutations play a role in the etiology of TGCT, with the clinical aim of better counselling DICER1 mutation carriers as to their cancer risks. We report here our analysis of germ-line DNA from 43 probands with a personal and family history of TGCT.
Methods
Subjects
Men with TGCT were recruited through an on-going case-control study at the Perelman School of Medicine at the University of Pennsylvania, which has been previously described [15,16]. All patients completed a questionnaire, which includes self-reported information about family history of TGCT. For the current study, men with TGCT who reported a family history of at least one relative also with TGCT were selected (Table 1). All studies were carried out in accordance with the Institutional Review Board (IRB) of the University of Pennsylvania with written consent (IRB study number: 703123).
Experimental details
We conducted High Resolution Melting Curve (HRM) analysis of DICER1 [GENBANK NM_177438.2] exons 2-12, 14-19, 21, the 3' half of 23 and 24-27 using lymphocyte DNA from one proband from each family as described previously [3]. Briefly, we screened 22 of the 26 coding exons of DICER1 by (HRM) using the LightScanner instrument (Idaho Technologies Inc., Utah, USA). The PCR reactions were done in 96 well plates from Bio Rad (Ontario, Canada) using the mastermix and the LCGreen Plus from Transition Technologies (Ontario, Canada). The plates were then transferred to the LightScanner instrument and the melted curves were analyzed by the software provided by Idaho Technologies. This technique was used as a presequencing selection for amplicons harboring variants. The PCR primers used are shown in Table 2. All questionable melt curves were subjected to confirmatory
Table 1 Type of testicular germ cell tumor in 39 probands* plus degree of relatedness to familial case(s) of TGCT
Type of testicular germ cell tumor in the proband Degree of relatedness to affected relative
1st 2nd 3rd >3rd Total
Seminoma, NOS 5 3 4 0 12
Embryonalcarcinoma, NOS 1 3 1 1 6
Teratoma, benign 0 0 1 0 1
Teratocarcinoma 1 0 2 2 5
Choriocarcinoma combined with other germ cellelements 0 0 2 0 2
Yolk sac tumor 0 0 1 0 1
Germ celltumor, nonseminomatous 0 0 1 0 1
Mixed germ celltumor (mixed teratoma and seminoma) 1 1 0 0 2
Mixed germ celltumor (mixed embryonaland seminoma) 3 1 2 0 6
Mixed germ celltumor (mixed yolk sac and seminoma) 0 0 0 1 1
NSGCT (mixed yolk sac and teratoma, benign) 0 0 1 0 1
*First degree- parent, sib, child; second degree - aunt, uncle, grandparent, grandchild; third degree - cousin; more than third - second cousin. If more than one relative affected, only the closest degree of relatedness is included. NSGCT - Non-seminoma germ cell tumor; NOS - not otherwise specified.
#Family history could not be confirmed for two cases (seminoma and yolk sac tumor) and pathology could not be fully confirmed on a further two cases. These four cases were excluded from the table.
