Scholarly article on topic 'Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy'

Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy Academic research paper on "Animal and dairy science"

CC BY-NC-ND
0
0
Share paper
OECD Field of science
Keywords
{" Escherichia coli " / STEC / Pig / Stx2e / PCR}

Abstract of research paper on Animal and dairy science, author of scientific article — Laura Ercoli, Silvana Farneti, Alessia Zicavo, Guerriero Mencaroni, Giuliana Blasi, et al.

Abstract In total 1095 samples from 675 pork products, 210 swine colon contents, and 210 swine carcass sponge swabs were collected in Umbria and Marche regions of Italy and examined for the presence of Shiga toxin-producing Escherichia coli (STEC), also known as Verotoxin-producing E. coli (VTEC). After an enrichment step, each sample was analysed by real-time PCR to detect the stx1, stx2, and eae genes. stx-Positive samples were further tested for the “top five” serogroup markers (O157, O26, O103, O111, O145) and cultured onto selective media. The isolates were assigned to stx subtypes and tested for the presence of aaiC and aggR genes. Out of 420 swine samples, 38.6% faecal samples and 13.8% carcass sponge swabs were stx-positive. In total, 33 E. coli STEC isolates were obtained from 30 samples (4 carcasses and 26 colon contents) indicating a culture-positive rate of 7.1%. A higher culture-positive rate was observed in faecal samples (12.4%) than in carcass sponge swabs (1.9%). Out of 675 pork samples, 19 (2.8%) were stx-positive. No STEC strains were isolated from stx-positive pork products. We concluded that STEC isolation from foodstuffs remains difficult, despite the application of ISO/TS 13136:2012. Furthermore, in accordance with the results of studies conducted in other countries, we observed that most of swine STEC strains carried stx 2e gene and lacked of virulence genes, such as eae, aaiC and aggR, indicative of potential pathogenic characteristics for humans. Although the majority of STEC isolates did not express virulence factors correlating with severe human diseases, the association between swine STEC strains and human illness requires further investigations.

Academic research paper on topic "Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy"

INTERNATIONAL

JOURNAL OF FOOD

Microbiology

Accepted Manuscript

Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy

Laura Ercoli, Silvana Farneti, Alessia Zicavo, Giuliana Blasi, Gianluca Striano, Stefania Scuota

Guerriero Mencaroni,

PII: S0168-1605(16)30212-4

DOI: doi: 10.1016/j.ijfoodmicro.2016.05.002

Reference: FOOD 7218

To appear in:

International Journal of Food Microbiology

Received date: Revised date: Accepted date:

23 February 2016

4 May 2016

5 May 2016

Please cite this article as: Ercoli, Laura, Farneti, Silvana, Zicavo, Alessia, Mencaroni, Guerriero, Blasi, Giuliana, Striano, Gianluca, Scuota, Stefania, Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy, International Journal of Food Microbiology (2016), doi: 10.1016/j.ijfoodmicro.2016.05.002

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Prevalence and characteristics of verotoxigenic Escherichia coli strains isolated from pigs and pork products in Umbria and Marche regions of Italy.

Laura Ercoli, Silvana Farneti, Alessia Zicavo, Guerriero Mencaroni, Giuliana Blasi, Gianluca Striano, Stefania Scuota*

Istituto Zooprofilattico Sperimentale dell'Umbria e delle Marche, via G. Salvemini n.1, 06126 Perugia, Italy

* Corresponding author. Istituto Zooprofilattico Sperimentale dell'Umbria e delle Marche, via G. Salvemini n.1, 06126 Perugia, Italy. Tel.: +39 075 585 269; fax: +39 075 343 3060. E-mail address: s.scuota@izsum.it

Abstract

In total 1,095 samples from 675 pork products, 210 swine colon contents, and 210 swine carcass sponge swabs were collected in Umbria and Marche regions of Italy and examined for the presence of Shiga toxin-producing Escherichia coli (STEC), also known as Verotoxin-producing E. coli (VTEC). After an enrichment step, each sample was analysed by real-time PCR to detect the stx1, stx2, and eae genes. stx-positive samples were further tested for the "top five" serogroup markers (O157, O26, 0103, O111, O145) and cultured onto selective media. The isolates were assigned to stx subtypes and tested for the presence of aaiC and aggR genes. Out of 420 swine samples, 38.6% faecal samples and 13.8% carcass sponge swabs were stx-positive. In total, 33 E. coli STEC isolates were obtained from 30 samples (4 carcasses and 26 colon contents) indicating a culture-positive rate of 7.1%. A higher culture-positive rate was observed in faecal samples (12.4%) than in carcass sponge swabs (1.9%). Out of 675 pork samples, 19 (2.8%) were stx-positive. No STEC strains were isolated from stx-positive pork products. We concluded that STEC isolation from foodstuffs remains difficult, despite the application of ISO/TS 13136:2012. Furthermore, in accordance with the results of studies conducted in other countries, we observed that most of swine STEC strains carried stx2e gene and lacked of virulence genes, such as eae, aaiC and aggR, indicative of potential pathogenic characteristics for humans. Although the majority of STEC isolates did not express virulence factors correlating with severe human diseases, the association between swine STEC strains and human illness requires further investigations.

Keywords: Escherichia coli; STEC; Pig; Stx2e; PCR

Conflict of interest: the authors declare no potential conflict of interest.

1. Introduction

Escherichia coli is a gram-negative microorganism usually found as a commensal in the gastrointestinal tract of many animal species. However, Shiga toxin-producing Escherichia coli (STEC) can cause severe human diseases, such as haemorrhagic colitis (HC) and haemolytic-uraemic syndrome (HUS), due to the production of cytotoxins known as Verotoxins or Shiga toxins (Stx1 and Stx2). Shiga toxins are encoded by the stxl and stx2 genes generally carried by prophages. Several variants of both Shiga toxins have been identified: Stx1 subtypes are designated as Stx1a, Stx1c, and Stx1d, whereas Stx2 comprises seven variants referred to, in alphabetical order, as Stx2a-Stx2g (Scheutz et al., 2012). STEC strains can express a combination of one or more stx subtypes (Karve and Weiss, 2014). However, epidemiological studies showed that strains producing Stx2a and Stx2c tend to be more frequently isolated from patients with HUS than those expressing other Stx variants (Caprioli et al., 2005). Many STEC strains that are highly pathogenic to humans and included in the subset of enterohaemorrhagic E. coli (EHEC), are often characterised by the production of an outer membrane protein called intimin. This protein mediates the attachment of bacteria to enterocytes and induces cytoskeletal changes accompanied by the accumulation of actin and causing characteristic histopathological lesions defined as "attaching and effacing" (A/E). The intimin-encoding gene (eae), which belongs to a large pathogenicity island (PAI) called Locus of Enterocyte Effacement (LEE), is an important virulence factor. However, eae-negative strains, such as O91:H21, O113:H21 and, more recently, O104:H4, have been associated with serious diseases, indicating the importance of other virulence factors in the pathogenesis of clinical symptoms (Bouvet et al., 2001; Bouvet et al., 2002a). Such factors located on mobile genetic elements, like PAI or plasmids, have been identified. Nevertheless, in some cases, their role in the pathogenic process has not been fully elucidated (Caprioli et al., 2005). Furthermore, different E. coli strains may belong to more than one pathotype group owing to the expression of different virulence factors. For example, E. coli O104:H4, involved in Germany's

