Scholarly article on topic 'First report of NDM-1-producing Pseudomonas aeruginosa in Egypt'

First report of NDM-1-producing Pseudomonas aeruginosa in Egypt Academic research paper on "Clinical medicine"

CC BY-NC-ND
0
0
Share paper
OECD Field of science
Keywords
{" Pseudomonas aeruginosa " / "New Delhi metallo-beta-lactamase 1 (NDM-1)" / "Verona integron-encoded metallo-beta-lactamase (VIM-2)" / Metallo-beta-lactamases / "Carbapenem resistance" / Egypt}

Abstract of research paper on Clinical medicine, author of scientific article — Mai Mahmoud Zafer, Mady Amin, Hadir El Mahallawy, Mohammed Seif El-Din Ashour, Mohamed Al Agamy

Summary This work reports the occurrence of New Delhi metallo-beta-lactamase 1 (NDM-1) in metallo-beta-lactamase-producing Pseudomonas aeruginosa in Egypt for the first time, and the presence of more than one blaMBL gene in carbapenem-resistant P. aeruginosa.

Academic research paper on topic "First report of NDM-1-producing Pseudomonas aeruginosa in Egypt"

International Journal of Infectious Diseases 29 (2014) 80-81

Contents lists available at ScienceDirect

International Journal of Infectious Diseases

journal homepage www.elsevier.com/locate/ijid

Case Report

First report of NDM-1-producing Pseudomonas aeruginosa in Egypt

Mai Mahmoud Zafera *, Mady Aminb, Hadir El Mahallawyc, Mohammed Seif El-Din Ashourd e, Mohamed Al Agamy e,f

a Department of Microbiology and Immunology, Faculty of Pharmacy, Ahram Canadian University, 4th Industrial Zone, Banks Complex, 6th of October, Giza, Egypt

b Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, El Aini, Al Sayedah Zeinab, Cairo, Egypt c Department of Clinical Pathology, National Cancer Institute, Cairo University, Cairo, Egypt d Department of Microbiology and Immunology, Faculty of Pharmacy, MSA University, 6th of October, Giza, Egypt e Department of Microbiology and Immunology, Faculty of Pharmacy, Al-Azhar University, Cairo, Egypt f Department of Pharmaceutics and Microbiology, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia

CrossMark

ARTICLE INFO

SUMMARY

Article history:

Received 7 May 2014

Received in revised form 6 July 2014

Accepted 11 July 2014

Corresponding Editor: Eskild Petersen,

Aarhus, Denmark

This work reports the occurrence of New Delhi metallo-beta-lactamase 1 (NDM-1) in metallo-beta-lactamase-producing Pseudomonas aeruginosa in Egypt for the first time, and the presence of more than one biaMBL gene in carbapenem-resistant P. aeruginosa.

© 2014 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-

nc-nd/3.0/).

Keywords:

Pseudomonas aeruginosa

New Delhi metallo-beta-lactamase 1

(NDM-1)

Verona integron-encoded metallo-beta-lactamase (VIM-2) Metallo-beta-lactamases Carbapenem resistance Egypt

1. Introduction

New Delhi metallo-beta-lactamase 1 (NDM-1) has received wide attention because of the extreme resistance it confers, its presence in many common pathogens, its rapid spread to multiple continents, and local nosocomial spread in some areas. Most early reports of infections were in individuals who had received medical care in the Indian subcontinent.1 The first variant of NDM-1 -NDM-2 - was detected in Acinetobacter baumannii from Egypt.2 The acquisition of NDM-1 by two clinical isolates of metallo-beta-lactamase (MBL)-producing Pseudomonas aeruginosa in Egypt and the association of blaVIM-2 with the blaNDM-1 in these two isolates is reported herein.

* Corresponding author. Tel.: +20 201111112472. E-mail address: mai_zafer@hotmail.com (M.M. Zafer).

2. Case report

The two P. aeruginosa isolates were recovered from hospitalized inpatients admitted to Kasr Al Aini Hospital, Cairo University, Egypt during March 2012. The first isolate was from a wound specimen obtained from a young man (23 years old) who had suffered 30% burns and was hospitalized in the surgical ward; he spent 10 days in the hospital. The second P. aeruginosa isolate was obtained from a sputum specimen recovered from a 74-year-old man who had a history of underlying malignancy (glioma) and who had undergone a brain tumor excision. He was hospitalized in the intensive care unit; he spent 22 days in the hospital. Both patients were alive after the hospitalization period.