Table 2 DICER1 oligonucleotide primers used in this study
Exon Forward Reverse Size of fragment Annealing temp. Sanger sequencing Annealing temp. HRM
2 GCAATGAAAGAAACACTGGATG TCAAATCCAATTACCCAGCAG 358 [1] 64
3 TTTTGTAAATTTATTGGAGGACG TCTGCCAGAAGAGATTAAATGAG 429 [1] 64
4 TTTTGGAGGATAACCTTGGAAC AAATCAGACAACCAAGGCTACAG 390 [1] 66
5 TTGTCGTCAAGACATGCTTTC TTTAATATTCATTCATTCATACACTGC 518 [1] 66
6 TAGTGGCATTTCCACCAAAC GAATTCTTACTCTTGCCCATTCC 437 [1] 69
7 TTCTCACTACTGCAGTATTGATACCTT GAGCCGCATTAAGCATATTTTC 303 [1] (7 F modified) 69
8 AAATCCCAGTTAAACCCCAC TCACATCACAACACAGGACG 554 [1] 68
9 TAAATCACCGTCGCCAAATC AAATCACTCTACAGCTACCTCATGG 591 [1] 69
10 CATGTGTGTCAGAAATGACAGTTG TTCCTATGGATACAAAGAATAACAAAG 431 [1] 68
11 AGCAGGTTACTTTGGAGTACTGAAG AACTTTTATTGCTGCACGATACTG 498 [1] 69
12 TCACATTTCAAGTGCTCACC TGAACATGTAGATGACTACAAAAGC 596 [1] 69
13 TTTTACTAGGCAGGACTTTTAAAGATG AAGTGTTCATGGTGCATGATTC 585 [1] NA
14 TTTGCAGTCCAGCTCATATTG AAGCTGTGAATCGGAGAAAG 498 [1] 69
15 TAAGAAGTGTCATGCCTCGG TCTAGTGGAGAAATAGAAGAGGCAC 468 [1] 68
16 GAAAGCATCATTTCTGTTCTGAAG AAGAGAAAAACGACTCTTTAGC 443 16R is new 65
17 TTCAGCATACTGTGTTCTACCTCTT TTTTAGTAGAGACGAGGTTTCACC 484 17 F is new 69
18 TGTAAAGGTGCCATTTAGCTTC TTTGTGTGCAAAGCATCTCC 589 [1] 69
19 ATTGCACTTGAGGGATTCTTACC TTTGTGATATATTAATGGGCCAAG 496 [1] 67
20 TTGGCCCATTAATATATCACA TCTCACTCCAACTGTTATGGCTTA 594 [1] NA
21-1 AATTGCTGTTGCTCTCAGCC GAGTACATTCATCGCTGGGC 508 [1] 68
21-2 ACAAGCAGGAAATACCCGTG ACTGCAAACCACTTTCAGGC 501 [1] 68
22 AAAGCATAGAATATGTGGGAATT AGAAATTTGCCTCCATCAAA 584 [1] NA
23-1 AACCCTTGCTTTTATTGAGTTTC CAGGGCTTCCACACAGTCC 574 [1] NA
23-2 AAACTGTGGTGTTGACACGG TACAAGGCCAACACGATGAG 571 [1] 68
24 TGTGGGGATAGTGTAAATGCTTC TGCCGTCAGAACTCTGAAAC 403 [1] 68
25-26 TGGACTGCCTGTAAAAGTGG TGAACTTTTCCCCTTTGATG 450 [1] 66
27 CCTGTCTGTCGGGGGTATG TCTGCCTTCAATTCATTCCA 448 [1] 69
Key: HRM- High Resolution Melt. Oligonucleotide primers 16R and 17 F are new; they were designed specifically for High Resolution Melt analysis.
NA: Not Applicable - the fragments amplified were not included in the HRM assay, they were sequenced instead. [1] refers to the source of the oligonucleotide primer sequences. bp - base pairs.
Sanger sequencing, which due to the complexity of the HRM results, was used as the sole method of DICER1 analysis for exons 13, 20, 22 and the 5' half of exon 23. Intron-exon boundaries were included in all analyses.
Findings
Among the 43 probands, we identified 14 different single nucleotide variants or polymorphisms, 12 of which have been previously reported, but no likely deleterious variants; notably no mutations that were predicted to truncate the protein were identified (Table 3).
TGCT account for 1 percent of all malignancies in males, but are the most common cancer among young men aged 15-35 years. Most germ cell tumors can be classified as seminomas or non-seminomas, while a
small proportion are of mixed histology. Established risk factors include cryptorochidism, previous diagnosis of TGCT, subfertility and family history of TGCT (reviewed in [17,18]).
