Scholarly article on topic 'Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity'

Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity Academic research paper on "Veterinary science"

CC BY
0
0
Share paper
Academic journal
BMC Microbiology
OECD Field of science

Academic research paper on topic "Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity"

Zhao et al. BMC Microbiology (2015) 15:111 DOI 10.1186/s12866-015-0438-0

Microbiology

RESEARCH ARTICLE Open Access

Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity

Jian Zhao, Qian Li, Chun-Ling Pan, Jun-Chao Liu, Hong-Yan Wang, Li-Si Tan and Ya-Ping Pan*

Abstract

Background: The development of chronic periodontitis was due to not only periodontal pathogens, but also the interaction between periodontal pathogens and host. The aim of this study is to investigate the alterations in gene expression in Porphyromonas gingivalis (P.gingivalis) W83 after inoculation in rat oral cavity.

Results: P.gingivalis W83 inoculation in rat oral cavity caused inflammatory responses in gingival tissues and destroyed host alveolar bone. Microarray analysis revealed that 42 genes were upregulated, and 22 genes were downregulated in the detected 1786 genes in the inoculated P.gingivalis W83. Real-time quantitative PCR detection confirmed the expression alterations in some selected genes. Products of these upregulated and downregulated genes are mainly related to transposon functions, cell transmembrane transportation, protein and nucleic acid metabolism, energy metabolism, cell division and bacterial pathogenicity.

Conclusions: P.gingivalis W83 has a pathogenic effect on host oral cavity. Meanwhile, inflammatory oral environment alters P.gingivalis W83 gene expression profile. These changes in gene expression may limit the proliferation and weaken the pathogenicity of P.gingivalis W83, and favor themselves to adapt local environment for survival.

Keywords: Porphyromonas gingivalis, Periodontitis, Microarray, Gene expression

Background

Periodontitis is a chronic inflammatory disorder mediated by host and bacteria interactions and manifested by damage to the periodontal tissues that may progress to tooth loss. The host inflammatory responses stimulated by periodontal pathogens intend to eliminate the invaded bacteria and attribute to the destruction of tooth supporting tissues and tooth loss [1]. Moreover, the local periodontal environment may change the gene expression profile of periodontal pathogens [2-4]. To a certain extent, the variation of bacterial gene expression may alter the pathogenic ability of bacteria.

Porphyromonas gingivalis (P.gingivalis) is an opportunistic pathogen of the oral mucosa and a prominent member of the oral biofilms. It is well known that P.gingivalis is implicated in the onset and progression of chronic peri-odontitis. P.gingivalis can induce immune cells to secrete cytokines when they invade into hosts. These cytokines are present in inflamed gingiva and aggravate the destruction of oral gingival tissues and alveolar bone [5]. In the

* Correspondence: yppan@mail.cmu.edu.cn

Department of Periodontology, Schoolof Stomatology, China Medical University, Shenyang, Liaoning, China

meantime, the expression of P.gingivalis genes varies under different conditions, such as iron or hemin [6,7], polyphosphate [8], rhein [9]. P.gingivalis may up-regulate or downregulate gene expression to adapt environment and survive [10].

The development of chronic periodontitis was not only due to periodontal pathogens, but also the interaction between periodontal pathogens and host. Most researches focus on periodontal pathogens acting on hosts, but ignore the action of host on P.gingivalis. Actually, the changes in P.gingivalis gene expression may affect the progression of chronic periodontitis. In the present study, the differential gene expression in P.gingivalis W83 inoculated in rat oral cavity and wild strain was analyzed.

Methods

Ethical statement

All rats were manipulated in accordance with Animal Research Reporting In Vivo Experiments (ARRIVE) guidelines. The experimental protocols were approved by the ethical committee of China Medical University.

O© 2015 Zhao et al.; licensee BioMed Central. This is an Open Access article distributed under the terms of the Creative BnlVled Central Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Bacteria and animals

This study was carried out with 6-week-old SPF rats (180 - 220 g) provided by Department of Experimental Animals, China Medical University, and maintained in a temperature-controlled room (23 ± 1 °C). P.gingivalis W83 was obtained from the American Type Culture Collection (ATCC) and grown anaerobically (10 % CO2, 10 % H2, 80 % N2) in enriched brain-heart infusion (BHI) broth containing 5 % fiber-free sheep blood, 1 % vitamin K and hemin, at 37 °C.