outbreak in 2011, was positive for stx2 and also carried aaiC and aggR virulence genes, which are typical of enteroaggregative E. coli (EAEC) (Frank et al., 2011).

STEC outbreaks are a serious public health concern owing to their association with severe clinical symptoms (Shen et al., 2015). However, STEC-induced infections are relatively uncommon compared to other foodborne diseases (Caprioli et al., 2005; EFSA and ECDC, 2015). In 2014, 5,955 confirmed cases of STEC infections were reported in the EU by the European Food Safety Authority (EFSA) with a notification rate of 1.56 cases per 100,000 individuals, which was 1.9% lower than the notification rate in 2013. The EU notification rate in the 2 years following the large outbreak in 2011 was higher than before the outbreak and remained so in 2014. This is possibly an effect of increased awareness and of more laboratories testing also for other serogroups than O157. Nevertheless, the most commonly reported serogroup in 2014 was O157 followed by O26 (EFSA and ECDC, 2015).

STEC strains are zoonotic agents that can be transmitted to humans through person-to-person contact, ingestion of food or water contaminated with animal faeces, and by direct contact with animals (Caprioli et al., 2005; Smith et al., 2014). Although STEC strains have been frequently isolated from the intestinal content of a wide range of animal species, ruminants, especially cattle, are recognised as the main natural STEC reservoir. Unlike cattle, that typically do not exhibit any STEC-associated symptoms (Tseng et al., 2014a), swine may present with clinical manifestations due to STEC infections (Tseng et al., 2014b). Oedema disease, an infectious illness that often affects post-weaning piglets and young finishing-age pigs, is caused by E. coli strains expressing the stx2e gene, encoding Stx2e. Cross-sectional epidemiological studies conducted in several countries showed that STEC prevalence in clinically healthy swine ranged from 0% to 68.3% (Tseng et al., 2014b). Only in rare cases, pork consumption is associated with severe clinical symptoms caused by highly pathogenic STEC strains. Moreover, in such cases it is usually unknown whether the contamination of food products occurred during pork processing or via cross-

contamination from foodstuffs of different origin. The expression of the stx2e gene has rarely been reported in STEC strains that cause HUS (Fratamico et al., 2004). Moreover, Stx2e-producing STEC strains isolated from humans and pigs had different serogroups, distinct virulence profiles, and dissimilar parameters of interaction with intestinal epithelial cells. Typical swine pathogenic E. coli strains generally express Stx2e and usually belong to a limited number of serogroups (O8, O108, O138, O139, O141,O147, and O149), which differ from those commonly associated with stx2e-positive human isolates (Sonntag et al., 2005; Schierack et al.,2006). Because of the limited epidemiologic data about STEC prevalence in swine and an increasing role of non-O157 STEC in human illness, the association between swine STEC strains and human disease needs to be elucidated (Tseng et al., 2014a).

The epidemiological data on STEC prevalence in pigs and in pork products are sparse and not directly comparable among the European countries (EFSA and ECDC, 2015). In this study, 420 faecal and carcass samples were collected, in an attempt to study the prevalence of STEC carriage in healthy pigs. In addition, 675 pork samples were collected from the main processing plants in Umbria and Marche regions of Italy. Since in this area pork meat is the basic ingredient of a large amount of typical food products, the prevalence of STEC in pigs and pork products is of particular interest.

2. Material and methods

2.1. Study design and sampling

In the period from March 2013 to March 2014, 420 swine specimens collected during the

slaughter process were analysed for the presence of STEC. In particular, 210 colon-content

specimens and 210 carcass sponge swabs were collected during 21 sampling days from 210

randomly selected pigs. Swine samples were obtained from eleven different facilities in Umbria and

Marche regions of Italy in numbers roughly proportional to the slaughter capacity of each abattoir. In order to obtain a statistically significant sample size, the number of tested animals was calculated based on the number of annually slaughtered pigs and on STEC prevalence rates reported in literature (5% prevalence, 3% standard error and 95% confidence level) (EFSA and ECDC, 2012; Caprioli et al., 1993). Faeces were sampled directly from the colon of each animal after evisceration. Carcass samples were collected with sterile pre-moistened sponges rubbed over the half-carcass surface, before chilling. Samples were transported to the laboratory in thermal boxes, stored at 4±1 °C and processed within 24 h.

In the period from May 2012 to March 2014, 675 pork samples, which included fresh meat and dried pork products, were tested for the presence of STEC. The sampling procedure was performed according to regional food safety monitoring plans. In total, 135 food specimens, each consisting of 5 sample units, were collected directly from processing plants.

2.2. Bacterial culture and DNA extraction

Carcass sponge swabs were suspended in 90 mL of Buffered Peptone Water (BPW; Oxoid, Basingstoke, UK) After incubation at 37±1°C for 16-22 h, DNA was extracted from 300 of broth using the boiling method. The broths were heated at 100°C for 5 min and then cooled in ice for 5 min. After centrifugation at 13,000 xg for 5 min, the supernatant (200 ^L) was collected and used as template for PCR assays.

For faecal sample analysis, 5 g of colon content from each animal were incubated in 45 mL of modified Tryptone-Soy Broth (mTSB; Oxoid) at 37°C±1 for 16-22 h. DNA was extracted from 1 mL of broth culture using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany).

Pork products were analysed in accordance to ISO/TS 13136:2012(E). Briefly, 25 g of each

sample was suspended in 225 mL of mTSB supplemented with 16 mg/L of novobiocin (mTSB+N)

and incubated at 37°C±1 for 18-24 h. DNA was extracted from 1 mL of each enrichment broth specimen using the DNeasy Blood and Tissue kit (Qiagen) according to the manufacturer's instructions for gram-negative bacteria.

