Scholarly article on topic 'Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata): phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa'

Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata): phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa Academic research paper on "Biological sciences"

CC BY
0
0
Share paper
Academic journal
BMC Genomics
OECD Field of science
Keywords
{""}

Academic research paper on topic "Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata): phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa"

BMC Genomics

BioMed Central

Open Access

Research article

Complete mitochondrial genome of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata): phylogenetic position of Bryozoa and phylogeny of lophophorates within the Lophotrochozoa

Kuem Hee Jang1'2 and Ui Wook Hwang*1'2

Address: department of Biology, Graduate School & Department of Biology, Teachers College, Kyungpook National University, Daegu 702-701, Korea and 2Institute for Phylogenomics and Evolution, Kyungpook National University, Daegu 702-701, Korea

Email: Kuem Hee Jang - gold-light@daum.net; Ui Wook Hwang* - uwhwang@knu.ac.kr * Corresponding author

Published: 21 April 2009 Received: 13 October 2008

Accepted: 21 April 2009 BMC Genomics 2009, 10:167 doi:10.1186/1471-2164-10-167 H H

This article is available from: http://www.biomedcentral.com/1471-2164/10/167

© 2009 Jang and Hwang; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background: The phylogenetic position of Bryozoa is one of the most controversial issues in metazoan phylogeny. In an attempt to address this issue, the first bryozoan mitochondrial genome from Flustrellidra hispida (Gymnolaemata, Ctenostomata) was recently sequenced and characterized. Unfortunately, it has extensive gene translocation and extremely reduced size. In addition, the phylogenies obtained from the result were conflicting, so they failed to assign a reliable phylogenetic position to Bryozoa or to clarify lophophorate phylogeny. Thus, it is necessary to characterize further mitochondrial genomes from slowly-evolving bryozoans to obtain a more credible lophophorate phylogeny.

Results: The complete mitochondrial genome (15,433 bp) of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata), one of the most widely distributed cheliostome bryozoans, is sequenced. This second bryozoan mitochondrial genome contains the set of 37 components generally observed in other metazoans, differing from that of F. hispida (Bryozoa, Gymnolaemata, Ctenostomata), which has only 36 components with loss of tRNAser(ucn) genes. The B. neritina mitochondrial genome possesses 27 multiple noncoding regions. The gene order is more similar to those of the two remaining lophophorate phyla (Brachiopoda and Phoronida) and a chiton Katharina tunicate than to that of F. hispida. Phylogenetic analyses based on the nucleotide sequences or amino acid residues of 12 protein-coding genes showed consistently that, within the Lophotrochozoa, the monophyly of the bryozoan class Gymnolaemata (B. neritina and F. hispida) was strongly supported and the bryozoan clade was grouped with brachiopods. Echiura appeared as a subtaxon of Annelida, and Entoprocta as a sister taxon of Phoronida. The clade of Bryozoa + Brachiopoda was clustered with either the clade of Annelida-Echiura or that of Phoronida + Entoprocta.

Conclusion: This study presents the complete mitochondrial genome of a cheliostome bryozoan, B. neritina. The phylogenetic analyses suggest a close relationship between Bryozoa and Brachiopoda within the Lophotrochozoa. However, the sister group of Bryozoa + Brachiopoda is still ambiguous, although it has some attractions with Annelida-Echiura or Phoronida + Entoprocta. If the latter is a true phylogeny, lophophorate monophyly including Entoprocta is supported. Consequently, the present results imply that Brachiozoa (= Brachiopoda + Phoronida) and the recently-resurrected Bryozoa concept comprising Ectoprocta and Entoprocta may be refuted.

Background

Bryozoans (ectoprocts), also known as "moss animals", are aquatic organisms that mostly live in colonies of interconnected individuals. They usually encrust rocky surfaces, shells or algae. They are an ecologically important group, with the marine species forming a dominant component of benthic subtidal marine communities. This group is also economically important because it is a major component of both marine and freshwater biofouling, and evolutionarily important as a long-living phylum with a good fossil record [1]. The phylum is currently reported to contain 4000 extant species. However, it is likely that more than twice that number are currently in existence [2,3], with new taxa being described annually.

Together with the Brachiopoda and Phoronida, Bryozoa have been classified as "Lophophorata" because they possess a similar suspension feeding apparatus, the lopho-phore, which is a horseshoe-shaped structure that surrounds the mouth and has ciliated tentacles [4-8]. However, lophophorate phylogeny remains one of the most controversial issues in metazoan animal phylogeny because they display an amalgam of deuterostome and protostome features. The "Lophophorata" have been classified as deuterostomes on the basis of morphological and larval features [9-13]. On the other hand, molecular phy-logenetic analyses suggest that the lophophorates have some affinities with mollusks and annelids within the protostomes [14-21].

Lophophorate phylogenies that have been reconstructed with mitochondrial protein-coding genes and nuclear ribosomal DNAs have failed to resolve the detailed relationships among the lophophorates and other related metazoan phyla [15,17,22-24]. Most studies of complete mitochondrial genomes have focused on chordate and arthropod phylogenies because only a few mitochondrial genomes from lophotrochozoan phyla have been determined to date. So far, complete lophotrochozoan mito-chondrial genome sequences have been published for 94 species from 12 phyla, including 45 mollusks, 8 annelids, 3 brachiopods, 1 bryozoan, 1 phoronid (nearly complete), 2 entoprocts, 28 platyheminths, 1 nemertean (nearly complete), 1 rotifer, 2 chaetognaths, 1 acan-thocephalan and 1 echiuran. If the mollusk data are excluded, only 49 mitochondrial genomes have been sequenced from the huge protostome group (the Lopho-trochozoa) so far.

Complete mitochondrial genomes have been characterized from a variety of metazoan phyla so that nucleotide, amino acid and gene order data can be used to resolve their phylogenetic relationships. Mitochondrial genomes are generally conserved in terms of gene components (usually 13 protein-coding genes, 2 ribosomal RNA genes and 22 transfer RNA genes) [25], and a number of studies

have taken advantage of the various levels of phylogenetic information offered by mitochondrial genomes to solve systematic and evolutionary questions over a broad taxo-nomic range [26,27].

Mitochondrial protein-coding genes have recently been used to resolve the phylogenetic relationships of lopho-phorates [28]. The results show that the phylum Brachiop-oda (an articulate brachiopod, Terebratulina retusa) belongs to the lophotrochozoan protostomes and that Brachiopoda have a close relationship with Molluska and Annelida within the monophyletic clade, Lophotrocho-zoa. The second lophophorate phylum, Phoronida (Pho-ronis architecta), has also been placed within the Lophotrochozoa. Phoronis has the almost same gene arrangement as the chiton, Katharina tunicata (Molluska, Polyplacophora) [29]. Phylogenies based on most of the molecular data strongly suggest that two lophophorate phyla, Brachiopoda and Phoronida, are closely related to each other (called Phoronizoa or Brachiozoa), and they appear to be sister groups of mollusks and annelids within the Lophotrochozoa [11,30].

In an attempt to address the phylogenetic position of bryozoans in metazoan phylogeny, the first mitochondrial genome from a ctenostome bryozoan, Flustrellidra hispida (Flustrellidridae), was recently sequenced and characterized. However, F. hispida exhibits a number of peculiar features, such as extensive translocation of gene components including protein-coding and tRNA genes, and extremely reduced size. Phylogenetic trees inferred from the nucleotide and amino acid sequences of its protein-coding genes were mutually conflicting, so the phyloge-netic position of F. hispida was not assigned. Thus, it is necessary to sequence additional mitochondrial genomes from more representative and widely-distributed bryo-zoans in order to address the issue of the phylogenetic position of bryozoans on the basis of mitochondrial genome information.

In this paper, to address whether or not lophophorates are a monophyletic group and to examine the exact phyloge-netic position of Bryozoa, we describe the complete mito-chondrial genome sequence of Bugula neritina (Bryozoa, Gymnolaemata, Cheilostomata), one of the most widely-distributed cheliostome bryozoans. The result is compared with the F. hispida sequence. We also explore the following: the monophyly of the class Gymnolaemata, the phylogenetic implication of the gene orders in lophophorate mitochondrial genomes, the secondary structures of extremely multiplied noncoding regions, etc.

Results and discussion Genome organization

The mitochondrial genome sequence of Bugula neritina is 15,433 bp long and consists of 13 protein-coding genes

(cox1-3, nad1-nad6, nad4L, atp6, atp8 and cob), two rRNA genes for the small and large subunits (rrnS and rrnL), and 22 tRNA genes, as is typical of the animal mitochondrial genomes published so far (Fig. 1). The A+T content of the entire mitochondrial genome of B. neritina is 70.0%. Interestingly, we found 27 multiplied noncoding regions (NC1-27). All the protein-coding and rRNA genes and 17 of the tRNA genes are transcribed in the same strand in B. neritina; the other five tRNAs are [trnL(cun), trnA, trnE, trnYand trnV], (Fig. 1). The first bryozoan mitochondrial genome reported from F. hispida [31] has only 36 gene components because trnS(ucn) is absent, it is relatively short (13,026 bp), and the A+T content is lower (59.4%). In contrast, B. neritina has features that are more typical of metazoan mitochondrial genomes in general in terms of the number of gene components, whole genome size and A+T content.

Extreme multiplication of noncoding region

Strikingly, the B. neritina mitochondrial genome contains 27 multiplied noncoding regions: 16 noncoding regions (NC1-NC16) larger than 10 bp (Table 1 and Fig. 2A) and 11 smaller (Table 1). The total length of the 16 noncoding regions larger than 10 bp is 864 bp. Three of them - NC3 (271 bp) between trnA and trnK, NC4 (246 bp) between trnK and rrnS and NC10 (68 bp) between trnY and cox1 -could be candidate origins of replication. trnK, one of the five tRNA genes transcribed on the light strand, is located between NC3 and NC4. The placement of trnK between these two possible control regions is likely to have occurred very recently and independently only in the specific evolutionary lineage of B. neritina, since it has never been found in any other metazoan. The remaining 13 noncoding regions (NC1-NC2, NC5-NC9, NC11-NC16) total 279 bp in length and are dispersed throughout the whole genome, ranging from 12 to 36 bp in size (Table 1 and Fig. 2A). In addition, 11 small intergenic gaps (< 10 bp) were identified between some gene components (Table 1).