Multiple epidemiological studies point toward a strong genetic basis for TGCT susceptibility. A large Swedish study estimates the genetic contribution of TGCT susceptibility to be about 25%, the third highest among cancers. Although familial aggregation of TGCT is rare with only 1.4% of families having two or more first degree relatives with the disease, multiple studies in different populations have shown that sons of an affected father are at 4-6 fold increased risk of developing TGCT while brothers of an affected male are at 8-10 fold increased risk, a familial relative risk that is much higher than
Table 3 DICER1 variants observed in 43 TGCT probands studied 14 samples had no SNPs
Variant Predicted function Number of cases
c.1377-25 T> A Like y non-pathogenic Previously reported 1****
c.1509 + 32A > G, rs144973109 Like y non-pathogenic Previously reported 2
c.1907 + 43C > T, rs11624081 Like y non-pathogenic Previously reported 6*
c.1907 + 105C > T, rs2275182 Like y non-pathogenic Previously reported 2*
c.1935G > A p.P645P, rs61751177 Like y non-pathogenic Previously reported 2§
c.2041-91A > G, rs2297730 Like y non-pathogenic Previously reported 6, 1***, 1§§§
c.2116 + 59insA Like y non-pathogenic Novel 1***
c.2116 + 65A > T, rs187825570 Like y non-pathogenic Previously reported 1**
c.2804 + 62C > T, rs117996122 Like y non-pathogenic Previously reported 1 §§
c.2805-129G > A Like y non-pathogenic Novel 1
c.2997 T > G p. L999L, rs12018992 Like y non-pathogenic Previously reported 1***
c.3093 + 178 T > C, rs17091820 Like y non-pathogenic Previously reported 1***
c.5145C > T p. L1715L, rs139500905 Like y non-pathogenic Previously reported 1
c*88 T> A, rs13078 Like y non-pathogenic Previously reported 15
* one case has s11624081 in addition to this variant, and another has both rs61751177 and s11624081 (i.e. this person carries 3 variants). ** has both rs2297730 and rs13078 in addition to this variant.
*** has rs2297730, rs17091820, rs12018992 and c.2116 + 59insA (i.e. this person carries 4 variants). **** has rs144973109 and rs2297730 in addition to this variant.
§ one case has both rs2275182 and rs11624081 in addition to this variant (i.e. this person carries 3 variants), and one case has rs13078 in addition to this variant. §§ has rs13078 in addition to this variant. §§§ has rs13078 in addition to this variant.
most other cancers. Ethnic variability is also observed with an incidence five times higher in Caucasian males than in African-Americans (as reviewed by Rapley and Nathanson) [19].
A genome-wide linkage search for susceptibility loci initially identified a region on Xp27 as a possible candidate, however this finding was not replicated in an independent data set, the results of which suggested that no single highly penetrant allele is responsible for a substantial proportion of familial TGCT [20]. Candidate-gene analysis of a "gr/gr" deletion on the Y chromosome known to cause infertility, was found to be associated with a 2-3 fold risk of developing TGCT [21], however the deletion was present in only 2% of TGCT patients unselected for family history, explaining just 0.5% of the excess familial risk [22]. Other candidate-gene analyses have suggested associations with genes involved in immune and hormone regulation, however these findings have not been confirmed. Stronger evidence has come from recent genome-wide association studies that have identified six susceptibility loci implicating KITLG, SPRY4, BAK1, TERT, ATF7IP and DMRT1 in disease pathogenesis. Nevertheless, these six loci together with the "gr/gr" deletion account for less than 15% of the excess familial risk, suggesting that many more risk alleles remain unaccounted for (reviewed in [19,22]). A recent study suggested a possible role for de novo germline copy number variants (CNVs); such variants were seen in 7% of 43 TGCT trios, greater than the expected
background rate of CNVs [23]. With these results in mind, whole exome/genome sequencing studies, focusing on large series of familial TGCTs is likely to be the next step in efforts to understand the genetic basis of TGCT.
The findings reported herein, when combined with the previously reported studies discussed above, suggest that neither germ-line nor somatic DICER1 mutations are commonly associated with TGCT. These results strongly suggest that TGCTs do not fall within the spectrum of diseases associated with germ-line DICER1 mutations and thus clinical screening for such cancers is not warranted in DICER1 mutation carriers.