2.3. PCR screening, isolation and characterization of STEC

The real-time PCR assay targeting the virulence genes eae, stx1, and stx2 was performed by

using primers and probes described in ISO/TS 13136:2012(E) and reported in Table 1 (Perelle et

al., 2004; Nielsen and Andersen, 2003). Real-time PCR analysis was conducted in a 25-^L reaction

volume by using the following reaction mix: 1x QuantiFast Probe PCR Master Mix (Qiagen), 25

pmol of each primer, 5 pmol of FAM-labelled probe, and 3 of the DNA template. A

commercially available Internal Positive Control (TaqMan Exogenous Internal Positive Control

Reagent-VIC probe; Thermo Fisher Scientific, Waltham, MA, US) was included in each PCR

reaction. Real-time PCR amplification was performed using a Stratagene Mx3005P system

(Agilent Technologies, Santa Clara, CA, US) with the following cycling conditions: 95°C hold for 3

min for initial denaturation of DNA and Taq polymerase activation was followed by 45 cycles of

amplification at 95°C for 3 sec and at 55°C for 30 sec. As documented in Table 2, faecal and

carcass samples, which tested positive for the presence of stx1 and/or stx2, were further examined

for the presence of E. coli O26, O103, O145, O111, and O157 serogroup-associated genes using

multiplex end-point PCR assay proposed by Monday et al. (2007). Food specimens, which tested

positive for the virulence factors during the screening step, were investigated further for the "top

five" serogroup-associated genes according to ISO/TS 13136 with primers and probes reported in

Table 1 using the amplification protocol described above. When one or both stx genes were

detected, we attempted to isolate STEC strains from the corresponding enrichment sample broths.

One loopful of the stx-positive enrichment culture was directly streaked onto the MacConkey agar,

Tryptone Bile X-Glucuronide (TBX) agar, or Sorbitol-MacConkey agar (SMAC) (Oxoid). The use

of TBX agar for isolation of STEC is recommended in ISO/TS 13136, however the choice of other media is allowed. It should be noted that in some studies an atypical colony morphology was observed on differential agar media (Rainbow® Agar O157, CHROMagar STECTM, MacConkey agar modified by Posse et al., 2008). These studies indicate that colony appearance may not provide a reliable tool to identify target STEC in presence of other E. coli (Gill et al., 2014; Verhaegen et al., 2015). Therefore, in case of a positive PCR reaction for genes associated with particular serogroups, immunomagnetic separation (IMS) (Dynabeads; Thermo Fisher Scientific) was performed to facilitate isolation of STEC strains. Plates were incubated for 18-24h at 37±1°C. Up to 50 colonies with E. coli morphology were inoculated onto Nutrient Agar (NA) (Oxoid) and pooled in water to a total of 10 per pool. Detection of stx genes was performed in each pool. The colonies forming stx-positive pools were tested individually for eae and stx genes by real-time PCR. Isolated STEC strains were subjected to slide agglutination with antisera specific for O157, O103, O26, O111, and O145 serogroups (Statens Serum Institute, Copenhagen, Denmark). The other serogroups were not tested. Subtyping of the stx genes was performed by multiplex PCR (Scheutz et al., 2012), whereas aaiC and aggR genes were detected by real-time PCR assay described by EU Reference Laboratory for E. coli (EU-RL VTEC, web site: http://www.iss.it/binary/vtec/cont/EU_RL_VTEC_Method_05_Rev_1.pdf). Primers and probes are reported in Table 1. STEC strains tested negative for examined stx subtypes were sent to the EU Reference Laboratory for E. coli (EU-RL VTEC) for further analysis.

2.4. Pulsedfield gel electrophoresis (PFGE)

STEC isolates were analysed by PFGE according to the PulseNet protocol for Escherichia coli O157:H7 (CDC, web site: http://www.cdc.gov/pulsenet/pathogens/index.html) and EFSA External Scientific Report about molecular typing of verocytotoxin-producing E. coli (Caprioli et al., 2014).

STEC strains were digested with the XbaI restriction enzyme (Promega, Madison, WI, US).

Restriction fragments were separated using a CHEF-DR III electrophoresis system (Bio-Rad, Hercules, CA, US). The gels were stained with ethidium bromide and DNA bands were visualized with a UV trans-illuminator (UVItec, Cambridge, UK). PFGE gel images were analysed using the BioNumerics software (Applied-Maths, Sint-Martens-Latem, Belgium) to establish genotypic relatedness between the isolates.

3. Results

3.1. STECprevalence in swine carcasses

Out of 210 swine carcass sponge swabs, 181 (86.2%) tested negative for stx genes (Table 3). Of these 181 stx-negative samples, 144 (68.6%) tested positive for eae. Of the 29 stx-positive broths, 26 (12.4%) tested positive for both stx2 and eae, 2 (0.9%) were positive only for stx2, and one (0.5%) tested positive for both stx1 and eae. Positive samples were examined further to identify "top five" serogroup-associated genes: 14 out of 29 samples (48.3%) were found positive for the O157 serogroup, 6 samples (20.7%)—for the O26 serogroup, 4 samples (13.8%) —for the O103 serogroup, 1 sample (3.4%) — for the O145 serogroup. No sample contained the O111-associated gene. STEC isolates were recovered from 4 samples: 5 strains were obtained from 4 carcass sponge swabs collected on different sampling days. Two different STEC strains were isolated from the same carcass. All STEC isolates were positive for stx2, while eae gene was absent. None of the strains belonged to the tested serogroup and none carried aaiC and aggR. Three STEC strains were positive for stx2e and one strain was positive for stx2d. For one strain, its stx2 subtype could not be determined with the available assays.

3.2. STEC prevalence in swine faecal samples

Of the 210 faecal samples obtained from pigs at slaughter, 129 (61.4%) were negative for Shiga toxin-encoding genes (Table 4). Out of these 129 stx-negative samples, 105 (50.0%) tested positive for eae. In the remaining 81 stx-positive samples, stx2 and eae genes were detected in 75 (35.7%) of enriched broths, while 6 (2.9%) broths were positive for stx2 only. In contrast to observations in carcasses, stx1 was not detected in any faecal sample. Genes associated with "top five" serogroups O157, O26, O103, O145, and O111 were detected, respectively, in 70/81 (86.4%), 31/81 (38.3%), 14/81 (17.3%), 8/81 (9.9%), and 1/81 (1.2%) of stx-positive samples. STEC strains were isolated in 26 faecal samples: 28 strains were obtained from 26 swine colon contents collected on 13 different sampling days. In two cases, two different STEC strains were isolated from the same faecal sample. Similarly to the isolates from carcasses, all STEC strains tested positive for stx2 but did not carry eae. None of the STEC strains belonged to one of the "top five" serogroups and none carried aaiC and aggR genes. Out of 28 STEC isolates, 27 tested positive for stx2e, while one isolate was negative for all stx2-subtypes tested, similarly to one of the strains isolated from the carcass of the same pig. Isolates that could not be typed were subjected to sequencing at the EU-RL VTEC. We found that these two isolates carried stx2e, but had an insertion sequence, located in the stx operon, downstream of the gene stx2A. This was the reason why in our initial assays subtype-specific genes could not amplify properly. Moreover, stx2e gene expression was inactivated by a single nucleotide deletion (the loss of a G in the stx2A gene), which caused a shift in the reading frame, during DNA translation.