Most metazoan mitochondrial genomes reported so far possess only a single major noncoding region, which is thought to be involved in the regulation of transcription and the control of DNA replication [32,33]. In general, possible control regions possess characteristic features such as high A+T contents, hairpin-loop structures, repeat motifs, etc. [25,34]. In B. neritina, there are three possible control regions (NC3, NC4 and NC10). Their A+T contents are 78.6% in NC3, 78.1% in NC4 and 79.4% in NC10, all of which are much higher than the 70.0% of the mitochondrial genome as a whole. In NC3, NC4 and NC10, we found some hairpin-loop structures that might be related to the mode of regulation of replication and transcription (Fig. 2B). NC3 and NC4 possess no characteristic repeat motifs but have extensive poly "A" and poly

"C" tracts (136 "A" and 12 "C" in NC3 and 122 "A" and 36 "C" in NC4), as often observed in mitochondrial control regions in other metazoans [25,34]. Intriguingly, NC10 (12 A, 15 C, 2 G and 37 T) includes at least nine "CTT" repeats with a short helix consisting of a 5-base-pair stem and a 3-nt loop (Fig. 2B). Despite its short length (68 bp), the existence of "CTT" repeats and a hairpin-loop may suggest that NC10 is important in regulating mito-chondrial replication and transcription. In addition to these, NC1 between trnW and trnL(cun) has a helix with a 5-bp stem [additional file 1].

Such multiple noncoding regions are rare in metazoan mitochondrial genomes. The other bryozoan sequenced, F. hispida, has 17 noncoding regions, ranging in size from 1 to 195 bp (506 bp in total). Among these, two possible control regions were observed between trnC and trnG (195 bp) and between cox2 and trnD (114 bp), which are separated by cox2-trnG [31]. The mollusk Loligo bleekeri (Cephalopoda; [35]) has 19 noncoding regions longer than 10 bp. Three of these 19 are 515 bp, 507 bp and 509 bp long, and their sequences are nearly identical, suggesting that all three originated from a single, large, ancestral noncoding region. In Lampsilis ornata (Bivalvia; [36]), 28 noncoding regions were found, ranging from 2 to 282 bp in size. Of these, only one large noncoding region (136 bp long) has an increased A+T content (76.8%), so it is a possible control region. Since no such extreme multiplication of noncoding regions has been observed in any other bivalve or cephalopod mollusk including Katharina tuni-cata, it is likely that the extreme multiplication of noncod-ing regions is a homoplasious characteristic, occurring independently in the lineages of L. bleekeri, L. ornata and B. neritina.

Comparative analysis of gene arrangements

Unlike other metazoan mitochondrial genomes in which genes are encoded on both strands, all the protein-coding and rRNA genes and 17 of the tRNA genes - the exceptions being the five tRNA genes trnL(cun), trnA, trnE, trnY and trnV - are transcribed from the same strand in B. neritina (Fig. 1 and Table 1). In F. hispida, one protein-coding gene (cox2), one ribosomal RNA gene (rrnL) and four tRNA genes (trnG, trnC, trnL(uur), trnV and trnV) are reversed. Such a single-strand-dependent transcription tendency has been reported for 137 among the 1428 metazoan species in 23 phyla for which complete or nearly complete mitochondrial genome sequences have been determined to date (Dec. 17, 2008). Except for six tunicates (Deuterostomia, Urochordata), all the remaining 131 cases were from protostomes or primitive meta-zoan groups: 83 protostomes including 62 lophotrochozoans and 17 nematodes, and 48 primitive metazoans including 29 cnidarians and 19 poriferans, the most primitive metazoan groups (Table 2). The single-

Figure!

A circular map of the complete mitochondrial genome of a bryozoan Bugula neritina (GenBank accession number AY690838). Protein and rRNA genes are abbreviated as follows: atp6 and atp8 (genes for ATPase subunits 6 and 8), coxl-cox3 (genes for cytochrome C oxidase subunits I-III), cob (gene for apocytochrome b), nadl-nad6 and nad4L (genes for NADH dehydrogenase subunits 1-6 and 4L), and rrnS and rrnL (genes for I2S and I6S rRNAs). All 22 tRNA genes are located among protein- and/ or tRNA-coding genes. The tRNA genes are named using single-letter amino acid abbreviations, with the exception of those coding for leucine and serine, which are named Ll for the tRNALeu(CUN) (anticodon TAG) gene, L2 for the tRNA-Leu(UUR) (anticodon TAA) gene, Sl for the tRNASer(AGN) (anticodon GCT) gene and S2 for the tRNASer(UCN) (anticodon TGA) gene. The arrows indicate the orientations of the gene components. The three slashed regions corresponding to NC3, NC4 and NCI0 may be related to the mode of regulation of mitochondrial replication and transcription.

strand dependence of transcription might be a plesiomor-phic, ancestral characteristic because such a tendency appears in 48 out of 59 primitive metazoans (81.4%) such as Cnidaria and Porifera (Table 2).

The arrangements of the protein-coding and rRNA genes were compared among two bryozoans (B. neritina and F. hispidia), a brachiopod (T. retusa), a phoronid (P. archi-tecta) and a polyplachophoran (K. tunicata) (Fig. 3). The overall gene arrangement in B. neritina was quite different from those in other metazoans published so far. Compared to the F. hispida sequence, B. neritina needed 6 local translocations and 1 inversion to have the same gene

order. On the other hand, only 5 translocations from a brachiopod, T. retusa, and 6 translocations with 1 inversion from a phoronid, P. architecta, would produce the gene arrangement of B. neritina; therefore, the gene arrangement in T. retusa is most similar to that of B. neritina. The B. neritina gene arrangement could be obtained from that of T. retusa by only five translocation events (rrnS/rrnL, nad3/nad2, cox2, nad1 and nad6) with no inversions. The phoronid gene arrangement was identical to that of Katharina with only one exception, a difference in the position of atp6.

Nucleotide composition and codon usage

As shown in Table 3, the overall A+T content of the B. neritina mitochondrial genome is 70.0% (+ strand: A = 37.7%; C = 17.6%; G = 12.4%; T = 32.3%), which is typical of the base compositions of metazoan mitochondrial genomes. However, it is unusual in comparison to those of other bryozoans and brachiopods; it is much higher than those of F. hispida (59.4%) and of three brachiopods, T. retusa (57.2%), T. transversa (59.1%) and L. rubellus (58.3%).

Table 3 shows the AT- and CG-skews of each of the 13 protein-coding and 2 ribosomal RNA genes and of the whole genome (total) in B. neritina mitochondria. The results show no marked bias in nucleotide composition. The AT-skew is positive for 11 genes and negative for five on the (+) strand. The CG-skew for all 15 genes on the (+) strand is positive. This means that the B. neritina mitochondrial genome has no biased nucleotide composition. As shown in [additional files 2 and 3], the other bryozoan, F. hispida, has no biased nucleotide composition either. In contrast, the AT-skews of 12 genes in T. transversa and L. rubellus and the CG-skews of nine genes in all three brachiopods seem clearly biased.

The codon usage pattern of the B. neritina mitochondrial protein-coding genes is shown in Table 4. There is a clear preference for A+T-rich codons; the five most frequently used codons are UUA (300 times) for leucine, AUA (281) for methionine, AUU (237) for isoleucine, UUU (178) for phenylalanine and AAA (144) for lysine. Compared to other lophotrochozoans, the B. neritina mitochondrial genome showed a strong bias to A+T codons with dramatically lower G+C content. The anticodon nucleotides in B. neritina were completely identical to those of the brachiopod Laqueus rubellus [37] and the annelid Lumbricus terres-tris [38] except for trnL(cun) and trnY. However, two anticodons - UUU in trnK and UCU in trnS(agn) - in B. neritina were different from those used in most other metazoans. The tRNA anticodon corresponding to the codon AGN for serine is UCU, as in nematode mitochon-drial genomes, but in most other metazoan mitochon-drial genomes such as those of platyhelminthes,

e\ L2 I S2

NC11 NC13 NC14

/ t v/ F /

G p NC5

NC15 NC16

NC7 NC8

T T T T A G A A T - A T - A T - A

A T T A A - T A - T T - A T - A T - A

G A T - A A - T T - A A - T T - A T - A

T A A A CC A - T A - T

T A A - T T - A T - A T - A A - T C - G

A - T A - T T - A T - A T - A A - T T - A A - T T - A A A T - A T - A T - A A A T - A T - A

TC C - G G - C

tfflA — ATTTAC-G(13 bp) T - A(16 bp) T-ACAAC-G(51 bp) A - T (27 bp) A - T (23 bp) tfflK

T - A A A A C t C

C T tAgca

A - T agaac

A - TA A A G T T

A - TA T 17 bp T 1 A T

C T - A CA CT

T A T - A T - A

T A T A G - C G - C

A T - A T A A - T

T C T - A C G A - T

T - A T - A G T C - G

A- T T A T - A T - A

(23 bp) C- G (79 bp) A - T (19 bp) T - A AAAT - AAA —

TT A - T T - A A - T

T - A _^ ¿________

trnY— AA — TACCCCCCTTTTCTCCCTTCTTCTTCTTCTT(17 bp) C T T T T T T coxl

Figure2

Multiple noncoding regions of the mitochondrial genome of a bryozoan, Bugula neritina, putative secondary structures of NC3, NC4 and NCI0, and "CTT" repeat motif observed in NCI0. A) Fifteen (NCI-NC16) larger than 10 bp of the 27 multiple noncoding regions of the Bugula neritina mitochondrial genome (black boxes). The circular genome is linearized. Genes encoded on the opposite strand are shown in gray boxes. NC3, NC4 and NCI0 may be related to the mode of regulation of mitochondrial replication and transcription. B) Plausible helix structures predicted from NC3, NC4 and NC 10, and 9 "CTT" repeats observed in NCI0. The secondary structures and repeats may play important roles in the regulation of mitochondrial replication and transcription. Arabic numbers inside the encircled loop regions of each helix and in parentheses between helices indicate the number of nucleotides in each region.

mollusks, Drosophila and echinoderms, the serine tRNA anticodon is GCU rather than UCU [25,38].