Abbreviations
CNVs: Copy number variants; PPB: Pleuropulmonary blastoma; SLCT: Sertoli-Leydig celltumor; TGCT: Testicular germ celltumor.
Competing interests
The authors declare that they have no competing interests. Authors' contributions
AB and NS did the HRM analysis and sequencing, AYS helped with interpretation of the results and writing of the paper, PAK and KLN ascertained the patients and maintained the database, MDT and WDF oversaw the project. WDF wrote the paper, which was edited by allauthors, who commented on and approved the finalversion. Allauthors read and approved the finalmanuscript.
Acknowledgements
We thank Monique McDermoth and John R. Priest for their assistance. Amin Bahubeshi was in receipt of a Canadian Institutes of Health Research/FRSQ training grant in cancer research FRN53888 of the McGillIntegrated Cancer Research Training Program. MDT was supported by a Fonds de la Recherche
en Santé du Québec (FRSQ) clinician-scientist award. This work was funded by a grant to KLN from the National institutes of Health: R01 CA114478 and by the MontrealJewish GeneralHospitalFoundation (WDF).
Author details
1Program in Cancer Genetics, Department of Oncology and Human Genetics, McGill University, Montreal, QC, Canada. 2Lady Davis Institute and Segal Cancer Centre, Jewish General Hospital, McGill University, Montreal, QC, Canada. 3Department of Human Genetics, McGillUniversity, Montreal, QC, Canada. 4Department of Biostatistics and Epidemiology, Perelman Schoolof Medicine at the University of Pennsylvania, Philadelphia, PA, USA. 5Division of TranslationalMedicine and Human Genetics, Department of Medicine, Perelman Schoolof Medicine at the University of Pennsylvania, Philadelphia, PA, USA. 6Abramson Cancer Center, Perelman Schoolof Medicine at the University of Pennsylvania, Philadelphia, PA, USA. 7Research Institute, McGill University Health Centre, Montreal, QC, Canada. 8Current Addresses: Faculty of Medicine, University of Toronto, Toronto, ON, Canada. 9Department of MedicalGenetics, University of Cambridge, Addenbrooke's Hospital, Level6, Addenbrooke's Treatment Centre Box 134, Cambridge CB2 0QQ, UK.
Received: 29 November 2012 Accepted: 26 March 2013 Published: 1 April 2013
References
1. Hill DA, Ivanovich J, Priest JR, Gurnett CA, Dehner LP, Desruisseau D, et al: DICER1 mutations in familial pleuropulmonary blastoma. Science 2009, 325:965.
2. Bahubeshi A, Bal N, Rio Frio T, Hamel N, Pouchet C, Yilmaz A, et al: Germline DICER1 mutations and familial cystic nephroma. J Med Genet 2010, 47:863-866.
3. Rio Frio T, Bahubeshi A, Kanellopoulou C, Hamel N, Niedziela M, Sabbaghian N, et al: DICER1 mutations in familial multinodular goiter with and without ovarian Sertoli-Leydig cell tumors. JAMA 2011, 305:68-77.
4. Slade I, Bacchelli C, Davies H, Murray A, Abbaszadeh F, Hanks S, et al: DICER1 syndrome: clarifying the diagnosis, clinical features and management implications of a pleiotropic tumour predisposition syndrome. J Med Genet 2011, 48:273-278.
5. Schultz KAP, Pacheco MC, Yang J, Williams GM, Messinger Y, Hill DA, et al: Ovarian sex cord-stromal tumors, pleuropulmonary blastoma and DICER1 mutations: a report from the International Pleuropulmonary Blastoma Registry. Gynecol Oncol 2011, 122:246-250.
6. Foulkes WD, Bahubeshi A, Hamel N, Pasini B, Asioli S, Baynam G, et al: Extending the phenotypes associated with DICER1 mutations. Hum Mutat 2011, 32:1381-1384.