3.3. STEC prevalence in pork samples

In total, 675 pork samples, including fresh and dried products, were analysed for the presence of

STEC strains using molecular and isolation methods. Of these 675 pork samples, 656 (97.2%) were

negative for Shiga toxin-encoding genes, while 19 (2.8%) fresh sausage samples were stx-positive

(Table 5). Of these 19 stx-positive enrichment cultures, 10 (1.5%) contained both eae and stx2, 5

(0.7%) tested positive only for stx1, and 4 (0.6%) were found to be positive only for stx2. Out of 19 stx-positive samples, 18 tested positive for at least one serogroup in real-time PCR. The most prevalent serogroup detected in 18/19 samples was O145 (94.7%). The O103-associated gene was detected in 15/19 (78.9%) samples. Eight out of 19 (42.1%) samples were found positive for the O157 serogroup, 7/19 (36.8%) were positive for the O26 marker, while no sample contained the O111-associated gene. One enrichment culture was negative for all serogroups tested. Unlike carcasses and faecal samples, STEC strains were not isolated from stx-positive pork products. This result could be due to the presence of preservative substances added to the minced meat or to the effect of ripening. Also the addition of novobiocin to the enrichment medium, as described in ISO/TS 13136, could inhibit the growth of some non-O157 STEC strain (Kanki et al., 2011).

3.4. PFGE profiles of STEC isolates

All 33 STEC isolates were analysed by PFGE but only 31 of them produced clear bands that allowed characterisation of PFGE profiles. Two STEC isolates could not be analysed because of DNA degradation. PFGE analysis produced a number of DNA fragments, which comprised between 13 and 22 bands. The selected 31 STEC isolates showed a similarity of 62.5% or greater. PFGE patterns are shown in Fig.1. Five clusters of isolates demonstrated identical PFGE profiles. Three of these 5 clusters were isolated from faeces of pigs kept on the same farms and sampled on the same day, while two clusters were obtained from faeces and carcasses of the same animals, suggesting that auto or cross-contamination occurred. In addition, two strains with similarity of 67.5% were recovered from a single carcass. Furthermore, another two STEC strains with similarity of 67.5% were isolated from a single faecal sample. Nonetheless, the small number of STEC isolates that could be analysed by PFGE did not allow making reliable epidemiological extrapolations.

4. Discussion

The prevalence of STEC strains in the swine population and pork products has been reported in some epidemiologic studies conducted in several countries. However, these data often could not be directly compared due to differences in study designs, application of dissimilar sample collection methods, or use of different STEC detection and isolation protocols (Tseng et al., 2014b).

STEC strain occurrence rate in swine faecal samples varies within a wide range of values depending on the study. Out of 210 swine faecal samples collected in this study, 38.6% (81/210) of faecal samples were stx-positive. In total, 28 STEC isolates were obtained from 26 faecal samples corresponding to the culture-positive rate of 12.4% (26/210). Similar prevalence estimates have been reported in studies conducted in other European countries. In France, about 31% (129/182) of swine faecal samples tested using PCR were sir-positive, but among the 129 positive specimens, none contained detectable levels of the uidA gene associated with the O157:H7 serotype (Bouvet et al., 2002b). In Belgium, from 177 individual rectal swabs, 56 (31%) were PCR-positive for STEC (Botteldoorn et al., 2002). However, many studies reported substantially different STEC prevalence rates. A study conducted in Switzerland reported a lower incidence of STEC in swine faecal samples: of 630 specimens collected at slaughter, 22% and 7.5% were PCR positive for stx and rfbE (O157 serogroup-associated gene), respectively (Kaufmann et al., 2006). In another study, carried out in northern Italy in 1993, faecal specimens from 242 slaughtered pigs were tested using the Vero cell assay and the presence of STEC was detected only in 7.8% (19/242) of enriched samples (Caprioli et al., 1993).In contrast, the US National Animal Health Monitoring System Swine 2000 Report stated that out of a total of 687 swine faecal samples tested for the presence of stxl and stx2 using PCR assays, 484 (70%) samples were positive for one or both genes. At least one STEC isolate was recovered from 196 faecal samples (196/687, 28.5%) in that study. It is noteworthy that about 80% of STEC isolates belonged to the stx2e subtype, whereas serogroup O157 strains were not

detected (Fratamico et al., 2004; Tseng et al., 2014a). A higher isolation rate was reported in a longitudinal study, in which STEC occurrence in faecal shedding during the finishing period was analysed in 150 pigs. In total, 1,200 faecal samples were collected and STEC isolates were recovered in at least one faecal sample from 98 out of 150 pigs (65.3%). Most of the STEC strains (97.9%) harboured stx2e, while E. coli O157:H7 was not isolated (Tseng et al., 2014b). Furthermore, relatively high STEC prevalence rates were reported in a study conducted in Chile, where STEC strains were identified by DNA hybridisation in 68.3% (82/120) of faecal samples collected from 120 healthy pigs (Borie et al., 1997). At the same time, other South American studies reported less frequent STEC occurrence. In Brazil, one study reported a rather low prevalence rate of 1.35% (1/74) indicated by isolation of just one stx2-positive strain from 74 swine intestinal samples (Martins et al., 2011).

As in the case with faecal samples, STEC prevalence in swine carcasses varied widely depending on the country and methods applied for detection and isolation. In our study, we found that 29 out of 210 (13.8%) carcass sponge swabs were stx-positive. In total, 5 STEC isolates were obtained from 4 carcass samples indicating a culture-positive rate of 1.9% (4/210).In Belgium, 5 pig carcasses out of 132 examined (12.8%) were stx-positive according to PCR analysis (Botteldoorn et al., 2002). In France, the carcass contamination rate determined by molecular methods varied from 12% to 50% (Bouvet et al., 2001; Bouvet et al., 2002a). In Canada, 51 out of 1067 carcasses (4.8%) were found to be PCR-positive for stx genes (Bohaychuk et al., 2011). Borges et al. (2012) examined the presence of STEC strains in 215 swine carcasses using PCR and isolation techniques in Brazil. Shiga-toxin encoding genes were detected in 12 samples (5.6%) and prevalence of STEC isolates comprised 0.4% (1/215). The only STEC strain isolated in that study was positive for stx2e and did not belong to the O157:H7 serotype.