P.gingivalis W83 inoculation

12 Rats were given azithromycin (10 mg/500 ml) ad libitum for 4 days to reduce the original oral flora. This was followed by a 7-day antibiotic-free period. 6 Rats were then orally challenged with P. gingivalis W83 (1 x 109 CFU) by gavage into the esophagus and oral cavity five times every other day [11]. The other 6 rats (control group) were only challenged with BHI broth. All 12 rats received steel wire ligature in cervical part in two sides of first molars and an 8-week high sugar feeding.

Alveolar bone loss analysis

Horizontal bone loss was assessed morphometrically by measuring the distance between the cement - enamel junction and the alveolar bone crest of the first, the second and the third molar. The alveolar bone destruction was detected by morphological and macroscopic observation, radiographic (PLANMECA, Finland) and stereo-microscope (SZX12, Olympus, Japan) fitted with a DIGIMED Viewer imaging measurement system evaluation at 6 sites per molars. Alveolar bone loss of every molar was presented in the figures as mean ± SD. Independent samples t-test was used to calculate the significance among the groups (SPSS Inc., Chicago, IL, USA). P-value < 0.05 was considered statistically significant.

Isolating culture and acquiring plaque

After P.gingivalis W83 inoculation in rat oral cavity for 8 weeks, plaques were acquired from periodontal pockets of first molar using toothpicks and put into 0.5 ml transfer tube. The plaques were dispersed by oscillator. 100 ^l ten-fold serial dilutions were inoculated on BHI culture medium anaerobically at 37 °C for 5-7 days. The morphology of colonies was observed in primary cultures. P.gingivalisW83 colonies were identified by their black pigmentation, gram staining and PCR. The single clone was purified in BHI medium for subcultures in order to detect the differences in the gene of P.gingiva lisW83.

Microarray hybridization

3 samples were picked up from wild strain P.gingivalis W83 and inoculated P.gingivalis W83, respectively. The

total RNA was extracted and labeled with Klenow, and then hybridism with P.gingivalis W83 chip. The commercial GeneChip P.gingivalis W83 Genome Array used here was provided by CapitalBio Corporation (http:// www.capitalbio.com/, Beijing, China), a service provider authorized by Roche NimbleGen (Wisconsin, USA). Array hybridization, washing, scanning and data analysis were performed at the CapitalBio Corporation, Beijing, China and carried out according to the Nimble-Gen's Expression user's guide.

Real-time quantitative PCR

To independently confirm the expression data generated by the microarray experiments, we performed real-time quantitative PCR analyses for 14 genes differentially regulated. Total RNA was extracted. Quality and concentration of the RNA were determined by measuring its absorbance at 260 and 280 nm using a microplate reader (M-200, Tecan, Switzerland). Total bacterial RNA was subsequently reverse-transcribed using the M-MLV RTase cDNA Synthesis Kit (Takara, China) following the manufacturer's protocol. Real-time quantitative PCR analysis was conducted in an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) in combination with the SYBR® Premix Ex TaqTM II PCR Master Mix Reagents Kit (Takara), as recommended by the manufacturer of the Wall Clear PCR Strip Tubes (Axygen, USA). The primers for the real-time quantitative PCR analysis were designed using Primer3 (http://bioinfo.ut.ee/primer3/) (Table 1). P.gingivalis W83 16 s DNA was used as the internal reference. Real-time quantitative PCR was performed three times for each sample. The data were analyzed according to relative gene expression by the 2-AACt method.

Statistics

Significantly differentially expressed genes between the inoculated periodontitis and wild strains were identified using two class unpaired method in the Significant Analysis of Microarray software (SAM, version 3.02). Genes were determined to be significantly differentially expressed with a selection threshold of false discovery rate, FDR < 5 % and fold change > 2.0 in the SAM output result.