7. Wilid-Runge S, Bahubeshi A, Carret A, Crevier L, Robitaille Y, Kovacs K, et al: New phenotype in the familial DICER1 tumor syndrome: Pituitary blastoma presenting at age 9 months. Endocr Rev 2011, 32:P1 -P777.
8. Doros L, Yang J, Dehner L, Rossi CT, Skiver K, Jarzembowski JA, et al: DICER1 mutations in embryonal rhabdomyosarcomas from children with and without familial PPB-tumor predisposition syndrome. Pediatr Blood Cancer 2012, 59:558-560.
9. Sabbaghian N, Hamel N, Srivastava A, Albrecht S, Priest JR, Foulkes WD: Germline DICER1 mutation and associated loss of heterozygosity in a pineoblastoma. J Med Genet 2012, 49:417-419.
10. Heravi-Moussavi A, Anglesio MS, Cheng S-WG, Senz J, Yang W, Prentice L, et al: Recurrent Somatic DICER1Mutations in Nonepithelial Ovarian Cancers. N Engl J Med 2012, 366:234-242.
11. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, et al: A method and server for predicting damaging missense mutations. Nat Methods 2010, 7:248-249.
12. Kumar P, Henikoff S, Ng PC: Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 2009, 4:1073-1081.
13. Gurtan AM, Lu V, Bhutkar A, Sharp PA: In vivo structure-function analysis of human Dicer reveals directional processing of precursor miRNAs. RNA 2012, 18:1116-1122.
14. de Boer CM, Eini R, Gillis AM, Stoop H, Looijenga LH, White SJ: DICER1 RNase IIIb domain mutations are infrequent in testicular germ cell tumours. BMC Res Notes 2012, 5:569.
15. Kanetsky PA, Mitra N, Vardhanabhuti S, Li M, Vaughn DJ, Letrero R, et al: Common variation in KITLG and at 5q31.3 predisposes to testicular germ cell cancer. Nat Genet 2009, 41:811 -815.
16. Kanetsky PA, Mitra N, Vardhanabhuti S, Vaughn DJ, Li M, Ciosek SL, et al: A second independent locus within DMRT1 is associated with testicular germ cell tumor susceptibility. Hum Mol Genet 2011, 20:3109-3117.
17. McGlynn KA: Environmental and host factors in testicular germ cell tumors. Cancer Invest 2001,19:842-853.
18. McGlynn KA, Cook MB: Etiologic factors in testicular germ-cell tumors. Future Oncol 2009, 5:1389-1402.
19. Rapley EA, Nathanson KL: Predisposition alleles for Testicular Germ Cell Tumour. Curr Opin Genet Dev 2010, 20:225-230.
20. Crockford GP, Linger R, Hockley S, Dudakia D, Johnson L, Huddart R, et al: Genome-wide linkage screen for testicular germ cell tumour susceptibility loci. Hum Mol Genet 2006, 15:443-451.
21. Nathanson KL, Kanetsky PA, Hawes R, Vaughn DJ, Letrero R, Tucker K, et al: The Y deletion gr/gr and susceptibility to testicular germ cell tumor. Am J Hum Genet 2005, 77:1034-1043.
22. Turnbull C, Rahman N: Genome-wide association studies provide new insights into the genetic basis of testicular germ-cell tumour. Int J Androl 2011, 34:e86-e96.
23. Stadler ZK, Esposito D, Shah S, Vijai J, Yamrom B, Levy D, et al: Rare de novo germline copy-number variation in testicular cancer. Am J Hum
Genet 2012, 91:379-383.
doi:10.1186/1756-0500-6-127
Cite this article as: Sabbaghian et al.: Germ-line DICER1 mutations do not make a major contribution to the etiology of familial testicular germ cell tumours. BMC Research Notes 2013 6:127.
Submit your next manuscript to BioMed Central and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at Tpntral
www.biomedcentral.com/submit >_ciiuai