Transfer RNA genes

The B. neritina mitochondrial genome contains 22 typical tRNA genes interspersed between the 2 rRNA and 13 protein-coding genes. This result differs from that of F. his-pidia, which has only 21 tRNA genes because of the two serine tRNA genes, trnS(agn) and trnS(ucn), trnS(ucn) is absent [31]. If we obtain more bryozoan mitochondrial genome data, it might be possible to provide reasonable evolutionary interpretations through further comparative

analyses with respect to the absence/presence of trnS(ucn). Thirteen of the 22 inferred B. neritina mitochondrial tRNAs have uniform features that are invariant in typical cloverleaf-shaped secondary structures with a 7-bp amino-acyl arm, 5-bp anticodon stem and 4-bp variable loop (Fig. 4). Two tRNAs [tRNACys, and tRNATyr] have no DHU arm or T^C arm. The T^C arm and variable loop are replaced by a single TV loop. In four tRNAs [tRNAGln, tRNALeu(uur), tRNASer(agn) and tRNASer(ucn)], the DHU arms are replaced by a loop. The unpaired DHU arm in tRNASer(agn) has been considered a typical feature of animal mitochondrial genomes [25]. tRNASer(ucn) with an

Table !: The mitochondrial genome profile of Bugula neritina

Positions Codons

Features From To Strands Sizes Start Stop Intergenic nucleotides-1

cox3 1 822 + 822 ATG TAA 8

trnW 831 897 + 67 34

trnLI 932 985 - 54 18

trnA 1004 1065 - 62 0

NC3 1066 1336 271 0

trnK 1337 1405 + 69 0

NC4 1406 1651 246 0

rrnS 1652 2491 840 0

trnN 2492 2555 + 64 0

rrnL 2556 3882 1327 0

trnG 3883 3947 + 65 17

trnE 3965 4025 - 61 28

trnP 4054 4121 + 68 17

trnL2 4139 4199 + 61 36

trnM 4236 4298 + 63 2

trnI 4301 4367 + 67 25

trnD 4393 4459 + 67 4

trnSI 4464 4523 + 60 0

nad6 4524 4993 + 470 ATG TA* 0

trnY 4994 5038 - 45 0

NCI0 5039 5106 68 0

coxI 5107 6642 + 1536 ATA TAA 12

atp8 6655 6780 + 126 ATG TAA 8

trnT 6789 6854 + 66 21

trnR 6876 6941 + 66 2

trnV 6944 6996 - 53 15

trnQ 7012 7072 + 61 1

atp6 7074 7763 + 690 ATG TAA 5

trnF 7769 7834 + 66 0

nad3 7835 8188 + 354 ATG TAA 17

nad2 8206 9141 + 936 ATG TAA 2

cox2 9144 9815 + 672 ATG TAA 1

trnC 9817 9878 + 62 13

trnS2 9892 9950 + 59 0

cob 9951 11057 + 1107 ATG TAA 26

nad4L 11084 1 1389 + 306 ATT TAA -13

Nad4 11377 12733 + 1357 ATT T* 0

trnH 12734 12797 + 64 3

nad5 12801 14495 + 1695 ATG TAA 2

nadI 14498 15433 + 936 ATG TAA 0

a: Gap nucleotides (positive value) or overlapped nucleotides (negative value) between adjacent genes. *: Incomplete termination codon, which is probably extended by post-transcriptional adenylation.

unpaired DHU arm has also been reported for some pro-tostomes: 2 nematodes (Caenorhabditis elegans and Ascaris suum [39]), 3 mollusks (1 chiton K. tunicata [40], 2 pulmonates Cepaea nemoralis and Euhadra herklotsi [41]), 2 brachiopods (T. transversa and L. rubellus [37,42]) and 1 annelid (Lumbricus terrestris [38]). We also found loss of the DHU arm from tRNACys in the brachiopod L. rubellus, as in B. neritina.

Regardless of formation of a stable DHU arm, the first of 2 nts separating the amino-acyl stem from the DHU arm

region is "T" in 14 tRNAs and the second is "A" in 19 tRNAs, and 1 nt separating the DHU arm region from the anticodon stem is "A" in 13 tRNAs. The 2 bp preceding the anticodon are always pyrimidines, with two exceptions -'GU' in tRNALeu(cun) and 'AA' in tRNA1^ - and the 1 nt nearest the anticodon is "T" in 21 cases, the exception being 'A' in tRNATyr. The nt immediately after the anticodon is always a purine ["A" in 20 tRNAs] with two exceptions - tRNAGlu and tRNATyr have "U" in the same position. Among the 18 tRNAs that form a stable T^C arm, 4-nt variable arms typical of metazoan mitochon-

Table 2: List of metazoan mitochondrial genomes showing single-strand dependent transcription tendency for protein-coding and ribosomal RNA genes

Classifications Complete mitochondrial genomes') Single-strand dependency2) Species names

Primitive metazoans

Cnidaria 34 29 Metridium senile etc.

Porifera 2' '9 Tethya actinia etc.

Others 4 0

Deuterostomia

Urochordata 6 6 Ciona intestinalis etc.

Others '03' 0

Protostomia

Lophotrochozoa

Bryozoa 2 1 Bugula neritina Flustrellidra hispidia

Brachiopoda 3 3 Terebratulina retusa Laqueus rubellus Terebratalia transversa

Phoronida 1 0 Phoronis psamophila

Entoprocta 2 0

Annelida 8 8 Platynereis dumerilii etc.

Molluska 45 '8 Mytilus edulis etc.

Platyhelminthes 28 28 Schistosoma japonicum etc.

Echiura ' ' Urechis caupo

Chaetognatha 2 0

Nemertea ' ' Cephalothrix rufifrons

Acanthocephala ' ' Leptorhychoides thecatus

Rotifera ' ' Brachionus plicatilis

Ecdysozoa

Nematoda 27 '7 Caenorhabditis elegans etc

Arthropoda 207 4 Tigriopus califormicus etc.

Others 3 0

Total 1428 137

') The number of mitochondrial genomes completely sequenced to date

2) The number of mitochondrial genomes showing single-strand dependent transcription tendency

drial tRNAs were observed in 15 tRNAs, 5-nt variable arms in 2 tRNAs, tRNAAsP and tRNASer(agn), and 6-nt variable arms in tRNAGlu. The inferred anticodons for 20 tRNAs in B. neritina were the same as those in the other bryozoan, F. hispida (Fig. 4), but anomalies were detected in two tRNAs: tRNATyr with AUA instead of GUA, and tRNA-Leu(cun) with GAG instead of UAG. The former has been reported for a few metazoans such as the predatory mite Metaseiulus occidentalis [43] and a onychophoran, Epiperi-patus biolleyi [44], but the latter has never previously been reported for any metazoan. The tRNALeu(cun) with GAG may be considered an interesting feature unique to B. neritina. However, further experimental studies are needed to determine whether if it is a truly unique characteristic of B. neritina, or whether it results from a simple error in deducing the anticodon of tRNALeu(cun) from the nucleotide sequence of trnL(cun).

Ribosomal RNA genes

The two rRNA genes are generally separated by at least one gene (trnV in most of cases). In B. neritina, rrnS and rrnL

are separated by trnN instead of trnV; trnV is located between trnR and trnQ. Assuming that the rRNA genes occupy all the available space between the adjacent genes, rrnS and rrnL are approximately 840 bp and 1,327 bp in length, respectively. The A+T contents of rrnS (69.1%) and rrnL (69.2%) are similar to the 70.0% of the whole mitochondrial genome. The total size (2,176 bp) of the B. neritina mitochondrial rRNAs was greater than those of the bryozoan F. hispida (1323 bp), 3 brachiopods (T. transversa, 1876 bp; L. rubellus, 1910 bp; T. retusa, 2057 bp), 2 annelids (P. dumerilii, 1962 bp; L. terrestris, 2030 bp) and a polyplacophoran mollusk K. tunicata (2101 bp), but less than those of a bivalve, Mytilis edulis (2189 bp), and a cephalopod, L. bleekeri (2312 bp).