Results

Pathogenic effects of P.gingivalis W83 on rat oral cavity

After P.gingivalis W83 inoculation in rat oral cavity for 8 weeks, the gingival tissues were inflammatory and bleeding (Fig. 1A). Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation (Fig. 1B). The distance between cementoenamel junction and alveolar bone crest (CEJ: ABC) was measured at proximal, middle and distal sites of buccal and palatal per molar, respectively. In first molars, second

Table 1 Seq uences for real-time PCR

Gene Sequence(5'-3') PCR product (bp)

PG1005 F: CGGTGAGGTTTACAGAAGAA R: AGGGAGGTGTAAGTCACG 79

PG1006 F: GGAATGGAGCGAAAGACC R: CCAACAAGCAGAACCGAC 169

PG1007 F: TCTGTTTGTTTGTCCCATTC R: TATGGCTCCTCAAAGTAGAG 62

PG1008 F: TTACAACAGCGGCTACCA R: TATCCACTGCCACAGCCT 103

PG1009 F: AAGCGTGCTACCATTGCG R: TCAGGCTATACCCGTTCT 78

PG1010 F: TCTGTCCCTGCGATACCT R: CACTCATCCTCCCTATCTTTC 99

PG0874 F: AGGGTGTCTGAGCAAGTA R: TGGAGGAATCGAAGATAGAA 73

PG1513 F: GAAACGGCTCAAGTCATA R: TCCCTCCTCCATTTCCAC 114

PG0684 F: GAATACGGAGGTCAATCGC R: GAACGCTGAGAAGGAGGC 90

PG0682 F: CGGTGAGTTCTATTATTGCG R: CAGCACCAGGCATGACCA 123

PG1975 F: CGTGACGGGCATAAGACA R: AGTGAGTCGTGGGTTTAC 134

PG1982 F: GTAATACCGAGGAAACTGAA R: GTGTTTCAGGGATAAGTCG 60

PG2008 F: CTGCGGTTTCAACCAAGT R: ATACCGAACCTCGTCTAC 115

PG0001 F: AGGTGGTCATGTTCCTCTCC R: TGACTACCCTCCTGCATTGG 78

molars, third molars, the distances were significantly increased, which were 1216.00 ± 305.98 ^m, 987.28 ± 238.14 ^m, 725.11 ± 202.71 ^m, compared with normal rats, which were 414.89 ± 209.67 ^m, 300.44 ± 127.92 ^m, 357.56 ± 281.06 ^m.

Identification of the inoculated P.gingivalis W83 in rat with periodontitis

Suspicious gram-negative bacilli were taken from plaque culture. After pure subculture, gram staining and polymerase chain reaction (PCR) proved that the bacteria were P.gingivalis W83. PCR fragment length of the product was 857 bp, as shown in Fig. 2.

Genes upregulated in the inoculated P.gingivalis W83

We determined the expression of 1786 genes by micro-array analysis in P.gingivalis wild strain and P.gingivalis

inoculated in oral cavity. The complete list of gene expression values has been deposited in NCBI's Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE67608). The detection showed that 42 genes were up-regulated in the inoculated P.gin-givalis W83 compared with wild strain (Table 2) (Fig. 3). In these upregulated genes, 30 expressed hypothetical proteins. Among other 12 genes, PG0874, PG0009, PG0427, PG0942 and PG0590 function as transposons. PG0009, PG0427, PG0942 and PG0590 encode ISPg5 transposases; and PG0874 encodes an int protein as a mobilizable transposon.

Genes downregulated in the inoculated P.gingivalis W83

Compared with wild strain, 22 genes were down-regulated in the inoculated strain (Table 3) (Fig. 3). Among these genes, PG0682, PG0683, PG0684, PG0282 and PG0946 encode ABC transporters. Products of PG0682, PG0683 and PG0684 are putative permease proteins; and products of PG0282 and PG0946 are ATP-binding proteins. In addition, PG2008 and PG0283 also encode transport and binding proteins. All these proteins are involved in cell transmembrane transportation. Some downregulated genes encode proteins related to protein and nucleic acid metabolism, including PG1129, PG1993, PG0001 and PG0522. Products of other genes are related to energy metabolism (PG1042), cell division (PG0141),bacterial pathogenicity (PG1975), and so on.

Microarray result confirmation by real-time quantitative PCR

Among the upregulated and downregulated genes, we picked up 14 genes to detect the expression by realtime quantitative PCR. Consistent with microarray hybridization, real-time quantitative PCR detection showed similar expression trends in these genes (Table 4).

