Scholarly article on topic 'Population dynamics of nitrifying bacteria for nitritation achieved in Johannesburg (JHB) process treating municipal wastewater'

Population dynamics of nitrifying bacteria for nitritation achieved in Johannesburg (JHB) process treating municipal wastewater Academic research paper on "Biological sciences"

CC BY-NC-ND
0
0
Share paper
Academic journal
Bioresource Technology
OECD Field of science
Keywords
{"Nitrite oxidizing bacteria (NOB)" / "Ammonia oxidizing bacteria (AOB)" / Nitritation / "Municipal wastewater" / "Johannesburg (JHB) process"}

Abstract of research paper on Biological sciences, author of scientific article — Wei Zeng, Xinlong Bai, Limin Zhang, Anqi Wang, Yongzhen Peng

Abstract Population dynamic of nitrifying bacteria was investigated for nitrogen removal from municipal wastewater. Nitritation was established with nitrite accumulation ratios above 85%. Quantitative PCR indicated that Nitrospira was dominant nitrite oxidizing bacteria (NOB) and Nitrobacter was few. During nitritation achieving, Nitrobacter was firstly eliminated, along with inhibition of Nitrospira bioactivities, then Nitrospira percentage declined and was finally washed out. Nitritation establishment depended on inhibiting and eliminating of NOB rather than ammonia oxidizing bacteria (AOB) enriching. This is the first study where population dynamics of Nitrobacter and Nitrospira were investigated to reveal mechanism of nitritation in a continuous-flow process. Phylogenetic analysis of AOB indicated that Nitrosomonas-like cluster and Nitrosomonas oligotropha were dominant AOB, accounting for 81.6% of amoA gene clone library. Community structure of AOB was similar to that of complete nitrification system with long hydraulic retention time, but different from that of nitritation reactor with low DO concentration.

Academic research paper on topic "Population dynamics of nitrifying bacteria for nitritation achieved in Johannesburg (JHB) process treating municipal wastewater"

ELSEVIER

Contents lists available at ScienceDirect

Bioresource Technology

journal homepage: www.elsevier.com/locate/biortech

Population dynamics of nitrifying bacteria for nitritation achieved in Johannesburg (JHB) process treating municipal wastewater

Wei Zeng *, Xinlong Bai, Limin Zhang, Anqi Wang, Yongzhen Peng

Key Laboratory of Beijing for Water Environment Recovery, Department of Environmental Engineering, Beijing University of Technology, Beijing 100124, China

HIGHLIGHTS

• Mechanism of nitritation startup in a continuous flow process was revealed.

• During nitritation establishing, Nitrobacter prior to Nitrospira was eliminated.

• Nitritation achieving depended on inhibiting and eliminating of NOB.

• Nitrosomona-like cluster and Nitrosomonas oligotropha were the dominant AOB,

• Control of aerobic hydraulic retention time did not change AOB communities.

ABSTRACT

Population dynamic of nitrifying bacteria was investigated for nitrogen removal from municipal wastewater. Nitritation was established with nitrite accumulation ratios above 85%. Quantitative PCR indicated that Nitrospira was dominant nitrite oxidizing bacteria (NOB) and Nitrobacter was few. During nitritation achieving, Nitrobacter was firstly eliminated, along with inhibition of Nitrospira bioactivities, then Nitrospira percentage declined and was finally washed out. Nitritation establishment depended on inhibiting and eliminating of NOB rather than ammonia oxidizing bacteria (AOB) enriching. This is the first study where population dynamics of Nitrobacter and Nitrospira were investigated to reveal mechanism of nit-ritation in a continuous-flow process. Phylogenetic analysis of AOB indicated that Nitrosomonas-like cluster and Nitrosomonas oligotropha were dominant AOB, accounting for 81.6% of amoA gene clone library. Community structure of AOB was similar to that of complete nitrification system with long hydraulic retention time, but different from that of nitritation reactor with low DO concentration. © 2014 The Authors. Published by Elsevier Ltd. This is an open access article under the CCBY-NC-ND license

(http://creativecommons.org/licenses/by-nc-nd/3.0/).

CrossMark

ARTICLE INFO

Article history:

Received 10 February 2014

Received in revised form 18 March 2014

Accepted 20 March 2014

Available online 29 March 2014

Keywords:

Nitrite oxidizing bacteria (NOB) Ammonia oxidizing bacteria (AOB) Nitritation

Municipal wastewater Johannesburg (JHB) process

1. Introduction

Traditional biological nitrogen removal (BNR) is accomplished by a two-stage treatment, i.e. nitrification and denitrification. In the first stage, ammonia is oxidized to nitrite by ammonia oxidizing bacteria (AOB), and then to nitrate by nitrite oxidizing bacteria (NOB). Thereafter, nitrate is reduced to nitrite, and then to nitrogen gas (N2) in the second anoxic denitrification stage (Zhu et al., 2008). Nitrite is an intermediate in two stages. If ammonia is oxidized to nitrite (nitritation), and then directly reduced to N2 gas (denitritation), the process will be largely shortened. Compared with traditional BNR, aeration costs can be reduced by 25% and demand of carbon source is decreased by

* Corresponding author. Address: Department of Environmental Engineering, Beijing University of Technology, Pingleyuan No. 100, Chaoyang District, Beijing 100124, China. Tel.: +86 10 67391918; fax: +86 10 67392627. E-mail address: zengwei_1@263.net (W. Zeng).

40% in nitritation/denitritation (Sun et al., 2010). For the treatment of carbon-limited municipal wastewater, nitritation/denitritation is particularly advantageous.