Phylogenetic position of bryozoans and lophophorate phylogeny

As shown in Fig. 5 and [additional files 4, 5, 6], the first step of phylogenetic analysis (ML and BI) was performed on the basis of the nucleotide and amino acid sequences of 12 protein-coding genes in 42 metazoa (Table 5), in

Bryozoa (Flustrellidra hispida)

coxl 8 m c nad2 cob cox3 nad5

nadl -rrnL -cox2 nad4 rrnS 4L

Bryozoa (Bugula neritina)

atp6 nj C nad2 cox2

cob 4L

nadl cox3

rrnS rrnL

Brachiopoda (Terebratulina retusa)

rrnS rrnL nadl cob

4L nad4

Phoronida (Phoronis architecta)

■ -nad5 -nad4 -4L

-cob <% nj e -nadl

-rrnL -rrnS cox3

atp6 nad2

Molluska (Katharina tunicata)

cox2 8 atp6

Figure3

Comparison of arrangement of the mitochondrial protein-coding and ribosomal RNA genes for 2 bryozoans, 1 brachiopod, 1 phoronid and 1 polyplacophoran. Protein-coding and ribosomal RNA genes are designated by their abbreviations as shown in Fig. 1. Each gene map commences from cox3 and is oriented so that the gene is transcribed from left to right. The rearrangements that are needed to inter-convert the pair of maps are shown, disregarding tRNA genes in which shared gene arrangements are indicated. A circular arrow indicates inversion of a single gene or a block consisting of more than two genes. Dramatic differences were found in tRNA gene positions, but they are not depicted because they are highly complex.

cox2 8

order to explore the phylogenetic position of bryozoans and lophophorate phylogeny within the Lophotrocho-zoa. All four trees showed that the two bryozoans (B. neritina and F. hispida) formed a strong monophyletic group (BP 100% in MLaa (Fig. 5) and MLnt [additional file 4], and BPP 1.0 in BIaa [additional file 5] and BInt [additional file 6]). No tree supported lophophorate monophyly, except for the MLaa tree in Fig. 5, in which lophophorates including Entoprocta are grouped together with a weak node confidence value (BP 40%). The sister group of the bryo-zoan clade appeared to be brachiopods (BP 88 in MLaa, BP 48 in MLnt and BPP 0.86 in BInt), except that the BIaa tree clustered Bryozoa with Phoronida [additional file 5]. As shown in Fig. 5 and [additional files 4, 5, 6], owing to possibly long-branch attraction artifacts (in particular, Nem-atoda and Platyhelminthes), all resultant ML and BI trees regardless of the data types employed showed unexpected groupings with extremely low node confidence values. In addition, phylogenetic trees inferred from nucleotide sequence data [additional files 4 and 6] had relatively lower node confidence values especially in deep branches. Amino acid-based trees (Fig. 5 and [additional file 5]) showed relatively higher node confidences in deep

branches than the nucleotide-based trees [additional files 4 and 6].

To resolve the problem of long-branch attraction, 2 nematodes and 3 platyhelminths were excluded from the first data set for the second-round phylogenetic analyses. The ML and BI trees newly obtained with the reduced data set, including 37 taxa comprising 35 protostomes (20 lopho-trochzoans and 10 ecdysozoans), 5 deuterostomes and 2 primitive metazoans (outgroup taxa) were improved, robust and reliable with higher nodal support values. Within the Lophotrochozoa, all four trees (Fig. 6) showed that the monophylies of the two bryozoans (B. neritina and F. hispida) and the three brachiopods (T. transversa, L. rubellus, T. retusa) were strongly supported with strong nodal supports (BP 100% in MLaa and MLnt and BPP 1.0 in BIaa and BInt). In all four trees shown in Fig. 6, the strong monophyletic bryozoan clade, within the Lopho-trochozoa, was grouped with a monophyletic brachiopod clade (BP 88% and 59% in MLaa and MLnt and BPP 1.0 and 0.98 in BIaa and BInt, respectively). The clade of Bryozoa + Brachiopoda was grouped with the clade of Annelida including Echiura as a subtaxon (BP 90% and 49% in

Table 3: Nucleotide compositions and AT- and CG-skews of the mitochondrial protein-coding and ribosomal RNA genes and the entire Bugula neritina genome

Proportion of nucleotides

Gene A C G T AT% AT skew CG skew

atpó (+) G.3I ó G.I9G G.I42

atpS (+) G.3óS G.I7S G.GSó

coxI (+) G.297 G.IS2 G.I74

cox2 (+) G.3óG G.I92 G.ISG

cox3 (+) G.349 G.I9G G.IS3

cob (+) G.343 G.IS9 G.I27

nadI (+) G.3ó4 G.2G3 G.I24

nad2 (+) G.372 G.IS3 G.IG3

nad3 (+) G.322 G.Ió9 G.I3ó

nad4 (+) G.3S4 G.I7S G.IGS

nad4L (+) G.3Só G.I4I G.G9S

nadS (+) G.39S G.I9G G.IGó

nadó (+) G.349 G.IóG G.IG2

rrnL(+) G.433 G.I4S G.I3ó

rrnS (+) G.42G G.Ió4 G.I4S

Entire genome G.377 G.I7ó G.I24

G.4GS 77.G -G.GS2 G.SI3

G.34S ó4.S -G.G79 G.G2G

G.29S óS.S G.G94 G.I23

G.3GS óS.7 G.Gó2 G.IGS

G.34I óS.4 G.GG3 G.I9ó

G.3G9 ó7.3 G.GS2 G.242

G.343 7I.S G.G4I G.277

G.373 ó9.S -G.G73 G.IGS

G.329 7I.3 G.G77 G.247

G.37ó 7ó.2 G.GI3 G.I7ó

G.3IG 7G.S G.I2I G.2SI

G.3S9 73.S -G.GS4 G.22I

G.2S7 72.G G.2G3 G.G29

G.27I ó9.I G.2Ió G.GóI

G.323 7G.G G.G7S G.I73

AT skew = (A%-T%)/(A%+T%); CG skew = (C%-G%)/(C%+G%)

MLaa and MLnt and BPP 0.99 and 0.98 in Blaa and BInt, respectively). P. psamophila (Phoronida) was clustered with Entoprocta in MLaa (BP 77%) and BIaa(BPP 0.90), which is consistent with the result of Yokobori et al. [45] based on mitochondrial protein-coding genes. In contrast, P. psamophila was grouped with a chiton, K. tunicate, in MLaa (BP 51%) and Blaa (BPP 0.97). This indicates that the phylogenetic positions of Phoronida,

Entoprocta and K. tunicata are still ambiguous. No tree in Fig. 6 supports lophophorate monophyly.

The results of the present phylogenetic analyses revealed that lophophorates are placed with mollusks and annelids as members of a monophyletic lophotrochozoan group. This is consistent with evidence from 18S rRNA [15,17,46], Hox genes [20], Na/K ATPase a-subunit [47]

Table 4: Codon usage pattern of 13 mitochondrial protein-coding genes in Bugula neritina

Amino acid Codon Na Amino acid Codon Na Amino acid Codon Na Amino acid Codon Na

Phe UUU I7S Ser UCU ó9 Tyr UAU SS Cys UGU I7

(GAA) UUC óó (UGA) UCC 4G (AUA) UAC ó3 (GCA) UGC I4

Leu UUA 3GG UCA 77 Ter UAA II Trp UGA 72

(UAA) UUG 3ó UCG ó UAG G (UCA) UGG Ió

Leu CUU Só Pro CCU óG His CAU 32 Arg CGU ó

(AAG) CUC 22 (UGG) CCC 33 (GUG) CAC 34 (UCG) CGC S

CUA II3 CCA 4G Gln CAA 72 CGA 29

CUG I7 CCG IG (UUG) CAG ó CGG S

Ile AUU 237 Thr ACU 7ó Asn AAU SG Ser AGU 7

(GAU) AUC IG9 (UGU) ACC 79 (GUU) AAC IGI (UCU) AGC IS

Met AUA 2SI ACA II2 Lys AAA I44 AGA II9

(CAU) AUG 39 ACG S (UUU) AAG I2 AGG 2I

Val GUU 32 Ala GCU 73 Asp GAU 2S Gly GGU 27

(UAC) GUC IS (UGC) GCC 33 (GUC) GAC 3G (UCC) GGC I9

GUA S7 GCA S9 Glu GAA 72 GGA 9I

GUG 2I GCG 3 (UUC) GAG S GGG 34

aThe number of codons used in 13 mitochondrial protein-coding genes

Alanine (A) i

Arginine (R) G

Asparagine (N) S

Aspartic Acid (D) '

U CUAU"A

u A I I I I A

A U UU C GAUAAG

U CAAU U

A CAUA GUU U C A

A III I A C

. GUAU G

A A A A AA

G - C u U A

U CGCAU A

. A I I I I C

AAAUUA GCGUU A

A I I I I U U U A

A UAAU U

A U GU

UA UA U G C

UA UA U C G

CA UA GUU

UA UA G U C

AA A A CCG

A AAG U

AcGGUA AUU

Cysteine (C)g - c Glutamine (Q) U - A Glutamic Acid (E)a - u Glycine (G) c - g Histidine (H)g - c

U — A U — A U — A C — G A - A

a AA c A - U ,, a _ ii caa G — C u U - A u A — U u A

CA C A A AU A a AA CCCU C U U AU U U GAUUU U U CUUA A

U A uU I III A U g U - U A A U A 1 1 1 1 a A A iii ^

U C U GGGA a A GUA ugg A AUA CUAAcA AAUUUG GAA a a

G A A AG G G A C U G A AU GA G A U A C G U A A

A U A U AU A A UAU A A AAAAC A

aaccaaa^aaaaaga AA^AUU AA a^aaaag CAU a^aaa A a^aaa

U — A A - U C — G U — A U — A

A - U A - U CU U — A U — A

G - C A - U U • G A - U A — A

U A C A C C C A U A

U A U A U U U A U A

G C A UUG UUC UCC GUG

Isoleucine (I)G

C — G C — G

Leucine (L1: CUN)A

Leucine (L2: UUR)'

G - C A A C

AU GU A A

a" aacaucaca

GG U A

Lysine (K)

G - C A

U CU C U

AAUUCG GUG

A AAAGU

AA UA CAA

G - C CC UA GAA

GA UA GAG

UA UA U A A

CA UA U U A

U ACACU

A „ A

A GUGA G

AGUGAA AAG

Methionine (M)a

Phenylalanine (F)u

Proline (P)g

Serine (S1: AGN)'

Serine (S2: UCN)c:

G - C c U CC CU

AA A C

A UCGA GGAA

UU C AAGCU A

U A G AA

UG CCCAA U

AUA A A

A UCCG GGUAA

A III - A

A AAGGU A

UA U AG

C — G C — G UA UA GAA

C AAAC A

A U UC

C — G

UA UA UGG

A U C U A

U A GUUAU C

A A U CCCCC A a

G - C CA UA U C A

C — G

UC UA U G A

A - U A A

U GCU C U

A UUUG CGAGA

A I I I I ,, A C A

GGGGG U A

G U A A

Threonine (T) a

Tryptophan (W) g

Tyrosine (Y) G I

Valine (V)g

GUAU A

CAU G A

UUCU U U

U AAACU

C — G

UA UA U G A

C — G

C — G CA UA U C G

AA G A

AA AU AUG

G - C G - C UG UA U A C

Figure4

Putative secondary structures of the 22 tRNAs identified in the mitochondrial genome of Bugula neritina. Bars indicate Watson-Click base pairings, and dots between G and U pairs mark canonical base pairings appearing in RNA.