The isolates were confirmed by VITEK 2 (bioMerieux, Marcy l'Etoile, France) and the minimum inhibitory concentrations (MICs) of selected antimicrobials were determined by Etest (AB Biodisk, Solna, Sweden). Both strains were resistant to imipenem and meropenem. The resistance patterns of both isolates are illustrated in Table 1.

http://dx.doi.org/10.1016/j.ijid.2014.07.008

1201-9712/© 2014 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

M.M. Zafer et al. /International Journal of Infectious Diseases 29 (2014) 80-81 81

Table 1

Minimum inhibitory concentrations (Etest, mg/ml) for Pseudomonas aeruginosa clinical isolates

Antibiotic

FEP TZP CAZ CAZ/CLA CIP AMK GEN IPM CTX

CLSI resistance break point >32 >128/4 >128/2 >32 >4 >64 >4 >16 >32

Wound 64 >256 >256 >256 >32 >256 >256 >32 >256

Sputum 24 >256 >256 192 >32 >256 12 >32 >256

FEP, cefepime; TZP, piperacillin/tazobactam; CAZ, ceftazidime; CAZ/CLA, ceftazidime/clavulanic acid; CIP, ciprofloxacin; AMK, amikacin; GEN, gentamicin; IPM, imipenem; CTX, cefotaxime.

Both isolates were positive for MBL production by combined disk test. PCRs with primers specific for blaVIM-2 (AAAGTTATGCCG-CACTCACC and TGCAACTTCATGTTATGCCG)3 and blaNDM-1 (CACCT-CATGTTTGAATTCGCC and CTCTGTCACATCGAAATCGC)2 revealed amplification of a 984-bp fragment corresponding to blaNDM-1 and a fragment of 865 bp corresponding to the blaVIM-2 gene. PCRs with primers specific for blaIMP (5'-GAAGGYGTTTATGTTCATAC-3' and 5'-GTAMGTTTCAAGAGTGATGC-3'), blaSPM (5'-CTGCTTGGATT-CATGGGCGC-3' and 5'-CCTTTTCCGCGACCTTGATC-3'), blaGiM (5'-TCGACACACCTTGGTCTG-30 and 50-AACTTCCAACTTTGCCAT-30), and blasiM (5'-TACAAGGGATTCGGCATCC-3' and 5'-TAATGGCCTGTTCC-CATG-3') genes were negative.3,4

Typing by multilocus sequence typing (MLST) of the recognized chromosomal markers (seven housekeeping genes) acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE (http://pubmlst.org/paeruginosa/) showed similarity in which sequence type (ST) 233, which is a part of the internationally dominant clonal cluster CC233, was detected in the two isolates.

3. Discussion

NDM-1-producers are now alarmingly on the increase worldwide and pose a potential risk for therapeutic failure with the empirical treatments currently in place.5 The first identification of a blaNDM gene in a clinical isolate originated from Egypt, with no obvious link to the indian subcontinent.2 Prior to the detection of the NDM-1-positive P. aeruginosa strains, neither of the patients in our study had traveled to the Indian subcontinent or any European country. Thus, either these patients experienced cross-transmission with NDM-1 cases that were travel-associated (but not reported), or inappropriate and non-prescription antibiotic use might have been the cause of the development of high antimicrobial resistance.

The presence of blaVIM-2 together with blaNDM-1 in the two P. aeruginosa isolates reported in this study indicates the dissemination of blaMBL-carrying organisms in Egypt.

Typing by MLST of the two isolates revealed both to belong to ST233, indicating that health care-acquired transfer of P. aeruginosa could occur; an increased risk of cross-transmission and high antimicrobial pressure might have favored clonal spread. In addition, patients who have the potential to facilitate the dissemination of multidrug-resistant organisms between hospitals may subsequently serve as important reservoirs and transmission sources, stressing the importance of hand hygiene compliance and patient precautions.

In conclusion, this finding of NDM-l-producing P. aeruginosa and the presence of more than one blaMBL gene in carbapenem-resistant P. aeruginosa highlights the emerging therapeutic challenge. The implementation of strict antimicrobial policies and infection control programs may help to prevent the rapid dissemination of these organisms.

Conflict of interest: No conflict of interest to declare.

References

1. Wilson ME, Chen LH. NDM-1 and the role of travel in its dissemination. Curr Infect DisRep 2012;14:213-26.

2. Kaase M, Nordmann P, Wichelhaus TA, Gatermann SG, Bonnin RA, Poirel L. NDM-2 carbapenemase in Acinetobacter baumannii from Egypt. JAntimicrob Chemother 2011;66:1260-2.

3. YanJJ, Hsueh PR, Ko WC, Luh KT, Tsai SH, Wu HM, et al. Metallo-ß-lactamases in clinical pseudomonas isolates in Taiwan and identification of VIM-3, a novel variant of the VIM-2 enzyme. Antimicrob Agents Chemother 2001;45:2224-8.

4. Ellington M, Kistler J, Livermore D, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-ß-lactamases. J Antimicrob Chemother 2007;59:321-2.

5. Mulvey MR, Grant JM, Plewes K, Roscoe D, Boyd DA. New Delhi metallo-ß-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada. Emerg Infect Dis 2011;17:103-6.