Discussion

Chronic periodontitis is initiated by periodontal pathogens, including P.gingivalis. Our study showed that P.gingivalis W83 induced rat gingival tissue inflammation, and alveolar bone loss, which is the key feature of periodontitis. Therefore, our study demonstrates that P.gingivalis W83 has pathogenic effects on rat oral cavity. After inoculation in rat oral cavity for 8 weeks, P.gin-givalis W83 were isolated, and analyzed by microarray. In the detected 1786 genes, 42 genes were upregulated, whereas 22 genes were downregulated, indicating that the local periodontal environment can change the gene expression profile of P.gingivalis W83.

In the 42 upregulated genes, 30 expressed hypothetical proteins. Among other 12 genes, PG0874, PG0009, PG0427, PG0942 and PG0590 are in the same class in JCVI cell function classification. They all function as mobile extrachromosomal factor: transposon. Transposon

Fig. 1 Pathogenic effects of P.gingivalis W83 on rat oralcavity. (A) The gingival tissues were inflammatory and bleeding after P.gingivalis W83 inoculation in rat oralcavity for 8 weeks. (B) Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation. Left: controlgroups. Right: rats inoculated with P.gingivalis W83 intraorally for 8 weeks

Fig. 2 Isolation and identification of inoculated P.gingivalis W83. (A) Some suspicious black colonies were found from plaque mixture. (B) Suspious black colonies were pure cultured. (C) Gram staining proved the pure culture as gram-negative brevibacterium (X400). (D) Agarose gelelectrophoresis proved that PCR fragment length was 857 bp. 1 and 2: Wild type P.gingivalis W83; 3-8: three inoculated P.gingivalis W83 samples for microarray analysis (two columns for each sample)

Table 2 Genes upregulated in the inoculated P.gingivalis W83

Locus no.

Putative identification"

Cellular rolea

PG0102 PG2116 PG1007 PG0265 PG1008 PG1510 PG1009 PG1655 PG0132 PG2114 PG2064 PG1010 PG0542 PG1005 PG1514 PG0844 PG0874

PG0507 PG1357 PG1410 PG0617 PG0855 PG0009

PG0427

PG0942

PG0541 PG1398 PG1027 PG0590

PG1006 PG0340 PG0256 PG0749 PG1662 PG2220 PG1871 PG2187

PG0410 PG1233 PG0325

hypotheticalprotein

hypotheticalprotein

GntR family transcriptionalregulator

hypotheticalprotein

hypotheticalprotein

hypotheticalprotein

hypotheticalprotein

hypotheticalprotein

hypotheticalprotein

hypotheticalprotein

hypotheticalprotein

ABC transporter, ATP-binding protein

hypotheticalprotein

putative lipoprotein

glycerol dehydrogenase-related protein

hypotheticalprotein

mobilizable transposon, int protein

hypotheticalprotein hypotheticalprotein hypotheticalprotein hypotheticalprotein hypotheticalprotein ISPg5, transposase Orfl

ISPg5, transposase Orfl

ISPg5, transposase Orfl

hypotheticalprotein hypotheticalprotein hypotheticalprotein ISPg5, transposase Orfl

hypotheticalprotein hypotheticalprotein CvpA family protein hypotheticalprotein hypotheticalprotein hypotheticalprotein hypotheticalprotein

1,4-dihydroxy-2-naphthoate octaprenyltransferase

hypotheticalprotein hypotheticalprotein hypotheticalprotein

Regulatory functions: DNA interactions

Transport and binding proteins: Unknown substrate

Cellenvelope Unknown function: General

Mobile and extrachromosomalelement functions: Transposon functions

Mobile and extrachromosomalelement functions: Transposon functions

Mobile and extrachromosomalelement functions: Transposon functions

Mobile and extrachromosomalelement functions: Transposon functions

Mobile and extrachromosomalelement functions: Transposon functions

Unknown function: General

Biosynthesis of cofactors, prosthetic groups, and carriers: Menaquinone and ubiquinone