Based on the mechanism of nitritation/denitritation, the key to achieve nitritation is to control ammonia oxidizing to nitrite, namely nitrite oxidizing to nitrate is eliminated. From a microbiological point of view, NOB has to be inhibited or eliminated while AOB plays an important role to cause nitrite build-up. Previous studies found that several factors affecting the metabolic activity and growth rate of AOB and NOB, such as high free ammonia (FA) and free nitrous acid (FNA) concentration (Park et al., 2010), pH value (He et al., 2012), temperature (Tao et al., 2012), sludge retention time (SRT) (Hellinga et al., 1998), hydraulic retention time (HRT) (Zeng et al., 2010), dissolved oxygen (DO) (Blackburne et al., 2008; Guo et al., 2009) and inhibitor (Mosquera-Corral et al., 2005). The above selection factors can be used to inhibit or eliminate NOB.

http://dx.doi.org/10.1016/j.biortech.2014.03.102 0960-8524/© 2014 The Authors. Published by Elsevier Ltd.

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

Studies about nitritation/denitritation mainly focused on synthetic or industrial wastewater, such as high temperature wastewater and high nitrogen loaded wastewater. Temperature and FA are used as selection factors to achieve nitritation (Ganigue et al., 2012; Li et al., 2011; Wang et al., 2011). However, FA, FNA, pH value, temperature and inhibitor in municipal wastewater can hardly reach inhibitory level to NOB. Very limited studies on achieving nitritation in the treatment of municipal wastewater primarily focused on sequencing batch reactor (SBR). At sufficient oxygen supply (DO > 2 mg/L), aeration duration was usually controlled to eliminate NOB from SBR process (Fux et al., 2006; Ganigue et al., 2012; Zeng et al., 2009). Continuous-flow process is most commonly applied to treat municipal wastewater. The operational method for continuous-flow process is very limited, and different from SBR process (Wang et al., 2007). Nitritation was achieved in A2/O and MUCT continuous-flow processes treating municipal wastewater through controlling low DO concentration (0.5 mg/L) and short HRT (6 h) to inhibit NOB (Zeng et al., 2010, 2013). However, the metabolic activity of AOB was inhibited at low DO concentration, and thus ammonia oxidizing rate and removal efficiency dramatically dropped. When DO concentration was up to 1.0 mg/L, nitritation quickly broke down. The above results demonstrated that achieving nitritation and steady nitrogen removal was difficult in a continuous-flow process treating municipal wastewater. The reason may be that the correlation of nitrifying bacteria (AOB and NOB) with process operation is not clear. The DO concentration and HRT are the main operational parameters in a continuous-flow process. Therefore, it is necessary to investigate the population dynamics of nitrifying bacteria at different DO and HRT to reveal the mechanism of nitritation, and set up an effective control strategy.

Presently, real-time quantitative polymerase chain reaction (QPCR) has become a popular method to quantify the abundance of functional bacteria in biological wastewater treatment (Harms et al., 2003). Application of QPCR in nitritation/denitritation was mainly related to quantification of AOB (Wang et al., 2012; Yapsakli et al., 2011), and very limited studies regarding quantification of NOB. However, the key to achieve nitritation is to inhibit or eliminate NOB. The NOB washed out of system is usually demonstrated through a fact that nitrite accumulation ratio (NAR) reaches a high level (>80%). Such indirect inference is not rigorous enough since it cannot distinguish between NOB inhibited and eliminated. The two situations will lead to different operational results. If the metabolic activity of NOB is just inhibited, nitritation will be unstable and even be destroyed when the conditions favor NOB growth. If NOB is washed out of system, nitritation will be stably performed and not be influenced by the short-term change of operational conditions. There is no report regarding the population

dynamics of NOB during nitritation establishing. Due to lack of NOB detection in biological wastewater treatment, the correlation of community structure and population dynamics of NOB with operational conditions is not revealed. Therefore, the mechanism of nitritation cannot be clearly explained.

This study aims to (1) set up an effective method to achieve nit-ritation quickly in Johannesburg QHB) process treating municipal wastewater at normal DO level, (2) investigate the correlation of population dynamics of AOB and NOB with operational conditions to reveal the mechanism of nitritation startup and (3) analyze the reasons causing the removal of ammonia and total nitrogen unstable during nitritation performance from a microbiological viewpoint.

2. Methods

2.1. Experimental set-up and operation

Fig. 1 shows the experimental system consisting of a Johannesburg (JHB) reactor with a working volume of 71 L and a secondary settler of 24 L. The JHB reactor was divided into seven chambers. The first chamber was a pre-anoxic zone for denitrification of returned sludge (external recycle, R1) from secondary settler and for one-third of influent. The second chamber provided an anaerobic zone for phosphorus release and for two-thirds of influent. Therefore, organic matter in raw wastewater could be used as the carbon sources for denitrification and phosphorus release. The third and fourth chambers were anoxic zones for denitrifica-tion of nitrite/nitrate recirculation (internal recycle, R2) from the last aerobic chamber. The last three chambers were aerobic zones for ammonia oxidation. The volume ratio of the pre-anoxic to anaerobic to anoxic to aerobic zone was 1.0:1.9:3.4:4.0. The flow rates of two feedings, returned sludge and nitrate recirculation were controlled by peristaltic pumps. Anaerobic zone was equipped with an ORP meter and each aerobic chamber was equipped with one DO probe. The air flow meter controlled the aeration rate to achieve the desired DO concentration. Temperature in the reactor was maintained at 25 ± 1 °C using a heater and thermostat. The sludge retention time (SRT) was controlled at 20 days by discharging an appropriate amount of settled sludge. The mixed liquor suspended solid (MLSS) concentration was about 3500 ± 500 mg/L.

2.2. Wastewater and sludge

The seed sludge was taken from a municipal wastewater treatment plant with a typical anoxic-aerobic process in Beijing.