Highly variable rates of stx-positive strain incidence have also been observed in pork products collected in many countries. Out of 675 pork samples analysed in our study, 19 (2.8%) were stx-

positive, but no STEC strains were isolated. At the same time, many studies reported higher prevalence rates of stx-positive strains in pork products. In Italy, out of 126 fresh meat samples screened using PCR, 20 (15.9%) were positive for the presence of stx genes. Furthermore, 50% of the stx-positive pork specimens (10/20) were contaminated with E. coli O157, as indicated by positive results of testing for the presence of rfbE. Moreover, 24 stx-positive strains were isolated from 13 stx-positive samples (10.3%, 13/126) and 15 of them were shown to have the O157 serotype (Villani et al., 2005). Bardasi et al. (2015) reported data from a two-year STEC monitoring plan carried out in the Emilia Romagna region of Italy. STEC virulence genes were detected according to ISO/TS 13136 in 41 out of 213 (19%) fresh sausages made from pork meat. In addition, one E. coli O103 strain positive for eae and stxl was isolated (Bardasi et al., 2015). In Britain, testing of pork sausages by DNA hybridisation showed the presence of STEC strains in 46 (25%) of 184 samples (Smith et al., 1991). In the United States, a study was published in which 231 ground pork samples were collected in the Washington D.C. area. Out of 231 samples, 31 (13.4%) were PCR-positive for stx genes. Positive specimens were further analysed using colony hybridisation and STEC strains were isolated from 13 (5.2%) pork samples. None of the STEC isolates belonged to O157 serogroup (Ju et al., 2012).

These studies show that the incidence of STEC strains in swine populations and pork products varied in different regions of the world. The epidemiologic data about STEC contamination of pork products suggest that swine may represent an important source of STEC strains in the food chain. The observed differences in STEC strain prevalence rates could be due to variances in husbandry practices and predominant climatic conditions of different geographical areas (Rajkhowa and Sarma, 2014). On the other hand, data about STEC strain prevalence rates in the swine production chain are sparse and discrepancies are potentially attributable to multiple factors, such as different sampling protocols. The variation in methods used for detection and isolation of STEC strains may

be yet another factor contributing to differences in prevalence rate estimates (Fratamico et al., 2004; Tseng et al., 2014a).

Although pigs are a potential reservoir of STEC strains, distinct genetic profiles have been described in STEC strains of swine and human origin (Sonntag et al., 2005). Out of 33 STEC isolates obtained in our study, 32 (97%) were stfX2e-positive and none belonged to any of the "top five" serogroups. Only a very small number of 5ix2e-positive strains have been detected in humans accounting only for 0.9%-1.7% of all human STEC isolates (Sonntag et al., 2005; Beutin et al., 2008). Stx2e-producing STEC strains have been usually found in patients showing mild diarrhoea or in asymptomatic carriers. However, severe clinical symptoms, such as HUS, have also been associated with such strains (Thomas et al., 1994; Fasel et al., 2014). In these human cases, no particular source of infection has been identified (Tseng et al., 2014a). In fact, it is important to note that only in a few instances pork products have been proven as a vehicle involved in STEC infection outbreaks (Fratamico et al., 2004; Conedera et al., 2007). Although a small number of STEC strain outbreaks implicating pork as the likely source of infection has been reported, the results of these investigations emphasised the importance of considering meat products other than beef as potential vehicles of STEC strain transmission (Troz-Williams et al., 2012; Tseng et al., 2014a).

The results of our study indicate that swine may represent a potential reservoir of pathogenic STEC strains. Since the majority of STEC strains isolated from faeces and carcasses did not express virulence factors able to cause severe human disease, the role of pork products as a potential source of foodborne infections needs to be further investigated. In fact, many challenges related to the isolation of non-O157 STEC strains remain, since these represent a heterogeneous group of pathogens with different phenotypic features (Smith et al., 2014). Our study has also revealed the difficulty of obtaining STEC isolates from six-positive enrichment cultures, in particular from food samples, despite the application of culturing methods outlined in ISO/TS 13136:2012. This result

could be due to the ripening or to the addition of preservatives to the ground meat. Failure to isolate STEC from stx-positive specimens may be attributable also to the addition of novobiocin to the enrichment medium, during the analysis, to the presence of viable but non-culturable (VBNC) bacterial cells, to the loss of Stx prophages during subculturing, to the high levels of background microflora, or to low levels of target bacteria in the sample (Ju et al., 2012; Farrokh et al., 2013; Meng et al., 2014).

Implementation of monitoring programmes, good hygiene practices, and efficient validated Hazard Analysis Critical Control Point procedures in the whole food production chain is an important instrument to control public health risks associated with STEC strain infections (EFSA, 2007). Prevention and control of foodborne diseases caused by STEC strains also require continuous improvement of analytical tools to understand the virulence, origins, and epidemiology of these bacteria, in order to devise strategies that lessen the risk of foodstuff contamination and eventually anticipate the emergence and the spread of new forms of these pathogens (Franz et al., 2014).

Acknowledgements

We would like to thank all EU-RL-VTEC staff of for their assistance, in particular Dr. Antonella Maugliani for kindly performing PFGE data analysis and Dr. Stefano Morabito for carrying out strains sequencing.

This research was supported by a grant from Ministry of Health-Italy (IZSUM RC03/2011). References

Bardasi L., Taddei R., Nocera L., Ricchi M., Merialdi G., 2015. Shiga-toxin-producing Escherichia coli in meat and vegetable products in Emilia Romagna Region, years 2012-2013. Italian Journal of Food Safety 4, 33-35.

Beutin L., Krüger U., Krause G., Miko A., Martin A., Strauch E., 2008. Evaluation of major types of Shiga toxin 2e-producing Escherichia coli bacteria present in food, pigs, and the environment as potential pathogens for humans. Applied and Environmental Microbiology 74, 4806-4816.

Bohaychuk V.M., Gensler G.E., Barrios P.R., 2011. Microbiological baseline study of beef and pork carcasses from provincially inspected abattoirs in Alberta, Canada. Canadian Veterinary Journal 52, 1095-1100.