3.7076 3.6850 3.6786 3.3714 3.3338 3.0890 3.0258 2.8935 2.7298 2.6986 2.5952 2.4885 2.4794 2.4686 2.4537 2.4324 2.4307

2.4290 2.3151 2.3094 2.2814 2.2153 2.1609

2.1431

2.1424

2.1291 2.1216 2.1204 2.1151

2.1122 2.1119 2.1090 2.0834 2.0788 2.0771 2.0589 2.0471

2.0 2.0367 2.0349

Table 2 Genes upregulated in the inoculated P.gingivalis W83 (Continued)

PG0409 hypotheticalprotein

PG1513 phosphoribosyltransferase, putative/phosphoglycerate

mutase family protein

Energy metabolism: Other

2.0259 2.0032

aLocus number, identification and functional classification according to JCVI P.gingivalis genome database

is a removable genome DNA sequence, which can "jump" in genome from one location to another through the process of cutting and integration. Transposition is generally known to be triggered by cellular stress [12-14], therefore upregulation of these transposons suggests that P.gingivalis W83 inoculated in rat oral cavity may adapt local environment for its own survival, which is consistent with some other studies [15,16].

In the 22 downregulated genes, 7 genes encode transport and binding proteins. All these proteins are involved in cell transmembrane transportation. They can transport many substrates, such as metabolites, ion, sugar, amino acids, lipids, cholesterol and drugs [17]. PG2008 encodes a TonB dependent receptor protein, responsible for iron transmembrane transportation [18]. As iron ion is necessary for the breeding and spreading

of P.gingivalis W83, downregulation of PG2008 suggests the subdued iron transferring and proliferation of P.gingivalis W83. There are 4 downregulated genes encoding proteins related to nucleic acid and protein metabolism. PG1129 encodes a nucleotide reductase, which is related to purine, pyrimidine, nucleotide and DNA metabolism, and plays a regulating role in cell proliferation. Products of PG1993 and PG0001 are related to the metabolism of DNA, such as copy, restructuring and repair. Therefore, downregulation of these genes means that the proliferation of inoculated P.gingivalis W83 is in certain obstacles.

PG1042 encodes a putative glycogen synthase, involved in biosynthesis and degradation of polysaccharides. Downregulation of PG1042 suggests a disturbed energy metabolism. PG0141 encodes a spoOJ protein related to

Fig. 3 Genes analyzed by microarray in the inoculated P.gingivalis W83. Fluorescence signalstrength values in X axes and Y axes represent controlgroups and experimentalgroups, respectively. Each data point was behalf of a gene chip hybridization signal. Red marking data points were T/C value >2, representing upregulated genes, and green marking data points were T/C value <0.5, representing downregulated genes

Table 3 Genes downregulated in the inoculated P.gingivalis W83

Locus no. Putative identification" Cellular rolea Fold

PG2008 TonB-dependent receptor, putative Transport and binding proteins: Cations and iron carrying compounds 0.2234

PG0929 hypotheticalprotein 0.2806

PG1129 ribonucleotide reductase Purines, pyrimidines, nucleosides, and nucleotides: 2'-Deoxyribonucleotide metabolism 0.2862

PG0684 ABC transporter, permease protein, putative Transport and binding proteins: Unknown substrate 0.3594

PG0683 ABC transporter, permease protein, putative Transport and binding proteins: Unknown substrate 0.3848

PG0682 ABC transporter, permease protein, putative Transport and binding proteins: Unknown substrate 0.3938

PG0522 tRNA delta(2)-isopentenylpyrophosphate transferase Protein synthesis: tRNA and rRNA base modification 0.4190

PG1648 RelA/SpoT family protein Cellular processes: Adaptations to atypicalconditions 0.4192

PG0282 ABC transporter, ATP-binding protein Transport and binding proteins: Unknown substrate 0.4303

PG0946 ABC transporter, ATP-binding protein Transport and binding proteins: Unknown substrate 0.4347

PG1042 glycogen synthase, putative Energy metabolism: Biosynthesis and degradation of polysaccharides 0.4485

PG0890 alkaline phosphatase, putative Centralintermediary metabolism: Other 0.4552

PG1100 hypotheticalprotein 0.4813

PG1993 excinuclease ABC subunit C DNA metabolism: DNA replication, recombination, and repair 0.4814