Fig. 1. Schematic diagram of JHB process (1. raw wastewater tank; 2. pre-anoxic zone; 3. anaerobic zone; 4. anoxic zone; 5. aerobic zone; 6. settler; 7. air pump; 8. mixer; 9. internal recycle; 10. external recycle; 11. influent; 12. pump; 13. airflow meter; 14. DO and ORT meter).

Table 1

Characteristics of the raw wastewater.

Contents Range Average

COD (mg/L) 84.6-267.6 168.1

NH4-N (mg/L) 49.7-103.1 71.8

NO3-N (mg/L) 0-0.10 0.01

NO3-N (mg/L) 0.06-1.3 0.57

TN (mg/L) 49.7-103.4 72.6

C/N 0.86-3.38 2.33

pH 7.13-7.42 7.31

aerobic AHRT =

anoxic AHRT =

Q (1 + R + R2)

Q (1 + Ri + R2)

where c(NO;T-N) and c(NOir-N) is the concentration of NO^-N and NO3-N in effluent of the last aerobic zone, respectively; VO and VA is the volume of aerobic and anoxic zone, respectively; Q is the flow rate of influent; R1 and R2 is the external and internal recycle ratio, respectively.

This plant performs traditional nitrification-denitrification without nitrite accumulating. Raw wastewater from a campus sewer line was pumped into a storing tank for sedimentation, and then fed into the reactor. The characteristics of raw wastewater are given in Table 1. The average influent COD to nitrogen ratio (C/N) was only about 2.33, and thus the organic carbon source was typically limiting.

2.3. Experimental procedure

The JHB system had been operated for 120 days including 6 successive phases. The internal and external recycle ratio was 200% and 60%, respectively. The influent flow rate was controlled at 8.10 L/h, and resultant HRT was 8.74 h. The anoxic HRT and anoxic actual HRT (AHRT) were 2.91 h and 0.81 h, respectively. The aerobic HRT and aerobic AHRT were 3.41 h and 0.95 h, respectively. The DO concentration was separately controlled at 2.0, 1.5, 1.0, 1.25, 1.4 and 1.6 mg/L in phase I-VI. The experimental purpose of phase I (1-20 d) was to investigate if nitritation could be started up by control of short aerobic HRT (0.95 h) only at DO concentration of 2.0 mg/L. Phases II—III (21-60 d) aimed to investigate the effect of DO concentration dropping on the population of AOB and NOB. The DO concentration was recovered to previous level in phases IV-VI to investigate its influence on nitritation and the population of nitrifying bacteria.

2.4. Analytical methods

Chemical oxygen demand (COD), ammonia (NH4-N), nitrate (NOJ-N), nitrite (NO^-N), sludge volume index (sVI), MLSS and mixed liquor volatile suspended solid (MLVSS) were measured according to the APHA Standard methods (1998). Total nitrogen (TN) was measured with a TN analyzer (Jena Multi N/C3000, Germany). DO concentrations and pH values were measured online using DO/pH meters (WTW Multi 340i, Germany).

The nitrite accumulation ratio (NAR), aerobic AHRT and anoxic AHRT were calculated according to the following formulas:

nitrite accumulation rate (NAR) =

Table 2

Primers and PCR programs.

c(NOj-N)

c(NO;T-N)+c(NO3-N)

2.5. Real-time quantitative PCR (QPCR)

Sludge samples were collected from the last chamber of aerobic zone on days 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110 and 120. MLVSS concentrations were determined on the day of sampling. Genomic DNA of sludge sample was extracted using Fast DNA SPIN kits for soil (Bio 101, Vista, CA, USA). The oligonucleotide sequences of the primers and PCR programs are shown in Table 2. PCR reaction mixture with a final volume of 25 il for amplification of AOB amoA gene, NOB and bacteria 16S rDNA contained 1 il DNA template, 12.5 il GoTaq Green Master Mix (2-fold) (Promega Go-Taq Green Master Mix, USA), 1 il upstream primer (10 mM), 1 il of downstream primer (10 mM), and 9.5 il of nuclease-free water. The purified PCR products were connected to QIAGEN pDrive Cloning Vector (QIAGEN PCR Cloning Kit, QIAGEN, Germany), and then was added into competent cells DH5a (TIANGEN, China) for transformation. Positive clones were identified by blue-white screening. The plasmid in the positive clone was extracted and purified using TaKaRa plasmid purification Kit (TaKaRa, Japan), and the concentration was measured with a spectrophotometer. Copy numbers were calculated based on mass concentration and average molecular weight of the plasmid. Ten-fold serial dilutions of plasmid of known copy number were used as standard DNA. QPCR mixture for AOB amoA gene, Nitrospira, Nitrobacter and bacteria 16S rDNA was prepared in a total volume of 25 il using the TaKaRa SYBR Pre-mix Ex Taq kit, containing 12.5 il 2-fold SYBR Premix Ex Taq buffer, 1 il forward primer (10 mM), 1 il reverse primer (10 mM), 0.5 il ROX Reference Dye II (50-fold), 2 il standard DNA template and 8 il Nuclease-Free water. QPCR programs for AOB amoA gene, Nitrospira, Nitrobacter and bacteria 16S rDNA were same as the PCR programs shown in Table 2.