Borges C.A., Beraldo L.G., Maluta R.P., Cardozo M.V., Guth B.E., Rigobelo E.C., de Ávila F.A., 2012. Shiga toxigenic and atypical enteropathogenic Escherichia coli in the feces and carcasses of slaughtered pigs. Foodborne Pathogens and Disease 9, 1119-1125.

Borie C., Monreal Z., Guerrero P., Sanchez M.L., Martinez J., Arellano C., Prado V., 1997. Prevalence and characterization of enterohaemorrhagic Escherichia coli isolated from healthy cattle and pigs slaughtered in Santiago, Chile. Archivos de Medicina Veterinaria 29, 205-212.

Botteldoorn N., Heyndrickx M., Rijpens N., Herman L., 2002. Detection and characterization of verotoxigenic Escherichia coli by a VTEC/EHEC multiplex PCR in porcine faeces and pig carcass swabs. Research in Microbiology 154, 97-104.

Bouvet J., Bavai C., Rossel R., Le Roux A., Montet M.P., Ray-Gueniot S., Mazuy C., Arquilliere C., Vernozy-Rozand C., 2001. Prevalence of verotoxin-producing Escherichia coli and E. coli O157:H7 in pig carcasses from three French slaughterhouses. International Journal of Food Microbiology 71, 249-255.

Bouvet J., Bavai C., Rossel R., Le Roux A., Montet M.P., Ray-Gueniot S., Mazuy C., Atrache V., Vernozy-Rozand C., 2002a. Effects of cutting process on pork meat contamination by verotoxin-producing Escherichia coli (VTEC) and E. coli O157:H7. International Journal of Food Microbiology 77, 91-97.

Bouvet J., Montet M.P., Rossel R., Le Roux A., Bavai C., Ray-Gueniot S., Mazuy C., Atrache V., Vernozy-Rozand C., 2002b. Effects of slaughter processes on pig carcass contamination by verotoxin-producing Escherichia coli and E. coli O157:H7. International Journal of Food Microbiology 77, 99-108.

Caprioli A., Maugliani A., Michelacci A., Morabito S., 2014. Molecular typing of Verocytotoxin-producing E. coli (VTEC) strains isolated from food, feed and animals: state of play and standard operating procedures for pulsed field electrophoresis (PFGE) typing, profiles interpretation and curation. EFSA supporting publication. EN-704, 1-55.

Caprioli A., Morabito S., Brugere H., Oswald E., 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Veterinary Research 36, 289-311.

Caprioli A., Nigrelli A., Gatti R., Zavanella M., Blando A.M., Minelli F., Donelli G., 1993. Characterization of verocytotoxin-producing Escherichia coli isolated from pigs and cattle in northern Italy. Veterinary Record 133, 323-324.

Conedera G., Mattiazzi E., Russo F., Chiesa E., Scorzato I., Grandesso S., Bessegato A., Fioravanti A., Caprioli A., 2007. A family outbreak of Escherichia coli O157 haemorrhagic colitis caused by pork meat salami. Epidemiology & Infection 135, 311-314.

EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control), 2012. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2010. EFSA Journal 10(3):2597.

EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control), 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014. EFSA Journal 13(12):4329.

EFSA (European Food Safety Authority) Panel on Biological Hazard, 2007. Scientific Opinion on Monitoring of verotoxigenic Escherichia coli (VTEC) and identification of human pathogenic VTEC types. EFSA Journal 579, 1-61.

Farrokh C., Jordan K., Auvray F., Glass K., Oppegaard H., Raynaud S., Thevenot D., Condron R., De Reu K., Govaris A., Heggum K., Heyndickx M., Hummerjohann J., Lindsay D., Miszczycha S., Moussiegt S., Verstraete K., Cerf O., 2013. Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. International Journal of Food Microbiology 162:190-212.

Fasel D., Mellmann A., Cernela N., Hächler H., Fruth A., Khanna N., Egli A., Beckmann C., Hirsch H.H., Goldenberg D., Stephard R., 2014. Hemolytic uremic syndrome in a 65-year-old male linked to a very unusual type of stx2e- and eae-harboring O51:H49 Shiga toxin-producing Escherichia coli. Journal of Clinical Microbiology 52, 1301-1303.

Frank C., Weber D., Cramer J.P., Askar M., Faber M., der Heiden M., Bernard H., Fruth A., Prager R., Spode A., Wadl M., Zoufaly A., Jordan S., Kemper M.J., Follin P., Müller L., King L., Rosner B., Buchholz U., Stark K., Krause G., 2011. Epidemic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. The New England Journal of Medicine 365, 1771-1780.

Franz E., Delaquis P., Morabito S., Beutin L., Gobius K., Rasko D.A., Bono J., French N., Osek J., Lindstedt B.A., Muniesa M., Manning S., LeJeune J., Callway T., Beatson S., Eppinger M., Dallman T., Forbes K.J., Aarts H., Pearl D.L., Gannon V.P.J., Laing C.R., Strachn N.J.C., 2014. Exploiting the explosion of information associated with whole genome sequencing to tackle Shiga

toxin-producing Escherichia coli (STEC) in global food production systems. International Journal of Food Microbiology 187, 57-72.

Fratamico P.M., Bagi L.K., Bush E.J., Solow B.T., 2004. Prevalence and characterization of shiga toxin-producing Escherichia coli in swine feces recovered in the National Animal Health Monitoring System's swine 2000 study. Applied and Environmental Microbiology 70, 7173-7178.

Gill A., Huszczynski G., Gauthier M., Blais B., 2014. Evaluation of eight agar media for the isolation of Shiga-toxin producing Escherichia coli. Journal of Micobiological Methods 96, 6-11.

ISO (International Organization for Standardization), 2012. Microbiology of food and animal feed-Real-time polymerase chain reaction (PCR)-based method for the detection of food-borne pathogens-Horizontal method for the detection of Shiga toxin-producing Escherichia coli (STEC) and the determination of O157, O111, O26, O103 and O145 serogroups. ISO/TS Norm 13136:2012(E). Geneva: International Organization for Standardization Publications.

Ju W., Shen J., Li Y., Toro M.A., Zhao S., Ayers S., Najjar M.B., Meng J., 2012. Non-O157 Shiga toxin-producing Escherichia coli in retail ground beef and pork in the Washington D.C. area. Food Microbiology 32, 371-377.