C U U G A A AG A U U A

A AAGC A

and molecular data [14-18,29]. Therefore, it strongly suggests that the long-held view inferred from morphological data [10] that deuterostomes have affinity with Bryozoa and the other two lophophorates should be refuted. Recent reports on lophophorate phylogeny based on SSU rRNA gene sequences [24,48] coincide with the present result in that lophophorates are unambiguously affiliated with protostomes rather than deuterostomes.

Contrary to the present findings, which cluster Bryozoa with Brachiopoda, some previous SSU rRNA-based results have shown that brachiopods and phoronids (called the subphylum 'Phoroniformea', 'Brachiozoa' or 'Porono-zoa') form a separate clade from the bryozoans and even suggest that phoronids may be members of the inarticulate brachiopods [11,15,17,19,21,23,30,48,49]. However, the present trees did not show the Brachiozoa grouping at all.

To clarify the statistical support for each grouping such as the monophylies of Brachiozoa, Lophophorata, the old-concept Bryozoa (comprising Entoprocta and Ectoprocta) [50,51] and the sister group Bryozoa + Brachiopoda, we performed tree topology tests (Table 6). The results indicate that on the basis of statistical probability, the sister group of Bryozoa + Brachiopoda could be the Annelida-Echiura or the Phoronida + Entoprocta clade. If the latter is a true phylogeny, lophophorate monophyly including Entoprocta may be supported. The tree topology test is likely to indicate that Brachiozoa (= Brachiopoda + Pho-ronida) and the recently reinstated old-concept Bryozoa may be refuted, but according to the present data the sister group of Bryozoa is Brachiopoda (Table 6).

Despite intensive phylogenetic analyses, phylogenetic relationships among lophotrochozoan members including lophophorates and others unfortunately remain unclear because there are conflicts among the phyloge-netic trees reconstructed by different tree-making methods, with different data types and with different taxon samplings (Figs. 5 and 6 and [additional files 4, 5, 6]). The phylogeny signal of mitochondrial genome nucleotides and/or amino acids alone may be unable to resolve what may have been a relatively rapid radiation during the Cambrian [52,53]. Recently, to overcome such limitations, huge EST data sets from a number of metazoans have been employed to resolve metazoan phylogeny [49]. The results still left the phylogenetic position of bryo-zoans unclear, and lophophorates did not form a mono-phyletic group. Further more intensive studies seem to be necessary to resolve the exact phylogenetic position of the bryozoans and to examine the question of lophophorate monophyly.

Conclusion

This study presents the complete mitochondrial genome of a cheliostome bryozoan, B. neritina. Comparison of the orders of the protein-coding genes showed the possibility that three lophophorates are closely related, including K. tunicata. The present phylogenetic analyses suggest the probable relationships ((Bryozoa, Brachiopoda), Annel-ida-Echiura), or ((Bryozoa, Brachiopoda), (Phoronida, Entoprocta)), but the phylogenetic position of phoronids is still ambiguous. Consequently, the results seem to imply that the three lophophorate members did not form a monophyletic group in the phylogenetic trees and this possibility was also refuted statistically. However, according to the tree topology test, lophophorate monophyly including Entoprocta - ((Bryozoa, Brachiopoda), (Phoronida, Entoprocta)) - was not refuted. In addition, Brachiozoa (= Brachiopoda + Phoronida) and the recently-reinstated old-concept Bryozoa may be refuted, but according to the present data the sister group of Bryozoa is Brachiopoda (Table 6). However, because only a few samples of lophophorates were used here and there were some conflicts among the resultant trees, it is better to postpone a final decision on the phylogenetic position of bryozoans and on lophophorate phylogeny. Until more mitochondrial genomes become available and until we know more about the evolution of these organelle genomes, we may not come to any conclusion with respect to the monophyly or polyphyly of the lopho-phorates.

Methods

Specimen collection and DNA extraction

Bugula neritina (Bryozoa) was collected at Cheonsuman, Taean Gun, Chungnam Province, Korea. Total genomic DNA was extracted using a DNeasy tissue kit (QIAGEN Co., Hilden, Germany) following the manufacturer's protocol.

PCR amplification and cloning

The entire Bugula mitochondrial genome was amplified by two kinds of overlapping polymerase chain reactions (PCR). The PCR strategy was as follows: the ca. 2.5 kb fragment from cox1 to rrnL was amplified with previously reported universal primers, 16SA (5'-CGC CTG TTT ATC AAA AAC AT-3'; [54]) and HCO2198 (5'-TAA ACT TCA GGG TGA CCA AA AAA -3'; [55]). From the newly-sequenced ca. 2.5-kb sequences, the following two Bugula-specific primers were designed to amplify the remaining part (ca. 13.5 kb) of the mitochondrial genome: bnCOI (5'-AGC CAT TTT CTC TTT ACA CCT TGC-3') and bn16S (5'-TCA CTA CAA ACT CTA CAG GGT CTT-3').

The 2.5-kb PCR product was directly ligated to the pGEM T-easy vector (Promega), and the 13.5-kb PCR product

-Bugula neritina

- Flustrellidra hispida — Laqueus rubellus

-Terebratalia transversa

Terebratulina retusa Loxocorone allax

Loxosomella aloxiata Phoronis psammophila

100 Loligo bleekeri 100 Octopus vulgaris

- Nautilus macromphalus Katharina tunicata Urechis caupo Clymenella torquata Lumbricus terrestris Platynereis dumerilii

Caenorhabditis elegans

Trichinella spiralis

92 100

Aplysia californica Pupa strigosa Biomphalaria glabrata Graptacme eborea

Atelura formicaria Tribolium castaneum Penaeus monodon Triops cancriformis Antrokoreana graciliipes Lithobius forficatus Limulus polyphemus

Heptathela hangzhouensis Priapulus caudatus — Epiperipatus biolleyi Arbacia lixula Florometra serratissima Balanoglossus carnosus Homo sapiens Xenopus laevis Acropora tenuis - Metridium senile

100 99

100 100

00 A F

Bryozoa Brachiopoda

| Entoprocta | Phoronida

ICephalopoda(M)

| Polyplacophora(M) o

| Echiura

Annelida

o o h o

N O SS

Echinococcus granulosus

-Schistosoma japonicum

Microcotyle sebastis

| Platyhelminthes

^ Nematoda

J Gastropoda(M) | Scaphopoda(M)

Arthropoda

| Priapulida | Onychophora

J Echinodermata

| Hemichordata

| Chordata

I Diploblasts

N O SS

Figure5

Maximum likelihood tree inferred from amino acid sequences of 12 protein-coding genes of 42 metazoan mitochondrial genomes, showing weak support of the monophyly of lophophorates including Bryozoa, Brachiopoda, Phoronida and Entoprocta and a sister group relationship of Bryozoa and Brachiopoda. The numbers above/below the branches indicate bootstrapping values (BP) that show node confidence values. Gray boxes indicate lopho-phorate members. Metridium senile and Acropora tenuis were used as outgroups. Refer to Table 5 for more detailed information and classification of the species used. "M" in parenthesis is an abbreviation of the phylum Molluska. The log likelihood value of the best tree is -66427.37.

Table 5: Species, classification and accession numbers used in the present phylogenetic analysis

Taxon Classification Accession No.

Diploblasts

Acropora tenuis Cnidaria, Anthozoa, Scleractinia NC 003522

Metridium senile Cnidaria, Anthozoa, Actiniaria NC 000933

Triploblasts

Deuterostomes

Arbacia lixula Echinodermata, Echinoidea NC 001770

Florometra serratissima Echinodermata, Crinoidea NC 001878

Balanoglossus carnosus Hemichordata, Enteropneusta NC 001887

Homo sapiens Chordata, Vertebrata, Primates AC 000021

Xenopus laevis Chordata, Vertebrata, Amphibia NC 001573

Protostomes

Ecdysozoa

Atelura formicaria Arthropoda, Hexapoda, Thysanura NC 011197

Tribolium castaneum Arthropoda, Hexapoda, Coleoptera NC 003081

Heptathela hangzhouensis Arthropoda, Chelicerata, Arachnida NC 005924

Limulus polyphemus Arthropoda, Chelicerata, Merostomata NC 003057

Lithobius forficatus Arthropoda, Myriapoda, Chilopoda NC 002629

Antrokoreana gracilipes Arthropoda, Myriapoda, Diplopoda NC 010221

Triops cancriformis Arthropoda, Crustacea, Notostraca NC 004465

Penaeus monodon Arthropoda, Crustacea, Decapoda NC 002148

Priapulus caudatus Priapulida, Priapulidae NC 008557

Epiperipatus biolleyi Onychopora, Peripatidae NC 009082

Caenorhabditis elegans Nematoda, Chromadorea NC 001328

Trichinella spiralis Nematoda, Enoplea NC 002681

Lophotrochozoa

Bugula neritina Bryozoa, Gymnolaemata, Cheilostomata AY690838(this study)

Flustrellidra hispida Bryozoa, Gymnolaemata, Ctenostomata NC 008192

Terebratalia transversa Brachiopoda, Laqueidae NC 003086

Terebratulina retusa Brachiopoda, Cancellothyrididae NC 000941

Laqueus rubellus Brachiopoda, Laqueidae NC 002507

Phoronis psammophila Phoronida, Phoroniformea AY36823I (partial)