2.6. amoA gene clone library construction and phylogenetic analysis

Genomic DNA was extracted from the sample on day 20. The PCR amplification and cloning were carried out as described above. The positive clones were sequences, and these sequences were grouped into different operational taxonomic units (OTUs) based on 3% distance cut-off with Mothur software (Schloss et al., 2009). The obtained sequences and the reference sequences were

Target Primer Sequence (5'-3') Amplication size (bp) PCR program References

AOB amoA amoA-1F GGGGTTTCTACTGGTGGT 491 15 min at 95 "C; 45 cycles of 1 min at 95 "C, 1 min at Rotthauwe et al. (1997) and Sims

gene 54 "C and 1 min at 72 "C and Hu (2013)

amoA-2R CCCCTCKGSAAAGCCTTCTTC

Nitrobacter Nb1000F TGCGACCGGTCATGG 394 10 min at 95 "C; 35 cycles of 1 min at 95 "C, 1 min at Wang et al. (2012)

16S rDNA 1387R GGGCGGWGTGTACAAGGC 62 "C and 2 min at 72 "C

Nitrospira 16S NSR1113F CCTGCTTTCAGTTGCTACCG 165 10 min at 95 "C; 35 cycles of 1 min at 95 "C, 1 min at Wang et al. (2012) and Yapsakli

rDNA NSR1264R GTTTGCAGCGCTTTGTACCG 60 "C and 2 min at 72 "C et al. (2011)

Bacterial 16S 1055F ATGGCTGTCGTCAGCT 323 10 min at 95 "C; 45 cycles of 30 s at 95 "C, 1 min at Ferris et al. (1996)

rDNA 1392R ACGGGCGGTGTGTAC 50 "C and 20 s at 72 "C

i ff"^ ».IA» * iM^f-A. J !

40 60 80

Time (day)

Fig. 2. Variations of nitrite accumulation ratio during experimental period.

aligned with MEGA software to generate the neighbor-joining (NJ) phylogenetic tree based on Jukes-Cantor corrected distances. Bootstrap value (1000 replicates) was set to estimate the reliability of phylogenetic reconstruction.

2.7. Nucleotide sequence accession numbers

The sequences determined in this study are available in GenBank under accession number of KF971285 to KF971322.

3. Results and discussion

3.1. Achievement of nitritation and nitrogen removal in JHB process

Fig. 2 shows the nitrite accumulation ratios, NO3-N and NO3-N concentrations in effluent of the last aerobic zone. The TN and ammonia removal throughout the experimental period is given in Fig. 3.

As shown in Fig. 2, phase I was rising stage of nitrite accumulation ratios. Period of initial 10 days was a stage for sludge acclimation. In the following 10-20 days, nitrite concentration in aerobic zone and NAR quickly rose, and reached 22 mg/L and 70% at the end of phase I, respectively. Rapid rising of NAR was possibly caused by short HRT. The HRT of aerobic zone was only 3.41 h, shorter than that in the wastewater treatment plant where the seed sludge was withdrawn. Short HRT influenced NOB to oxidize nitrite to nitrate. At the end of phase I, the concentration of ammonia in effluent was almost zero (Fig. 3), indicating that oxygen supply (DO = 2.0 mg/L) was enough for AOB to oxidize ammonia to nitrite in spite of a short HRT. However, average TN removal efficiency was only 50% (Fig. 3). The anoxic AHRT was only 0.81 h, which was not long enough to reduce nitrite to nitrogen gas completely. And thus a low TN removal was observed.

Based on the operation of phase I, phase II aimed to improve NAR and TN removal further. Short aerobic HRT was still maintained in phase II, leading to oxidation of nitrite to nitrate continuously inhibited. In this phase, NAR increased to 80%

90 80 70 60 50 40 30 20 10

Fig. 3. NH4-N and TN removal during experimental period.

(Fig. 2). Compared with the traditional complete nitrification, in nitritation the HRT can be shortened and the oxygen demand can be decreased by 25%. Therefore, DO concentration was reduced to 1.5 mg/L (decreased by 25%) in phase II. The concentration of ammonia in effluent was still zero (Fig. 3), suggesting that the oxygen supply (DO = 2.0 mg/L) in phase I was excessive. In this phase, TN removal was gradually improved and up to 70% (Fig. 3), which was possibly resulted from the following two reasons. Firstly, the amount of DO through nitrification liquid recycling into the anoxic zone was decreased due to the decline of DO concentration in the aerobic zone, ensuring a perfectly anoxic environment. Furthermore, performance of denitritation in the anoxic zone reduced the demand of carbon source.

In phase III DO concentration was further reduced to 1.0 mg/L. The NAR rose to 94% and nitrate concentration in aerobic zone was almost zero, indicating a good nitritation (Fig. 2). According to formula (1), NAR is nearly 100% and not influenced by the change of nitrite concentration when nitrate concentration is almost zero. However, nitrite concentration in aerobic zone was as low as 6 mg/L. This observation suggested that low DO concentration inhibited the metabolic activities of AOB, leading to incomplete oxidation of ammonia to nitrite. The effluent ammonia concentration was above 40 mg/L, and the removal efficiencies of ammonia and TN significantly descended (Fig. 3). Therefore, although short HRT and low DO concentration could maintain a high NAR level, the removal of ammonia and TN could not be ensured. That is not suitable to evaluate nitritation only by NAR.

Low DO operation resulted in poor performance of ammonia oxidation. To improve the ammonia removal, DO concentration was increased to 1.25 mg/L, 1.4 mg/L and 1.6 mg/L in phase IV-VI, respectively. However, the effluent ammonia concentration still reached 30 mg/L regardless of NAR maintaining at over 80%. The reason may be that low DO concentration and short HRT in previous phase inhibited AOB, leading to decrease of the numbers of AOB population. Thereafter, AOB could not be dominated by raising DO concentration only. That should be further demonstrated by detecting the dynamics of AOB population.

The above results suggested that nitritation could be rapidly established (10-20 d) through short HRT and normal DO level (1.5-2.0 mg/L) in JHB process treating municipal wastewater.