PG0226 transglutaminase-related protein Unknown function: General 0.4823

PG0141 spoOJ protein Cellular processes: Celldivision 0.4865

PG0144 hypotheticalprotein 0.4888

PG1975 hemagglutinin protein HagC Cellular processes: Pathogenesis 0.4941

PG1982 CRISPR-associated Casl family protein Mobile and extrachromosomalelement functions: Other 0.4950

PG1718 hypotheticalprotein 0.4955

PG0283 RND family efflux transporter MFP subunit Transport and binding proteins: Unknown substrate 0.4965

PG0001 chromosomalreplication initiation protein DNA metabolism: DNA replication, recombination, and repair 0.4984

aLocus number, identification and functional classification according to JCVI P.gingivalis genome database

Table 4 Microarray result confirmation by real-time PCR

Gene Fold increase measured by

Microarray analysis Real-time PCR

PG1005 2.471 12.24 ±2.12t

PG1006 2.11 Î 11.57 ± 1.06t

PG1007 3.681 24.67 ± 3.67t

PG1008 3.33Î 28.99 ± 4.56t

PG1009 3.03 t 27.56 ±2.66t

PG1010 2.491 19.88 ± 3.41 t

PG0874 2.431 18.58 ± 2.081

PG1513 2.001 15.86 ±2.12t

PG0684 0.361 0.036 ± 0.004j

PG0682 0.391 0.047 ± 0.005j

PG1975 0.491 0.067 ± 0.011 j

PG1982 0.491 0.058 ± 0.007j

PG2008 0.22 j 0.011 ± 0.002j

PG0001 0.501 0.068 ± 0.008j

16sRNA - 1

cell division, and PG1975 encodes hemagglutinin HagC related to pathogenicity of P.gingivalis W83. In addition, PG1982 encodes a CRISPR protein related to CAS1 family. CRISPR/CAS system can protect bacteria against the encroachment by phage, and resist other chromosome genetic material and prevent from the expression of their genes [19-21]. Downregulation of PG1982 suggests a decrease in the defense capability of P.gingivalis W83.

It should be noted that gene expression observed in this study was in mRNA level. As we have known, alterations in mRNA expression are not always consistent with those in protein expression. Therefore, observations in protein level of gene expression will be more convincing. However, it is impracticable to analyze the protein expression of all 64 genes with RNA expression alteration. Moreover, some products of these genes are still hypothetical proteins. Because the inoculated P.gingivalis was cultured outside the rat oral cavity for some days before RNA extraction, the RNA samples cannot exactly reflect the changes in gene expression after inoculation,

although the results can still indicate which genes are upregulated or downregulated.

Conclusions

Our study shows that P.gingivalis W83 has pathogenic effects on host, and local inflammatory oral environment alters the gene expression profile of P.gingivalis W83. Products of these upregulated and downregulated genes are mainly related to transposon functions, cell transmembrane transportation, protein and nucleic acid metabolism, energy metabolism, cell division and bacterial pathogenicity. These changes may lead to decreased proliferation and pathogenicity of P.gingivalis W83, and favor themselves to adapt local environment for survival.

Abbreviations

P.gingivalis: Porphyromonas gingivalis; PCR: Polymerase chain reaction; SPF: Specific pathogen free; ATCC: American Type Culture Collection; CFU: Colony forming unit; CEJ: Cementoenamel junction; ABC: Alveolar bone crest; CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats; CAS: CRISPR associated genes.

Competing interests

The authors declare that they have no competing interests. Authors' contributions

JZ carried out microarray analysis,analyzed and interpreted the data, and drafted the manuscript. QL performed P.gingivalis W83 culture and inoculation. CLP performed real-time PCR analysis. JCL and HYW were responsible for the isolation and identification of the strain. LST performed alveolar bone loss analysis. YPP designed the study and drafted the manuscript. All authors read and approved the final manuscript.

Acknowledgments

This work was supported by National Natural Science Foundation of China (No. 81271153).

Received: 2 January 2015 Accepted: 5 May 2015 Published online: 24 May 2015

10. Yoshimura M, Ohara N, Kondo Y, Shoji M, Okano S, Nakano Y, et al. Proteome analysis of Porphyromonas gingivalis cells placed in a subcutaneous chamber of mice. Oral Microbiol Immunol. 2008;23(5):413-8.