Loxocorone allax Entoprocta, Loxosomatidae, Loxocorone NC 010431

Loxosomella aloxiata Entoprocta, Loxosomatidae, Loxosomella NC 010432

Aplysia californica Molluska, Gastropoda, Opisthobranchia NC 005827

Biomphalaria glabrata Molluska, Gastropoda, Pulmonata NC 005439

Pupa strigosa Molluska, Gastropoda, Opisthobranchia NC 002176

Graptacme eborea Molluska, Scaphopoda, Dentaliida NC 006162

Loligo bleekeri Molluska, Cephalopoda, Coleoidea NC 006321

Nautilus macromphalus Molluska, Cephalopoda, Nautiloidea NC 007980

Octopus vulgaris Molluska, Cephalopoda, Coleoidea NC 006353

Katharina tunicate Molluska, Polyplacophora NC 001636

Clymenella torquata Annelida, Polychaeta, Capitellida NC 002322

Lumbricus terrestris Annelida, Clitellata, Haplotaxida NC 001673

Platynereis dumerilii Annelida, Polychaeta, Phyllodocida NC 000931

Microcotyle sebastis Platyhelminthes, Trematoda, Monogenea NC 009055

Schistosoma japonicum Platyhelminthes, Trematoda, Digenea NC 002544

Echinococcus granulosus Platyhelminthes, Cestoda, Eucestoda NC 008075

Urechis caupo Echiura, Xenopneusta, Urechidae NC 006379

Bryozoa Brachiopoda Echiura Annelida

Cephalopoda(M)

| Polyplacophora(M)

| Entoprocta | Phoronida

| Gastropoda(M)

| Scaphopoda(M)

| Priapulida

| Onychophora | Echinodermata | Hemichordata

| Chordata

I Diploblasts

Priapulus caudatus

Epiperipatus biolkyi

—Metridium senile

Bryozoa Brachiopoda Echiura Annelida

Gastropoda(M) Scaphopoda(M) Cephalopoda(M)

Entoprocta

| Phoronida | Polyplacophora(M)

| Priapulida

| Onychophora | Echinodermata | Hemichordata I Chordata

Figure6

Maximum likelihood trees inferred from amino acid (A) or nucleotide (B) sequences of 12 protein-coding genes in 37 metazoan mitochondrial genomes, showing a monoclade of Bryozoa and Brachipoda, a sister group relationship of Bryozoa + Brachiopoda and Annelida-Echiura, non-monophyly of lophophorates, and a close relationship of Phoronida and Entoprocta (or Katharina tunicate). The numbers above and below the branches indicate bootstrapping values in percentage (BP) and Bayesian posterior probabilities (BPP) in order, which show node confidence values. Because the BI tree was very similar to the ML tree, only the ML tree is presented here and the BPP values of the BI tree are shown with BP values of the ML tree on each node. Gray boxes indicate lophophorate members. Metridium senile and Acropora tenuis were used as outgroups. Refer to Table 5 for more detailed information and classification of the species used. M in parenthesis is an abbreviation of the phylum Molluska. The log likelihood values of the best trees are -72906.37 in (A) and -106791.00 in (B).

Arthropoda

Arthropoda

Diploblasts

was digested with PstI, generating four fragments (approximately 0.9, 2.7, 2.7 and 7 kb). The two internal PstI-restricted fragments (0.9 kb and 2.7 kb) were ligated into PstI-digested pUC19 vector and both the end fragments (2.7 kb and 7 kb) with A-tailings were ligated into the modified, PstI-digested pGEM T-easy vector (Promega Co.). All ligates were cloned with Escherichia coli DH5a strain. Correct recombinants were selected by the blue/ white colony selection method using X-gal and IPTG. Plasmid DNAs were purified using an AtmanBio Plasmid Miniprep Kit (Takara Co., Japan).

Sequencing and sequence analysis

The purified plasmid DNA was sequenced using a primer walking method with the ABI PRISM BigDye terminator system and analyzed on an ABI3700 model automatic sequencer (Genotech Co., Korea). DNA sequences were analyzed using GeneJockey II, Version 1.6 (BIOSOFT Inc., Cambridge, UK). Thirteen mitochondrial protein-coding

genes were initially identified by a BLAST comparison with other animal mitochondrial genomes, with start codons inferred as eligible in-frame start codons corresponding at least to the extent of alignment that does not overlap the upstream gene. Protein gene termini were inferred to be at the first in-frame stop codon unless this was located within the sequence of a downstream gene. Otherwise, a truncated stop codon (T or TA) adjacent to the beginning of the downstream gene was designated the termination codon, assuming that it could be completed by polyadenylation after transcript cleavage [56]. Ribos-omal RNAs were identified by a BLAST search. A preliminary screening for tRNA genes was carried out using tRNAscan-SE, version 1.1 [57]. The tRNA genes that were not identified in this way were visually identified by inspection of anticodon sequences and their proposed cloverleaf secondary structures [58]. The sequence data obtained here are available from DDBJ/EMBL/GenBank under accession number AY690838.

Table 6: Topology test results

Hypothesis Phylogenetics Hypothesis ELW Test

Monophyly of Bryozoa and Brachiopoda (((Br, Bc),(An-Ec)),(En, Ph)) 0.4837*

// (((Br, Bc),(En, Ph)),(An-Ec)) 0.4939*

// ((((Br, Bc), Ph),(An-Ec)), En) 0.0135

// ((((Br, Bc), Ph), En),(An-Ec)) 0.0135

Old-concept Bryozoa ((En, Br), Bc,(An-Ec), Ph) 0.0160

Brachiozoa (((Bc, Ph), Br, En),(An-En)) 0.0005

((Bc, Ph), Br,(An-Ec), En) 0.0002

Asterisks (*) mark values for the topologies included in the 0.95 confidence set (ELW of the tree topologies with the highest confidence levels that added up to 0.95). The two bold-letter lines are accepted and the others are refuted.

Br, Bryozoa (Bugula+Flustrellidra); En, Entoprocta (Loxocorone+Loxosomella); Bc, Brachiopoda [((Laqueus, Terebratalia), Terebratulina)]; Ph, Phoronida (Phoronis); An, Annelida (Clymenella,(Lumbricus, Platynereis)); Ec, Echiura (Urechis).

Phylogenetic analysis

For the first step in the present phylogenetic analyses, we employed 40 protostomes and deuterostomes as ingroup taxa and 2 primitive metazoans as outgroup taxa, as listed in Table 5. When we selected the taxa for the present analyses, we tried to include all the lophotrochzoans for which complete mitochondrial genomes had already been sequenced. Some representative and/or slowly-evolving ecdysozoans and deuterostomes were included as reference taxa. All mitochondrial genome sequences obtained from members of the phyla Bryozoa (2 species), Brachiopoda (3), Phoronida (1), Echiura (1) and Entoprocta (2) were used here. However, since complete mitochondrial genome sequences from a number of members of the phyla Molluska (45), Platyhelminthes (28), and Annelida (8) have been determined, we selected only 3 each from Annelida and Platyhelminthes and 8 from Molluska, in order to reduce the calculation time in the present analyses. Those selected are representative and/or slowly-evolving ones in each phylum. Paraspadella gotoi and Spadella cephaloptera (Phyum Chaetognatha) and Cephalothrix rufifrons (Phylum Nemertea) were not included in the present analyses because they do not have atp6 and atp8, or have some genes that are as yet unidentified.

The nucleotide and amino acid sequences of the 12 protein-coding genes were used for the analyses. Only the 12 multiple alignment subsets of these sequences were created using a Clustal X multiple alignment program [59] under the default option. Only well-aligned, conserved alignment sites were extracted from each alignment subset using the Gblock program [60] with the default option. The conserved blocks extracted were subsequently con-

catenated into a single, unified, large alignment set with the Gblock program. In the second-round phylogenetic analyses, to resolve the problem of long-branch attraction, 5 taxa (2 nematodes and 3 platyhelminths) showing extremely long branches (Fig. 5 and [additional file 4]) were excluded from the original data set used in the first step. In total, the nucleotide and amino acid sequences of the mitochondrial protein-coding genes for 37 taxa were aligned and conserved blocks were extracted as described above.

For the first-round phylogenetic analyses with 42 meta-zoan mitochondrial genomes, the refined alignments (1735 aa and 4470 nt positions in length) were subjected to two different tree-making algorithms: the maximum likelihood (ML) and Bayesian inference (BI) methods. For phylogenetic analyses based on amino acid sequences, rather than using hierarchical likelihood ratio tests to select the best-fitting model for the evolution of sequences, and to calculate the related parameter values (I and A), ProtTest ver. 1.3 was used under the Akaike Information Criterion (AIC) because it has several important advantages [61]. Among the 36 models implemented in this program, the best-fitting model selected was MtArt [62] with among-site substitution-rate heterogeneity described by a gamma distribution (A = 0.732) and a fraction of sites constrained to be invariable (I= 0.072). For phylogenetic analyses based on nucleotide sequences, the best-fitting evolutionary model was estimated by Model Test 3.6 [63], from which the GTR+G+I (general time reversible model + among site rate variation + invariable sites) model was selected. Model Test 3.6 was also used to estimate the substitution rate parameters between nucle-

otides (AC 1.64479, AG 3.36847, AT 1.24161, CG 3.28174, CT 3.48682, and GT 1.00000) for the GTR model, base frequencies (A = 0.244605, C = 0.141275, G = 0.184743, T = 0.429377), assumed proportion of invariable sites (I = 0.126031), and the shape parameter (alpha) of the among-site rate variation (G = 0.665080).