Meanwhile a good performance of ammonia and TN removal was achieved. Short HRT of aerobic zone was a key factor to inhibit nitrite oxidation completely. When DO concentration was below 1.5 mg/L, although NAR was maintained at a high level, the ammonia oxidation was inhibited due to insufficient oxygen supply. The ammonia and TN removal significantly decreased.

3.2. Population dynamics of nitrite oxidizing bacteria (NOB)

16S rDNA genes of Nitrospira and Nitrobacter affiliated with NOB, and bacteria in the JHB process were quantified using RT-PCR method throughout the experimental period. The cell numbers of NOB and bacteria, and NOB percentages were calculated based on an assumption that NOB (Nitrospira and Nitrobacter) contain 1 copy of 16S rDNA gene and bacteria contain 3.6 copies of 16S rDNA (Harms et al., 2003). The quantitative results are presented in Fig. 4. The amplification efficiencies of Nitrospira, Nitrobacter and bacteria were 100.8%, 107.2% and 114.8%, respectively, and the correlation coefficients of standard curves were higher than 0.997.

As shown in Fig. 4, the cell numbers of bacteria varied in a small range of 4.85 x 109-1.8 x 1010 cells/gVSS, maintaining relatively stable throughout the experimental period. After the seed sludge was added into JHB reactor, the abundances of Nitrobacter decreased by 95% only in 10 days, and then stabilized at a low level. Rapid decline of Nitrobacter was possibly caused by the following two reasons. Firstly, Nitrobacter prefer to exist in the form of suspended cells instead of attaching to activated sludge flocs or biofilms. And thus they are easily washed out of the reactor when the HRT is short (Koops and Pommerening-Roser, 2001). Furthermore, in the seed sludge the number of Nitrobacter was very few, and only accounted for 0.1% of bacterial communities while the percentage of Nitrospira was 24%. The number of Nitrospira was about 240 times of Nitrobacter. During operation, the numbers of Nitrospira varied in 106-109 cells/gVSS, and Nitrobacter population varied in 104-106 cells/gVSS. The quantification results indicated that Nitrospira was the dominant NOB in the municipal wastewater treatment, consistent with previous studies (Harms et al., 2003; Wang et al., 2012). The Nitrospira could out-compete Nitrobacter for nitrite competition since the percentage of Nitrobacter in the

-D •O

2E9 r(a)

, 6E6 r(b)

£ 5E6 4E6

§ 2E6

te 1E6

20 40 60 80 100 120

Time (day)

20 40 60 80 100120

Time (day)

1E11 (c) 25

1E10 ■ Jv—..............' — -—■.............'—---■— .................." . 20

—■— Total bacteria

1E9 - ' *— --- Total NOB - 15

—o— NOB % m

1E8 . \ ^^^^ - 10 o

~--• _

1E7 - 5

1E6 ..... 0

Time (day)

Fig. 4. Population dynamics of NOB in the JHB process.

activated sludge was very small. Therefore, Nitrobacter was washed out faster than Nitrospira.

A temporary and small increase in the amount of Nitrospira from 1.18 x 109 to 1.81 x 109 cells/gVSS was observed after the seed sludge was added into JHB system. Thereafter, the cell numbers of Nitrospira gradually decreased. At the end of phase I, Nitrospira were 1.29 x 109 cells/gVSS, similar to the amount in the seed sludge. Yet at this moment NAR already reached 90% (Fig. 2), and nitritation was successfully achieved. That demonstrated that nitritation establishment was resulted from inhibition on Nitrospira bioactivities rather than Nitrospira washed out of the system. During phase I, DO concentration was controlled at 2.0 mg/ L and oxygen supply was adequate, suggesting that DO was not a selection factor to achieve nitritation. Thereafter, the amount of Nitrospira continuously decreased no matter what DO concentration was. That further proved that DO had no effect on nitritation achieving. During nitritation establishment, Nitrospira bioactivities were firstly inhibited, and then washed out of system. The population dynamics of Nitrospira demonstrated that Nitrospira could be washed out of system by short HRT only and were not influenced by DO concentration in JHB process treating real municipal waste-water. As shown in Fig. 4 regarding the abundance and fractional abundance of NOB relative to the bacterial community, from day 20 the NOB proportion decreased to below 10% and from day 50 it dropped to below 1%. Before day 50, nitrite accumulation ratio gradually rose along with rapid decrease of NOB abundance and proportion. During day 60 to day 120, fractional abundance of NOB was only 0.1-0.8% meanwhile the average nitrite accumulation ratio was about 80-90%. The outcomes suggested that a small part of nitrite (below 10%) oxidation supported a small percentage of NOB (0.1-0.8%) surviving.

This is the first report regarding the population dynamics of Nitrobacter and Nitrospira during nitritation establishing in a continuous-flow process. Although from a viewpoint of microbial kinetics the speed of ammonia oxidation is slower than that of nitrite oxidation, nitrite oxidation always lags behind ammonia oxidation when nitrite is absent in influent. To continuous-flow anaerobic/anoxic/aerobic process (Fig. 1), nitrification liquid from the last aerobic chamber was recirculated to the first anoxic zone for denitrification. And thus there was almost no nitrite in the influent of aerobic zone. If aerobic HRT was controlled short enough, the short HRT could not ensure all nitrite to be oxidized to

nitrate, resulting in part of nitrite accumulated. Under long-term operation of short HRT, bioactivities of NOB will be inhibited and finally washed out of the reactor. That can be proved by variations of nitrite accumulation ratio (Fig. 2) and abundance and relative proportion of NOB (Fig. 4). Previous studied also suggested that control of short aerobic HRT was an effective method to achieve nitritation in anaerobic/anoxic/aerobic configuration (Wang et al., 2007; Zeng et al., 2010, 2013).