Kanki M., Seto K., Harada T., Yonogi T., Kumeda Y., 2011. Comparison of four enrichment broths for the detection of non-O157 Shigatoxin-producing Escherichia coli O91, O103, O111, O119, O121, O145 and O165 from pure culture and food samples. Letters in Applied Microbiology 53, 167-73.

Karve S.S., Weiss A.A., 2014. Glycolipid binding preferences of Shiga toxins variants. PloS one 9:e101173.

Kaufmann M., Zweifel C., Blanco M., Blanco J.E., Blanco J., Beutin L., Stephan R., 2006. Escherichia coli O157 and non-O157 Shiga toxin-producing Escherichia coli in fecal samples of finished pigs at slaughter in Switzerland. Journal of Food Protection 69, 260-266.

Martins P R., da Silva M.C., Dutra V., Nakazato L., da Silva Leite D., 2011. Prevalence of enterotoxigenic and Shiga toxin-producing Escherichia coli in pigs slaughtered in Mato Grosso, Brazil. The Journal of Infection in Developing Countries 5, 123-126.

Meng Q., Bai X., Zhao A., Lan R., Du H., Wang T., Shi C., Yuan X., Bai X., Ji S., Jin D., Yu B., Wang Y., Sun H., Liu K., Xu J., Xiong Y., 2014. Characterization of Shiga toxin-producing Escherichia coli from healthy pigs in China. BioMed Central Microbiology 14:5.

Monday R.S., Beisaw A., Feng P.C.H., 2007. Identification of Shiga toxigenic Escherichia coli seropathotypes A and B multiplex PCR. Molecular and Cellular Probes 21, 308-311.

Nielsen E.M., Andersen MT., 2003. Detection and characterization of verocytotoxin-producing Escherichia coli by automated 5' nuclease PCR assay. Journal of Clinical Microbiology 41(7), 2884-2893.

Perelle S., Dilasser F., Grout J., Fach P., 2004. Detection by 5'-nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157:H7, associated with the world's most frequent clinical cases. Molecular and Cellular Probes 18, 185-192.

Perelle S., Dilasser F., Grout J., Fach P., 2005. Detection of Escherichia coli serogroup O103 by real time polymerase chain reaction. Journal of Applied Microbiology 98, 1162-1168.

Posse B., De Zutter L., Heyndrickx M., Herman L., 2008. Novel differential and confirmation plating media for Shiga toxin-producing Escherichia coli serotypes O26, O103, O111, O145 and sorbitol-positive and -negative O157. FEMS Microbiology Letters 282, 124-131.

Rajkhowa S., Sarma D.K., 2014. Prevalence and antimicrobial resistance of porcine O157 and non-O157 Shiga toxin-producing Escherichia coli from India. Tropical Animal Health and Production 46, 931-7.

Scheutz F., Teel L.D., Beutin L., Pierard D., Buvenz G., Karch H., Mellmann A., Caprioli A., Tozzoli A., Morabito S., Strockbine N.A., Melton-Celsa A.R., Sanchez M., Persson S., O'Brien A.D., 2012. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. Journal of Clinical Microbiology 50, 2951-2963.

Schierack P., Steinrück H., Kleta S., Vahjen W., 2006. Virulence factor gene profiles of Escherichia coli isolates from clinically healthy pigs. Applied and Environmental Microbiology 72, 6680-6686.

Shen J., Rump L., Ju W., Shao J., Zhao S., Brown E., Meng J., 2015. Virulence characterization of non-O157 Shiga toxin-producing Escherichia coli isolates from food, humans and animals. Food Microbiology 50, 20-27.

Smith H.R., Cheasty T., Roberts D., Thomas A., Rowe B., 1991. Examination of retail chickens and sausages in Britain for Vero cytotoxin-producing Escherichia coli. Applied and Environmental Microbiology 57, 2091-2093.

Smith J.L., Fratamico P.M., Gunther IV N.W., 2014. Shiga toxin-producing Escherichia coli. Advances in Applied Microbiology 86, 145-197.

Sonntag A.K., Bielaszwska M., Mellmann A., Dierksen N., Schierack P., Wieler L.H., Schmidt M.A., Karch H., 2005. Shiga toxin 2e-producing Escherichia coli isolates from humans and pigs differ in their virulence profiles and interactions with intestinal epithelial cells. Applied and Environmental Microbiology 71, 8855-8863.

Thomas A., Cheasty T., Chart H., Rowe B., 1994. Isolation of Vero cytotoxin-producing Escherichia coli serotypes O9ab:H- and O101:H- carrying VT2 variant gene sequences from a patient with haemolytic uraemic syndrome. European Journal of Clinical Microbiology & Infectious Diseases 13, 1074-1076.

Troz-Williams L.A., Mercer N.J., Walters L.M., Maki A.M., Johnson R.P., 2012. Pork implicated in a Shiga toxin-producing Escherichia coli O157:H7 outbreak in Ontario, Canada. The Canadian Journal of Public Health 103, 322-326.

Tseng M., Fratamico P.M., Bagi L., Manzinger D., Funk J.A., 2014a. Shiga toxin-producing Escherichia coli in swine: the public health perspective. Animal Health Research Reviews 8, 1-13.

Tseng M., Fratamico P.M., Bagi L., Manzinger D., Funk J.A., 2014b. Shiga toxin- producing E. coli (STEC) in swine: prevalence over the finishing period and characteristics of the STEC isolates. Epidemiology & Infection 8, 1-10.

Verhaegen B., De Reu K., Heyndrickx M., De Zutter L., 2015. Comparison of six chromogenic agar media for the isolation of a broad variety of non-157 Shigatoxin-producing Escherichia coli (STEC) serogroups. International Journal of Environmental Research and Public Health 12, 6965-6978.

Villani F., Russo F., Blaiotta G., Moschetti G., Ercolini D., 2005. Presence and characterization of verotoxin producing E. coli in fresh Italian pork sausages, and preparation and use of an antibiotic-resistant strain for challenge studies. Meat Science 70, 181-188.