For the second-round phylogenetic analyses with 35 pro-tostomes and deuterostomes and 2 outgroup taxa, the refined alignments (2127 aa and 4965 nt positions in length) were subjected to the two different tree-making algorithms, ML and BI. For phylogenetic analyses based on amino acid sequences, MtArt was selected as the best-fitting model [62] with among-site substitution-rate heterogeneity described by a gamma distribution (r = 0.714) and a fraction of sites constrained to be invariable (I = 0.1511). For phylogenetic analyses based on nucleotide sequences, GTR+G+I (general time reversible model + among site rate variation + invariable sites) was selected as the best-fitting model. The substitution rate parameters between nucleotides were AC 1.08325, AG 3.02089, AT 1.20831, CG 2.51010, CT 2.92091, and GT 1.00000 for the GTR model, the base frequencies were A = 0.259281, C = 0.176486, G = 0.176848, T = 0.387385, the invariable site parameter (I) was 0.105884, and the shape parameter (alpha) of the among-site rate variation was G = 0.593221.

All the parameters estimated were then employed for ML and BI analyses in the first and second round phylogenetic analyses, respectively. Four rate categories were used in the present study. The ML analysis was carried out using PHYML v2.4.4 [64] and Treefinder [65]. The bootstrap proportions in percentage (BP) of the ML tree were obtained with 500 replicates by the fast-ML method using PHYML and Treefinder. The BI analysis was carried out using the MrBayes v3.0b4 program [66] with the following options: 1,000,000 generations, 4 chains (1 hot and 3 cold) and a burn-in step of the first 10,000. The node confidence values of the BI tree were presented with Bayesian posterior probabilities (BPP).

Statistical confidence values for possible groupings of the ML tree based on the amino acid residues of 12 protein-coding genes were computed by applying expected likelihood weights (ELWs) [67] to all local rearrangements (LR) of tree topology around an edge (1,000 replicates) using the program TREEFINDER.

Abbreviations

atp6 and atp8: genes for the ATPase subunits 6 and 8; cox1-cox3: genes for cytochrome C oxidase subunits I-III; cob: a gene for apocytochrome b; nad1-nad6 and nad4L: genes for NADH dehydrogenase subunits 1-6 and 4L; rrnS and

rrnL: genes for 12S and 16S rRNAs; trnX: where X is replaced by single-letter amino acid abbreviations of the corresponding amino acids; trnL1 and trnL2: genes for tRNALeu(UUR) (anticodon TAA) and tRNALeu(CUN) (antico-don TAG): respectively; trnS1 and trnS2: genes for the tRNASCT(UCN) (anticodon TGA) and tRNASer(AGN) (anticodon GCT): respectively; ML: the maximum likelihood method; BI: Bayesian inference; BPP: Bayesian posterior probabilities; BP: bootstrap proportions; MLnt: the maximum likelihood tree inferred from nucleotide sequences; MLaa: the maximum likelihood tree inferred from amino acid sequences; BInt: the Bayesian inference tree inferred from nucleotide sequences; BIaa: the Bayesian inference tree inferred from amino acid sequences.

Competing interests

The authors declare that they have no competing interests. Authors' contributions

KHJ and UWH made substantial contributions to the conception and design of the study, acquisition of the data, and analysis and interpretation of the data. KHJ wrote the early draft of this manuscript, and UWH revised and rewrote all parts of the manuscript. Both authors read and approved the final version of the manuscript. UWH gave final approval of the version to be published.

Additional material

Additional file 1

A hairpin-loop structure of a noncoding region NC1 in the mitochondrial genome of a bryozoan,

A hairpin-loop structure of a noncoding region NC1 in the mitochondrial genome of a bryozoan, Bugula neritina. Click here for file

[http://www.biomedcentral.com/content/supplementary/1471-2164-10-167-S1.eps]

Additional file 2

AT-skew of mitochondrial protein-coding and ribosomal RNA genes of 14 lophotrochozoan species.

AT-skew of mitochondrial protein-coding and ribosomal RNA genes of 14 lophotrochozoan species. Click here for file

[http://www.biomedcentral.com/content/supplementary/1471-2164-10-167-S2.docx]

Additional file 3

CG-skew of mitochondrial protein-coding and ribosomal RNA genes of 14 lophotrochozoan species.

CG-skew of mitochondrial protein-coding and ribosomal RNA genes of 14 lophotrochozoan species.

Click here for file

[http://www.biomedcentral.com/content/supplementary/1471-2164-10-167-S3.docx]

Additional file 4

Maximum likelihood tree inferred from nucleotide sequences of 12 protein-coding genes of 42 metazoan mitochondrial genomes, showing non-monophyly of lophophorates and a sister group relationship of Bryozoa and Brachiopoda Maximum likelihood tree inferred from nucleotide sequences of 12 protein-coding genes of 42 metazoan mitochondrial genomes, showing non-monophyly of lophophorates and a sister group relationship of Bryozoa and Brachiopoda. The numbers above/below the branches indicate bootstrapping values (BP) that show node confidence values. Gray boxes indicate lophophorate members. Metridium senile and Acropora tenuis were used as outgroups. Refer to Table 5 for more detailed information and classification of the species used. M in a parenthesis is an abbreviation of the phylum Molluska. The log likelihood value of the best tree is -112314.88. Click here for file

[http://www.biomedcentral.com/content/supplementary/1471-2164-10-167-S4.eps]

Additional file 5

Bayesian Inference tree inferred from amino acid residues of 12 protein-coding genes of 42 metazoan mitochondrial genomes. Bayesian Inference tree inferred from amino acid residues of 12 protein-coding genes of 42 metazoan mitochondrial genomes. The numbers above/below the branches indicate Bayesian posterior probabilities (BPP) that show node confidence values. Metridium senile and Acro-pora tenuis were used as outgroups. The log likelihood value of the best tree is -68516.902. Refer to Table 5 for more detailed information. Click here for file

[http://www.biomedcentral.com/content/supplementary/1471-2164-10-167-S5.eps]

Additional file 6

Bayesian Inference tree inferred from nucleotide sequences of 12 protein-coding genes of 42 metazoan mitochondrial genomes. Bayesian Inference tree inferred from nucleotide sequences of 12 protein-coding genes of 42 metazoan mitochondrial genomes. The numbers above/below the branches indicate Bayesian posterior probabilities (BPP) that show node confidence values. Metridium senile and Acro-pora tenuis were used as outgroups. The log likelihood value of the best tree is -112068.205. Refer to Table 5 for more detailed information. Click here for file

[http://www.biomedcentral.com/content/supplementary/1471-2164-10-167-S6.eps]

Acknowledgements

The authors greatly appreciate Prof. Ji Eun Seo (Dept. of Social Welfare with addiction rehabilitation, Woosuk University, Jeonbuk, Korea) for providing the Bugula neritina sample for us, and also heartily thank the laboratory staffs of UWH (Mr. Yong Seok Lee, Ms. Shin Ju Park, and Mr. Jong Tae Lim) for their help with the experiments and sequence analysis. We also appreciate two anonymous reviewers for critical and valuable comments on the manuscript. This study was supported by both a grant from the Korea Science and Engineering Foundation (KOSEF; R0I-2008-000-2I028-0) and a year-2008 grant from the National Institute of Biological Resources, Korean Government (Origin of Biological Diversity of Korea: Molecular Phylogenetic Analyses of Major Korean Taxa) awarded to UWH.

References

1. McKinney ML, Jackson JBC: Bryozoan Evolution. Chicago: University of Chicago Press; 1989.

2. Hayward PJ, Ryland JS: Cheilostomatous Bryozoa Part 1 Aete-oidea-Cribrilinoidea. Edited by: Hayward PJ, Ryland JS. Brill and Backhuys; 1998.

3. Ryland JS: Bryozoa: an introductory overview. Moostiere (Bryozoa), Moss Animals (Bryozoa) Denisia 2005, 16:9-20.

4. Hyman LH: The invertebrates: smaller coelomate groups. New York; Toronto; London: McGraw-Hill; 1959.

5. Emig CC: On the origin of the lophophorata. ZZool Syst EvolutForsch 1984, 22:91-94.

6. Brusca RC, Brusca GJ: Invertebrates. Sunderland, MA: Sinauer Associates Inc; 1990.

7. Willmer P: Invertebrate Relationships: Patterns in animal evolution. New York: Cambrige University Press; 1990.

8. Eming CC: Les lophophorates constituent-ils un embranchement? Bull Soc Zool France 1997, 122:279-288.

9. Eernisse DJ, Albert JS, FE A: Annelida and arthropoda are not sister taxa: a phylogenetic analysis of spiralian metazoan phylogeny. Syst Biol 1992, 41:305-330.

10. Nielsen C, Scharff N, Eibye-Jacobsen D: Cladistic analyses of the animal kingdom. Biol J Linn Soc Lond 1996, 57:385-410.

I I. Zrzavy J, Milhulka S, Kepka P, Bezdek A, Tietz DF: Phylogeny of the Metazoa based on morphological and I8S ribosomal DNA evidence. Cladistics 1998, 14:249-285.

12. Nielsen C: Animal evolution: Interrelationships of the living phyla. 2nd edition. Edited by: Nielsen C. USA, Oxford University Press; 2001:232-263.

13. Brusca RC, Brusca GJ: Invertebrates. 2nd edition. Edited by: Brusca RC, Brusca GJ. MA, Sinauer Press; 2003:771-779.

14. Conway-Morris S: Nailing the Lophophorates. Science 1995, 375:365-366.

15. Halanych KM, Bacheller JD, Aguinaldo AM, Liva SM, Hillis DM, Lake JA: Evidence from I8S ribosomal DNA that the lopho-phorates are protostome animals. Science I995, 267:1641-1643.

16. Conway-Morris S, Cohen BL, Gawthrop AB, Cavalier-Smith T, Win-nepenninckx B: Lophophorate phylogeny. Science I996, 272:282.

17. Mackey LY, Winnepenninckx B, Dewachter R, Backeljau T, Emscher-mann P, Garey JR: 18S rRNA suggests that Entoprocta are pro-tostomes, unrelated to Ectoprocta. J Mol Evol 1996, 42:552-559.