3.3. Population dynamics and phylogenetic analysis of ammonia oxidizing bacteria (AOB)

3.3.1. Population dynamics of AOB

The amoA genes of AOB were quantified using RT-PCR method throughout the experimental period. The cell numbers of AOB and bacteria, and AOB percentages were calculated based on an assumption that AOB contain 2 copies of amoA gene and bacteria contain 3.6 copies of 16S rDNA (Harms et al., 2003). Quantitative results are presented in Fig. 5. The amplification efficiency of AOB was 106.1%, and the correlation coefficient of standard curve was 0.996.

As shown in Fig. 5, the cell numbers of AOB varied in a range of 1.83 x 107-1.87 x 108 cells/gVSS. The cell numbers of AOB and bacteria in the seed sludge were 1.62 x 108 and 4.86 x 109 cells/ gVSS, respectively, and the relative abundance of AOB to bacteria was 3.33%. After the seed sludge was added into JHB system, the amount of bacteria quickly increased while the cell numbers of AOB did not, leading to decline of AOB percentage from 3.33% to 1.8% (Fig. 5). In phase I, although nitrite concentration in aerobic zone rapidly rose (Fig. 2), the cell numbers of AOB did not increase. The NAR reached 80-90% in phase II, but the amount of AOB changed little and the effluent ammonia concentration was almost zero. It indicated that although AOB only accounted for 1.8% of total bacteria, they oxidized all ammonia to nitrite. Based on the population dynamics of NOB and AOB (Figs. 4 and 5), nitritation achievement depended on inhibiting and eliminating of NOB rather than further enriching of AOB.

In phase III DO concentration was controlled at 1.0 mg/L. The abundance of AOB rapidly decreased from 1.63 x 108 cells/gVSS to 5.15 x 107 cells/gVSS. Meanwhile, the effluent ammonia concentration quickly increased (Fig. 3). The outcomes indicated that low DO concentration of 1.0 mg/L inhibited AOB bioactivities,

-D •O

ffl O <d

Time (day)

ffl 1 5o L5 c-

0.0 -1 0

Fig. 5. Population dynamics of AOB in the JHB process.

and led to gradual decline of AOB abundance. After day 60, since AOB proportion decreased to below 0.4%, the removal efficiencies of ammonia and TN kept at a low level (Figs. 3 and 5). In order to raise AOB percentage, DO concentration was increased in phase IV-VI. Yet the cell numbers of AOB maintained at the level of 107 without obvious increase after 60 days of operation. The outcomes suggested that AOB percentage in sludge could not be recovered through increasing DO concentration only when it was below 0.4%. Other operational conditions, such as increasing ammonia load and extending HRT, should be combined to raise AOB proportion.

Regarding AOB abundance, in despite of variations of NAR and DO, the cell numbers of AOB throughout the experimental period varied in a small range of 107-108 cells/gVSS (Fig. 5). Therefore, variations of NAR and DO had no obvious effects on the AOB abundance.

3.3.2. Phylogenetic analysis of AOB

AOB aomA genes were extracted from the sludge sample on day 20 with which clone library was constructed. The 41 clones were randomly picked to be sequenced, and 38 positive clones were determined. The positive clones covered 92.7% of clone library, representing the diversity of AOB in JHB reactor well. The obtained nucleotide sequences were grouped into 7 OTUs based on 97% DNA sequence identity using Mothur software (Schloss et al., 2009). The clone numbers in OTU1-OTU7 were 22, 7, 5, 1, 1, 1 and 1, respectively. Fig. 6 presents a neighbor-joining (NJ) phyloge-netic tree of aomA genes from this study and relevant sequences

from Genbank. As shown in Fig. 6, all the clones were affiliated with the genera Nitrosomonas in the Betaproteobacteria, in agreement with previous studies (Park and Noguera, 2004; Siripong and Rittmann, 2007). OTU1 and OTU7 belonged to the Nitrosomon-as-like cluster, which were the most dominant species accounting for 60.53% of the clone library. OTU2 was related to the Nitrosomonas marina with a proportion of 18.42% in the clone library. OTUs 3-6 were affiliated with the Nitrosomonas oligotropha accounting for 21.05% of the clone library.

In this study although nitritation was performed, both Nitroso-monas-like cluster and N. oligotropha as the dominant species accounted for 81.58% of the clone library, similar to the community structure of AOB in the traditionally complete nitrification system (Gao et al., 2013; Purkhold et al., 2000). Although there was no HRT variation in this study, the aerobic HRT of 3.41 h was much shorter than that in complete nitrification system (usually >6 h). Compared with the HRT in complete nitrification process, the HRT in this study was remarkably shortened. However, community structure of AOB was the same as previous studies with complete nitrification (Gao et al., 2013; Purkhold et al., 2000), that is, Nitrosomona-like cluster and N. oligotropha as the dominant species. Therefore, short HRT did not change community structure of AOB in this study, which was compared with complete nitrification system with long HRT. The outcomes suggested that the method to establish nitritation in this study had almost no effects on the community structure of AOB. Previous studies indicated that DO concentration was the most important factor influencing the diversity of AOB (Glrike et al., 2001; Park et al., 2002). In a continuous

97 I clone JHB-S02 (07U5)

-clone JHB-S03 (OTU6)

Nitrosomonas sp. clone Ab5 (GQ247377) 991 clone JHB-S05 (OTU3)

_I clone JHB-S20 (OTU4)

Nltnosomonadaceae bacterium (KC735719) Nitrosomonas sp. NL7 (AY958704) Nitrosomonas oligotropha (AF272406) Nitrosomonas sp. clone BW-L-6 (JQ345999) Nitrosomonas sp. clone BW-L-17 (JQ346009)

100 58 71

75i clone JHB-S11 (OTU2) 100 clone 0716145 2-2-1-14 (JX879871)