11. Baker PJ, Dixon M, Roopenian DC. Genetic control of susceptibility to Porphyromonas gingivalis-induced alveolar bone loss in mice. Infect Immun. 2000;68(10):5864-8.

12. Zhang Z, Saier Jr MH. Transposon-mediated adaptive and directed mutations and their potential evolutionary benefits. J Mol Microbiol Biotechnol. 2011 ;21(1 —2):59—70.

13. Wheeler BS. Small RNAs, big impact: small RNA pathways in transposon control and their effect on the host stress response. Chromosome Res. 2013;21(6-7):587-600.

14. Arnault C, Dufournel I. Genome and stresses: reactions against aggressions, behavior of transposable elements. Genetica. 1994;93(1-3):149-60.

15. Hendrickson EL, Xia Q, Wang T, Lamont RJ, Hackett M. Pathway analysis for intracellular Porphyromonas gingivalis using a strain ATCC 33277 specific database. BMC Microbiol. 2009;9:185.

16. Xia Q, Wang T, Taub F, Park Y, Capestany CA, Lamont RJ, et al. Quantitative proteomics of intracellular Porphyromonas gingivalis. Proteomics. 2007;7(23):4323-237.

17. Park Y, Yilmaz O, Jung IY, Lamont RJ. Identification of Porphyromonas gingivalis genes specifically expressed in human gingival epithelial cells by using differential display reverse transcription-PCR. Infect Immun. 2004;72(7):3752-8.

18. Letoffe S, Delepelaire P, Wandersman C. Free and hemophore-bound heme acquisitions through the outer membrane receptor HasR have different requirements for the TonB-ExbB-ExbD complex. J Bacteriol. 2004;186(13):4067-74.

19. Pourcel C, Salvignol G, Vergnaud G. CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology. 2005;151(Pt 3):653-63.

20. Haft DH, Selengut J, Mongodin EF, Nelson KE. A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput Biol. 2005;1(6), e60.

21. Grissa I, Vergnaud G, Pourcel C. The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics. 2007;8:172.

References

1. Williams RC. Periodontal disease. N Engl J Med. 1990;322(6):373-82.

2. Aruni AW, Zhang K, Dou Y, Fletcher H. Proteome analysis of coinfection of epithelial cells with Filifactor alocis and Porphyromonas gingivalis shows modulation of pathogen and host regulatory pathways. Infect Immun. 2014;82(8):3261 —74.

3. Nissen L, Sgorbati B, Biavati B, Belibasakis GN. Lactobacillus salivarius and L. gasseri down-regulate Aggregatibacter actinomycetemcomitans exotoxins expression. Ann Microbiol. 2014;64:611-7.

4. Kerr JE, Abramian JR, Dao DH, Rigney TW, Fritz J, Pham T, et al. Genetic exchange of fimbrial alleles exemplifies the adaptive virulence strategy of Porphyromonas gingivalis. PLoS One. 2014;9(3), e91696.

5. Baker PJ. The role of immune responses in bone loss during periodontal disease. Microbes Infect. 2000;2(10):1181-92.

6. Anaya-Bergman C, Rosato A, Lewis JP. Iron- and hemin-dependent gene expression of Porphyromonas gingivalis. Mol Oral Microbiol. 2015;30(1):39-61.

7. Phillips P, Progulske-Fox A, Grieshaber S, Grieshaber N. Expression of Porphyromonas gingivalis small RNA in response to hemin availability identified using microarray and RNA-seq analysis. FEMS Microbiol Lett. 2014;351(2):202-8.

8. Moon JH, Lee JH, Lee JY. Microarray analysis of the transcriptional responses of Porphyromonas gingivalis to polyphosphate. BMC Microbiol. 2014;14:218.

9. Azelmat J, Larente JF, Grenier D. The anthraquinone rhein exhibits synergistic antibacterial activity in association with metronidazole or natural compounds and attenuates virulence gene expression in Porphyromonas gingivalis. Arch Oral Biol. 2015;60(2):342-6.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

BioMed Central