-Web references

http://www.cdc.gov/pulsenet/pathogens/index.html (February, 2016) http://www.iss.it/binary/vtec/cont/EU_RL_VTEC_Method_05_Rev_1.pdf (February, 2016)

Table 1 Primers and probes used for real-time PCR

Target gene Sequence (5' to 3')a Expected size of the PCR product (bp) Reference

stxl TTTGTYACTGTSACAGCWGAAGCYTTACG CCCCAGTTCARWGTRAGRTCMACRTC Probe-CTGGATGATCTCAGTGGGCGTTCTTATGTAA 131 Perelle et al., 2004

stx2 TTTGTYACTGTSACAGCWGAAGCYTTACG CCCCAGTTCARWGTRAGRTCMACRTC Probe-TCGTCAGGCACTGTCTGAAACTGCTCC 128 Perelle et al., 2004

eae CATTGATCAGGATTTTTCTGGTGATA CTCATGCGGAAATAGCCGTTA Probe- ATAGTCTCGCCAGTATTCGCCACCAATACC 102 Nielsen and Andersen, 2003

rfbE (O157) TTTCACACTTATTGGATGGTCTCAA CGATGAGTTTATCTGCAAGGTGAT Probe- AGGACCGCAGAGGAAAGAGAGGAATTAAGG 88 Perelle et al., 2004

wbdl (Olll) CGAGGCAACACATTATATAGTGCTTT TTTTTGAATAGTTATGAACATCTTGTTTAGC Probe- TTGAATCTCCCAGATGATCAACATCGTGAA 146 Perelle et al., 2004

wzx (O26) CGCGACGGCAGAGAAAATT AGCAGGCTTTTATATTCTCCAACTTT Probe-CCCCGTTAAATCAATACTATTTCACGAGGTTGA 135 Perelle et al., 2004

ihpl (O145) CGATAATATTTACCCCACCAGTACAG GCCGCCGCAATGCTT Probe-CCGCCATTCAGAATGCACACAATATCG 132 Perelle et al., 2004

wzx (Ol 03) CAAGGTGATTACGAAAATGCATGT GAAAAAGCACCCCCGTACTTAT Probe- CATAGCCTGTTGTTTTAT 99 Perelle et al., 2005

aggR GAATCGTCAGCATCAGCTACA CCTAAAGGATGCCCTGATGA Probe- CGGACAACTGCAAGCATCTA 102 EU-RL VTEC b

aaiC CATTTCACGCTTTTTCAGGAAT CCTGATTTAGTTGATTCCCTACG Probe- CACATACAAGACCTTCTGGAGAA 160 EU-RL VTEC b

a Y is (C, T), S is (C, G),W is (A, T), R is (A, G), M is (A, C). b http://www.iss.it/binary/vtec/cont/EU_RL_VTEC_Method_05_Rev_1.pdf

Table 2 Primers used for end-point multiplex PCR

Target gene Sequence (5' to 3') Expected size of the PCR product (bp) Reference

wzx (O26) ATCCTTGCTTCGCCTGTT CAGCGATACTTTGAACCTTAT 268 Monday et al., 2007

wzx (0103) TATCCTTTCATAGCCTGTTGTT AATAGTAATAAGCCAGACACCTG 320

wzx (0111) GTTGC GAGGAATAATTC TTCA CCATAGTATTGCATAAAGGC 829

wzx (0145) TTGAGCACTTATCACAAGAGATT GATTGAATAGCTGAAGTCATACTAAC 418

wzx (0157) GCTGCTTATGCAGATGCTC CGACTTCACTACCGAACACTA 133

Table 3 STEC detection in carcass sponge swabs by molecular analysis

Virulence factors Number of positive samples % O157a O145a 0103a 0111a 026a

eae+stx2+stx1- 26 12.4 12 1 3 0 4

eae-stx2+stx1- 2 0.9 1 0 1 0 2

eae+stx2-stx1+ 1 0.5 1 0 0 0 0

Positive tot. 29 13.8 14 1 4 0 6

Negative tot. 181 86.2

Total 210 100 48.3% 3.4% 13.8% 0% 20.7%

aThe same sample could be positive for more than one serogroup

Table 4 STEC detection in swine faecal samples by molecular analysis

Virulence factors Number of positive samples % O157a O145a 0103a 0111a 026a

eae+stx2+stxl- 75 35.7 65 7 12 1 28

eae-stx2+stxl- 6 2.9 5 1 2 0 3

Positive tot. 81 38.6 70 8 14 1 31

Negative tot. 129 61.4

Total 210 100 86.4% 9.9% „17.3% 1.2% 38.3%

aThe same sample could be positive for more than one serogroup

Table 5 STEC detection in pork samples by molecular analysis

Virulence factors Number of positive samples % O157a O145a 0103a 0111a 026a

eae+stx2+stx1- 10 1.5 7 10 8 0 4

eae-stx2+stx1- 4 0.6 1 3 2 0 3

eae-stx2-stx1+ 5 0.7 0 5 5 0 0

Positive tot. 19 2.8 8 18 15 0 7

Negative tot. 656 97.2

Total 675 100 42.1% 94.7% 78.9% 0% 36.8%

aThe same sample could be positive for more than one serogroup

Black-and-white in print is required. Figure caption:

Figure 1 Dendrogram of STEC isolates from faecal samples (strain codes including F letter) and carcasses (strain codes including C letter). Five clusters were identified (100% of identity): three clusters originated from slaughterhouse "D Umbria" and two from "B Umbria". Two strains (40668\2-4Ca and 40668\2-4Cb) were recovered from a single carcass and two strains (9299\1-4Fa and 9299\1-4Fb) were isolated from a single faecal sample.

sa i t в z к e i g i i i i g i i i §

I I III»

II MIHI Hill I1

I llll III

I llll III

II nil III

40668\2-4 С ■ 14487X1-2 F 24758X1-1 F 9299X1-6 F 9299XI-I0 F 607б\1-7 F 2792X1-8F JSS43XI-4 F 35543X1-7 F 35543X1-8 F 12681X1-8 F 37S3l\2-8 С I3588M-9 F 14487*1-5 F I4487Û-5 С 1268I\2-I0 С 4141X1-6 F 4I4IU-7 F 1482X1-9 F 4I4IM-4F 9299« M F b 9299X1-9 F 40668X1-4 F 40668 2-4 С b 4141X1-3 F 37U1M-10F 4141X1-2 F 45044 ,1-2 F 1482X1-7 F 9299X1-4 F» 40668 .1-7 F

stx2e Jt*2e 5tx2e ltx2e Mx2e

«tx2e

stx2 n t.

«tx2 ni.

Ях2е

Ях2е

«х2е Я*2с stx2e «х2е tfx2e

D Umbría В Umbra С Umbra D Umbra D Umbra В Umbra С Umbra В Umbría

В Umbría A Umbría A Umbría G Marche В Umbría В Umbra

D Umbría D Umbría D Umbra D Umbría

E Umbría A Umbría D Umbría D Umbría

Fig. 1

Highlights

• STEC isolates from swine samples were positive in particular for stx2e.

• High presumptive STEC detection in swine samples using ISO/TS 13136:2012.

• Problems in STEC isolation from pork may be due to preservatives or novobiocin.