L clone 0618003 zhong-33 M13F (KC967935)

— Nitrosomonas marina (HM345622) - I— Nitrosomonas sp. NS20 (AB212172)

g^ii Nitrosomonas marina (HM345617) 87^- Nitrosomonas marina (HM345618)

— Nitrosomonas cryotolerans (AF272402)

tNitrosomonadaceae bacterium clone Ab1 (GQ247374) clone JHB-S15 (OUI1) ^ clone JHB-S14 (OTU7)

i- Nitrosomonas eutropha (AY177932) L Nitrosomonas sp. TK794 (AB031869) Nitrosomonas sp. LT-1 (JN367453) Nitrosomonas europaea (AF037107) Nitrosomonas sp. LT-4 (JN367456)

- Nitrosomonas sp. NM 104 (AF272415) r- Nitrosococcus oceani (AB474000)

96 L Nitrosococcus halophilus Nc4 (AF287298)

N.oligotropha

N.marina

N.cryotolerans Nitrosomonas-like

N.europaea!eutropha

Fig. 6. Neighbor-joining phylogenetic tree for AOB amoA gene sequences. Representative sequences in each OUT named clone JHB-S## in this study were contrasted with reference sequences in the GenBank with MEGA software. Bootstrap values are presented in percentages of 1000 replicates on the nodes. The scale bar represents 0.1 nucleotide substitution per nucleotide position.

flow process, controlling low DO concentration (0.5 mg/L) is commonly used to achieve nitritation, and the Nitrosomonas europaea is the dominant specie of AOB under low DO condition (Helmer et al., 1999; Park and Noguera, 2004). Furthermore, N. europaea preferentially utilize nitrite as electron acceptor (Bock et al., 1995; Kuai and Verstraete, 1998). In this study N. europaea was not found even though nitritation was achieved. The reason may be that in this study nitritation was established through controlling short HRT while the DO concentration was in a normal level (2.0 mg/L). Thus, difference of community structure of AOB in this study from other nitritation systems was mainly resulted from different DO levels.

4. Conclusion

Short aerobic HRT was a key factor to establish nitritation inJHB process treating municipal wastewater. The Nitrospira was dominant NOB and a small amount of Nitrobacter was present. During nitritation establishing, Nitrobacter prior to Nitrospira was eliminated. Along with rising of NAR, the abundance and percentage of AOB did not increase. Therefore, nitritation achieving primarily depended on inhibiting and eliminating of NOB rather than further enrichment of AOB. Community structure of AOB at nitritation and short HRT was the same as complete nitrification system with long HRT, that is, Nitrosomona-like cluster and N. oligotropha as the dominant species.

Acknowledgements

This work was financially supported by Natural Science Foundation of China (No. 51278007), Program for New Century Excellent Talents in University (No. NCET-11-0891) and the National High Technology Research and Development Program (863) of China (No. 2012AA063406).

References

APHA, 1998. Standard Methods for the Examination of Water and Wastewater, 20th ed. American Public Health Association, Washington, DC.

Blackburne, R., Yuan, Z.G., Keller, J., 2008. Partial nitrification to nitrite using low dissolved oxygen concentration as the main selection factor. Biodegradation 19 (2), 303-312.

Bock, E., Schmidt, I., Stuven, R., Zart, D., 1995. Nitrogen loss caused by denitrifying Nitrosomonas cells using ammonium or hydrogen as electron donors and nitrite as electron acceptor. Arch. Microbiol. 163,16-20.

Ferris, M.J., Muyzer, G., Ward, D.M., 1996. Denaturing gradient gel electrophoresis profiles of 16S rRNA-defined populations inhabiting a hot spring microbial mat community. Appl. Environ. Microbiol. 62 (2), 340-346.

Fux, C., Velten, S., Carozzi, V., Solley, D., Keller, J., 2006. Efficient and stable nitritation and denitritation of ammonium-rich sludge dewatering liquor using an SBR with continuous loading. Water Res. 40, 2765-2775.

Ganigue, R., Volcke, E.I.P., Puig, S., Balaguer, M.D., Colprim, J., 2012. Impact of influent characteristics on a partial nitritation SBR treating high nitrogen loaded wastewater. Bioresour. Technol. 111, 62-69.

Gao, J.F., Luo, X., Wu, G.X., Li, T., Peng, Y.Z., 2013. Abundance and diversity based on amoA genes of ammonia-oxidizing archaea and bacteria in ten wastewater treatment systems. Appl. Microbiol. Biotechnol.. http://dx.doi.org/10.1007/ s00253-013-5428-2.

Glrike, A., Purkhold, U., Wagner, M., Amann, R., Schramm, A., 2001. Community structure and activity dynamics of nitrifying bacteria in a phosphate-removing biofilm. Appl. Environ. Microbiol. 67 (3), 1351-1362.

Guo, J.H., Peng, Y.Z., Wang, S.Y., Zheng, Y.N., Huang, H.J., Wang, Z.W., 2009. Long-term effect of dissolved oxygen on partial nitrification performance and microbial community structure. Bioresour. Technol. 100 (11), 2796-2802.

Harms, G., Layton, A.C., Dionisi, H.M., Gregory, I.R., Garrett, V.M., Hawkins, S.A., Robinson, K.G., Sayler, G.S., 2003. Real-time PCR quantification of nitrifying bacteria in a municipal wastewater treatment plant. Environ. Sci. Technol. 37, 343-351.

Hellinga, C., Schellen, A.A.J.C., Mulder, J.W., Loosdrecht, M.C.M., Heijnen, J.J., 1998. The SHARON process: an innovative method for nitrogen removal from ammonium-rich wastewater. Water Sci. Technol. 37 (9), 135-142.