18. Cohen BL, Gawthrop AB: The brachiopod genome. In Treatise on invertebrate paleontology Edited by: Williams A, Lawrence KS. Geological Society of America and University of Kansas Press; 1997:189-211.

19. Giribet G, Distel DL, Polz M, Sterrer W, Wheeler WC: Triploblas-tic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Platyhelminthes, and Chaetognatha: a combined approach of I8S rDNA sequences an morphology. Syst Biol 2000, 49:539-562.

20. Passamaneck YL, Halanych KM: Evidence from Hox genes that bryozoans are lophotrochozoans. Evol Develop 2004, 6:275-281.

21. Peterson KJ, Eernisse DJ: Animal phylogeny and the ancestry of bilaterians: inferences from morphology and 18S rDNA gene sequences. Evol Develop 2001, 3:170-205.

22. Field KG, Olsen GJ, Lane DJ, Giovannoni SJ, Ghiselin MT, Raff EC, Pace MR, Raff RA: Molecular phylogeny of the animal kingdom. Science I988, 239:748-753.

23. Cohen BL, Gawthrop AB, Cavalier-Smith T: Molecular phylogeny of brachiopods and phoronids based on nuclear-encoded small subunit ribosomal RNA gene sequences. Phil Trans R Soc Lond B 1998, 353:2039-2061.

24. Cohen BL, Stark S, Gawthrop AB, Burke ME, Thayer CW: Comparison of articulate brachiopod nuclear and mitochondrial gene trees leads to a clade-based redefinition of proto-stomes Protostomozoa and deuterostomes Deuterostomo-zoa. Proc R Soc Lond Ser B Biol Sci I998, 265:475-482.

25. Wolstenholme DR: Animal mitochondrial DNA: structure and evolution. Int Rev Cytol 1992, 141:173-216.

26. Hassanin A, Léger N, Deutsch J: Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of metazoa, and consequences for phylogenetic inferences. Syst Biol 2005, 54:277-298.

27. Swire J, Judson O, Burt A: Mitochondrial genetic codes evolve to match amino acid requirements of proteins. J Mol Evol 2005, 60:128-139.

28. Stechmann A, Schlegel M: Analysis of the complete mitochondrial DNA sequence of the brachiopod Tereburatulina retusa places Brachiopoda within the protosmes. P Roy Soc B Biol Sci 1999, 266:2043-2052.

29. Helfenbein KG, Boore JL: The mitochondrial genome of Pho-ronis architecta comparisons demonstrate that phoronids are lophotrochozoan protosmes. Mol Biol Evol 2004, 21:153-157.

30. Cavalier-Smith T: A revised six-kingdom system of life. Biol Rev 1998, 73:203-266.

31. Waeschenbach A, Telford MJ, Porter JS, Littlewood TJ: The complete mitochondrial genome of Flustrellidra hispida and the phylogenetic position of Bryozoa among the Metazoa. Mol Phylogenet Evol 2006, 40:195-207.

32. Clayton DA: Replication of animal mitochondrial DNA. Cell 1982, 28:693-705.

33. Clayton DA: Replication and transcription of vertebrate mito-chondrial DNA. Annu Rev Cell Biol 1999, 7:453-478.

34. Jacobs HT, Elliott DJ, Math VB, Farquharson A: Nucleotide sequence and gene organization of sea urchin mitochondrial DNA. J Mol Biol 1988, 202:185-217.

35. Tomita K, Yokobori SI, Oshima T, Ueda T, Watanabae K: The Cephalopod Loligo bleekeri mitochondrial genome: multipled noncoding regions and transposition of tRNA genes. J Mol Biol 2002, 54:486-500.

36. Serb JM, Lydeard C: Complete mtDNA sequence of the North American freshwater mussel, Lampsilis ornata (Unionidae): an examination of the evolution and phylogenetic utility of mitochondrial genome organization in bivalvia (Molluska). Mol Biol Evol 2003, 20:1854-1866.

37. Noguchi Y, Endo K, Tajima F, Ueshima R: The mitochondrial genome of the brachiopod Laqueus rubellus. Genetics 2000, 155:245-259.

38. Boore JL, Brown WM: Complete sequence of the mitocondrial DNA of the annelid worm Lumburicus terrestris. Genetics 1995, 141:305-319.

39. Wolstenholme DR, Okimoto R, Macfarlane JL: Nucleotide correlations that suggest tertiary interactions in the TV-replacement loop-containing tochondrial tRNAs of the nematodes, Caenorhabditis elegans and Ascaris suum. Nucleic Acids Res 1994, 22:4300-4306.

40. Boore JL, Brown WM: Complete DNA sequence of the mito-chondrial genome of the black chiton, Katharina tunicate. Genetics 1994, 138:423-443.

41. Yamazaki N, Ueshima R, Terrett JA, Thomas RH: Evolution of pulmonate gastropod mitochondrial genomes: comparisons of gene organizations of Euhadra, Cepaea and Albinaria and implications of unusual tRNA secondary structures. Genetics 1997, 145:749-758.

42. Helfenbein KG, Brown WM, Boore JL: The complete mitochon-drial genome of the articulate brachiopoda Terabratalia transversa. Mol Biol Evol 2001, 18:1734-1744.

43. Jeyaprakash A, Hoy M: The mitochondrial genome of the predatory mite Metaseiulus occidentalis (Arthropoda: Chelicer-ata: Acari: Phytoseiidae) is unexpectedly large and contains several novel features. Gene 2007, 391:264-274.

44. Lars P, Anke B, Georg M: The complete mitochondrial genome of the Onychophoran Epiperipatus biolleyi reveals a unique transfer RNA set and provides further support for the ecdys-ozoa hypothesis. Mol Biol Evol 2008, 25:42-51.

45. Yokobori S, Iseto T, Asakawa S, Sasaki T, Shimizu N, Yamagishi A, Oshima T, Hirose E: Complete nucleotide sequences of mito-chondrial genomes of two solitary entoprocts, Loxocorone allax and Loxosomella aloxiata: Implications for ophotrocho-zoan phylogeny. Mol Phylogenet Evol 2008, 47(2):612-628.

46. Eernisse DJ: Arthropod and annelid relationships re-examined. London: Chapman & Hall; 1997.

47. Anderson FE, Cordoba AJ, Thollesson M: Bilaterian phylogeny based on analyses of a region of the sodium-potassium ATPase a-subunit gene. J Mol Evol 2004, 58:252-268.

48. Cohen BL: Monophyly of brachiopods and phoronids: reconciliation of molecular evidence with Linnaean classification (the subphylum Phoronifirmea nov.). Proc R Soc Lond B 2000, 267:225-231.

49. Dunn C, Hejnol a, Matus D, Pang K, Browne W, Smith S, Seaver E, Rouse G, Obst M, Edgecombe G, et al.: Broad phylogenomic sampling improves resolution of the animal tree of life. Nature 2008, 452:745-749.

50. Hausdorf B, Helmkampf M, Meyer A, Witek A, Herlyn H, Bruchhaus I, Hankeln T, Struck T, Lieb B: Spiralian Phylogenomics Supports the Resurrection of Bryozoa Comprising Ectoprocta and Entoprocta. Mol Biol Evol 2007, 24:2723-2729.

5 1. Helmkampf M, Bruchhaus I, Hausdorf B: Phylogenomic analyses of lophophorates (brachiopods, phoronids and bryozoans) confirm the Lophotrochozoa concept. Proc R Soc B 2008, 275:1927-1933.

52. Adoutte A, Balavoine G, Lartillot N, Lespinet O, Prud'homme B, De Rosa R: The new animal phylogeny: reliability and implications. Proc Natl Acad Sci U S A 2000, 97(9):4453-4456.

53. Halanych K: The new view of animal phylogeny. Ann Rev Ecol Evol Syst 2004, 35:229-256.

54. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P: Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a comilation of conserved polymerase chain reaction primers. Ann Entomol Soc Amer 1994, 87:651-701.

55. Folmer O, Black M, Hoeh R, Lutz RA, Vrijenhoek R: DNA primers for amplification of mitochondrial cytchrome C oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Bio-technol 1994, 3:294-299.

56. Ojala D, Montoya J, Attardi G: tRNA punctuation model of RNA processing in human mitochondria. Nature 1981, 290:470-474.

57. Lowe TM, Eddy SR: tRNA-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 1997, 25:955-964.

58. Kumazawa Y, Nishida M: Variations in mitochondrial tRNA gene organization of reptiles as phylogenetic markers. Mol Biol Evol 1995, 12:759-772.

59. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997, 24:4876-4882.

60. Castresana J: Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 2000, 17:540-552.

61. Posada D, Buckley T: Model selection and model averaging in phylogenetics: advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Syst Biol 2004, 53:793-808.

62. Adachi J, Hasegawa M: Model of amino acid substitution in proteins encoded by mitochondrial DNA. J Mol Evol 1996, 42:459-468.

63. Posada D, Crandall KA: Modeltest: testing the model of DNA substitution. Bioinformaitcs 1998, 14:817-818.

64. Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 2003, 52:696-704.

65. Jobb G: TREEFINDER version of may 2006. Munich, Germany: Distributed by the author [http://www.treefinder.de].

66. Huelsenbeck JP, Ronquist F: MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17:754-755.

67. Strimmer k, Rambaut A: Inferring confidence sets of possibly misspecified gene trees. Proc R Soc B 2002, 269:137-142.

Publish with BioMecl Central and every scientist can read your work free of charge

"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime." Sir Paul Nurse, Cancer Research UK

Your research papers will be:

• available free of charge to the entire biomedical community

• peer reviewed and published immediately upon acceptance

• cited in PubMed and archived on PubMed Central

• yours — you keep the copyright

Submit your manuscript here: i } BioMedcentral

http://www.biomedcentral.com/info/publishing_adv.asp ^