Helmer, C., Kunst, S., Juretschko, S., Schmid, M.C., Schleifer, K.H., Wagner, M., 1999. Nitrogen loss in a nitrifying biofilm system. Water Sci. Technol. 39 (7), 13-21.

He, Y.L., Tao, W.D., Wang, Z.Y., Shayya, W., 2012. Effects of pH and seasonal temperature variation on simultaneous partial nitrification and anammox in free-water surface wetlands. J. Environ. Manage. 110,103-109.

Koops, H.P., Pommerening-Roser, A., 2001. Distribution and ecophysiology of the nitrifying bacteria emphasizing cultured species. FEMS Microbiol. Ecol. 37,1-9.

Kuai, L.P., Verstraete, W., 1998. Ammonium removal by the oxygen-limited autotrophic nitrification-denitrification system. Appl. Environ. Microbiol. 64 (11), 4500-4506.

Li, J.P., Elliott, D., Nielsen, M., Healy, M.G., Zhan, X.M., 2011. Long-term partial nitrification in an intermittently aerated sequencing batch reactor (SBR) treating ammonium-rich wastewater under controlled oxygen-limited conditions. Biochem. Eng. J. 55, 215-222.

Mosquera-Corral, A., González, F., Campos, J.L., Mendéz, R., 2005. Partial nitrification in a SHARON reactor in the presence of salts and organic carbon compounds. Process Biochem. 40, 3109-3118.

Park, H.D., Regan, J.M., Noguera, D.R., 2002. Molecular analysis of ammonia-oxidizing bacterial populations in aerated-anoxic Orbal processes. Water Sci. Technol. 46, 273-280.

Park, H.D., Noguera, D.R., 2004. Evaluating the effect of dissolved oxygen on ammonia-oxidizing bacterial communities in activated sludge. Water Res. 38, 3275-3286.

Park, S., Bae, W., Rittmann, B.E., 2010. Operational boundaries for nitrite accumulation in nitrification based on minimum maximum substrate concentrations that include effects of oxygen limitation, pH, and free ammonia and free nitrous acid inhibition. Environ. Sci. Technol. 44, 335-342.

Purkhold, U., Pommerening-roser, A., Juretschko, S., Schmid, M.C., Koops, H.P., Wagner, M., 2000. Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: implications for molecular diversity surveys. Appl. Environ. Microbiol. 66 (12), 5368-5382.

Rotthauwe, J.H., Witzel, K.P., Liesack, W., 1997. The ammonia monooxygenase structural gene amoA as a functional marker molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 63 (12), 4704-4712.

Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B., Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B., Thallinger, G.G., Van Horn, D.J., Weber, C.F., 2009. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 75377541.

Sims, A., Hu, Z.Q., 2013. Simulated storm-water runoff treatment by duckweed and algae ponds. J. Environ. Eng. 139, 509-515.

Siripong, S., Rittmann, B.E., 2007. Diversity study of nitrifying bacteria in full-scale municipal wastewater treatment plants. Water Res. 41,1110-1120.

Sun, H.W., Yang, Q., Dong, G.R., Hou, H.X., Zhang, S.J., Yang, Y.Y., Peng, Y.Z., 2010. Achieving the nitrite pathway using FA inhibition and process control in UASB-SBR system removing nitrogen from landfill leachate. Sci. China Chem. 53 (5), 1210-1216.

Tao, W.D., He, Y.L., Wang, Z.Y., Smith, R., Shayya, W., Pei, Y.S., 2012. Effects of pH and temperature on coupling nitritation and anammox in biofilters treating dairy wastewater. Ecol. Eng. 47, 76-82.

Wang, C.C., Kumar, M., Lan, C.J., Lin, J.G., 2011. Landfill-leachate treatment by simultaneous partial nitrification, anammox and denitrification (SNAD) process. Desalination Water Treat. 32 (1-3), 4-9.

Wang, F., Liu, Y., Wang, J.H., Zhang, Y.L., Yang, H.Z., 2012. Influence of growth manner on nitrifying bacterial communities and nitrification kinetics in three lab-scale bioreactors. J. Ind. Microbiol. Biotechnol. 39, 595-604.

Wang, X.L., Ma, Y., Peng, Y.Z., Wang, S.Y., 2007. Short-cut nitrification of domestic wastewater in a pilot-scale A/O nitrogen removal plant. Bioprocess Biosyst. Eng. 30, 91-97.

Yapsakli, K., Aliyazicioglu, C., Mertoglu, B., 2011. Identification and quantitative evaluation of nitrogen-converting organisms in a full-scale leachate treatment plant. J. Environ. Manage. 92, 714-723.

Zeng, W., Zhang, Y., Li, L., Peng, Y.Z., Wang, S.Y., 2009. Control and optimization of nitrifying communities for nitritation from domestic wastewater at room temperatures. Enzyme Microbiol. Technol. 45, 226-232.

Zeng, W., Li, L., Yang, Y.Y., Wang, S.Y., Peng, Y.Z., 2010. Nitritation and denitritation of domestic wastewater using a continuous anaerobic-anoxic-aerobic (A2O) process at ambient temperatures. Bioresour. Technol. 101, 8074-8082.

Zeng, W., Wang, X.D., Li, B.X., Bai, X.L., Peng, Y.Z., 2013. Nitritation and denitrifying phosphorus removal via nitrite pathway from domestic wastewater in a continuous MUCT process. Bioresour. Technol. 143, 187-195.

Zhu, G.B., Peng, Y.Z., Li, B.K., Guo, J.H., Yang, Q., Wang, S.Y., 2008. Biological removal of nitrogen from wastewater. Rev. Environ. Contam. Toxicol. 192, 159-195.