Scholarly article on topic 'Photosynthetic leaf area modulates tiller bud outgrowth in sorghum'

Photosynthetic leaf area modulates tiller bud outgrowth in sorghum Academic research paper on "Biological sciences"

CC BY-NC-ND
0
0
Share paper
Academic journal
Plant, Cell & Environment
OECD Field of science
Keywords
{""}

Academic research paper on topic "Photosynthetic leaf area modulates tiller bud outgrowth in sorghum"

Plant, Cell & Environment

Plant, Cell and Environment (2015) 38, 1471-1478 doi: 10.1111/pce.12500

Original Article

Photosynthetic leaf area modulates tiller bud outgrowth in sorghum

Tesfamichael H. Kebrom & John E. Mullet

Department of Biochemistry and Biophysics, Texas A&M University, College Station, TX 77843, USA

ABSTRACT

Shoot branches or tillers develop from axillary buds. The dormancy versus outgrowth fates of buds depends on genetic, environmental and hormonal signals. Defoliation inhibits bud outgrowth indicating the role of leaf-derived metabolic factors such as sucrose in bud outgrowth. In this study, the sensitivity of bud outgrowth to selective defoliation was investigated. At 6 d after planting (6 DAP), the first two leaves of sorghum were fully expanded and the third was partially emerged. Therefore, the leaves were selectively defoliated at 6 DAP and the length of the bud in the first leaf axil was measured at 8 DAP. Bud outgrowth was inhibited by defoliation of only 2 cm from the tip of the second leaf blade. The expression of dormancy and sucrose-starvation marker genes was up-regulated and cell cycle and sucrose-inducible genes was down-regulated during the first 24 h post-defoliation of the second leaf. At 48 h, the expression of these genes was similar to controls as the defoliated plant recovers. Our results demonstrate that small changes in photosynthetic leaf area affect the propensity of tiller buds for outgrowth. Therefore, variation in leaf area and photosynthetic activity should be included when integrating sucrose into models of shoot branching.

Key-words: axillary bud; defoliation; dormancy; shoot branching; sucrose; tillering; apical dominance.

INTRODUCTION

Shoot branching or tillering is an important trait that affects grain yield and biomass production (Hammer 2006; Kuraparthy et al. 2008). Branches or tillers develop from buds that are formed from meristems initiated in the axil of leaves. The buds may grow and form branches or become dormant in response to developmental and environmental signals that promote or inhibit bud outgrowth. Developmental signals are those associated with the status of the shoot apical meristem as a vegetative or floral meristem and the overall growth of the plant. Environmental signals that modulate tillering include availability of water, nutrients, temperature, light quality and quantity. The effects of developmental and environmental

Correspondence: T. H. Kebrom. e-mail: tesfamichael.kebrom @ag.tamu.edu

signals are integrated and transmitted through variation in hormonal and metabolic signals that act within or outside the buds. Plant carbohydrate status is well known to affect tillering, therefore indices of carbohydrate supply/demand have been developed to account for how this factor modulates tillering under field conditions (Kirby et al. 1985; Lafarge 2006; Luquet etal. 2006; Kim etal. 2010; Alam etal. 2014). Genetic factors also modify the onset and extent of tillering and the sensitivity of bud outgrowth to developmental and environmental factors. A century of research on shoot branching has identified many of the developmental, environmental and genetic factors that regulate the dormancy versus outgrowth fates of axillary buds (reviewed in Beveridge et al. 2009, Domagalska & Leyser 2011, Kebrom et al. 2013, Janssen et al. 2014).

Studies on shoot branching initially focused on explaining the phenomenon of apical dominance. In intact plants that do not normally develop branches, removal of the shoot apex or decapitation stimulates bud outgrowth. It is now well established that the inhibitory signal removed by decapitation is the plant hormone auxin synthesized in the shoot apex (Thimann & Skoog 1933; Thimann etal. 1934). However, subsequent studies identified that auxin inhibits bud outgrowth indirectly without entering into axillary buds (Prasad et al. 1993). This led to the search for a second messenger for auxin. Molecular, physiological and genetic approaches identified cytokinins (CKs) and strigolactones as second messengers that are modulated during the inhibition of bud outgrowth in response to apically derived auxin (Ferguson & Beveridge 2009). CKs act inside the bud to promote bud outgrowth (Turnbull et al. 1997; Dun et al. 2012). Auxin inhibits the expression of adenosine phosphate-isopentenyltransferase (IPT) (Tanaka et al. 2006), a key gene in the biosynthesis of CKs. The role of strigolactones as inhibitors of shoot branching was discovered through the analysis of highly branched mutants of Arabidopsis (Arabidopsis thaliana L.), petunia (Petunia hybrida), pea (Pisum sativum L.) and rice (Oryza sativa L.) resulting from disruptions in the strigolactone biosynthetic pathway (reviewed in Dun et al. 2009).The expression of some of the strigolactone biosynthesis genes is up-regulated by auxin (Bainbridge etal. 2005; Arite etal. 2007). Although the increased levels of abscisic acid (ABA) are associated with bud dormancy, this hormone acts through an auxin-independent mechanism (Gocal et al. 1991; Chatfield et al. 2000).

© 2014 The Authors. Plant, Cell & Environment published by John Wiley & Sons Ltd. 1471

This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Research on the regulation of shoot branching by environmental factors has focused on the inhibition of bud outgrowth by shade signals perceived by the red (R) and far red (FR) absorbing photoreceptor phytochrome B (phyB) (Kebrom et al. 2013). It is well documented that phyB mutants in diverse species produce fewer tillers or branches (Kebrom et al. 2006; Finlayson et al. 2010). Low R:FR ratio light also inactivates phyB and inhibits bud outgrowth in wild-type plants. The R:FR is reduced either by absorption of R by the canopy or reflectance of FR by neighbouring plants (Cumming 1963; Ballare et al. 1990). The maize (Zea mays spp. mays.) tb1-like genes in diverse species inhibit bud outgrowth and plants with mutations in these genes are highly branched (Doebley et al. 1997; Takeda et al. 2003; Aguilar-Martinez et al. 2007; Finlayson 2007). Recent studies identified that R:FR perceived by phyB controls bud outgrowth by regulating the expression of tb1 (Kebrom et al. 2006; Finlayson et al. 2010; Gonzalez-Grandio etal. 2013). The expression of tb1-like genes is increased by shade signals (low R:FR) and reduced by high R:FR. The grassy tillers1 (gt1) mutant maize is highly branched and expression of gt1 was increased by shade signals in teosinte (Z. mays ssp. parviglumis) and sorghum [Sorghum bicolor (L.) Moench] (Whipple et al. 2011). The tb1 and gt1 likely function in the same pathway because both are up-regulated by shade signals and gt1 is expressed in the presence of functional tb1.

The tb1-like genes also suppress bud outgrowth in response to hormonal signals such as auxin from the shoot apex or strigolactones (Aguilar-Martinez etal. 2007; Dun etal. 2013). However, tillering in the OsTB1 rice mutant (fine culm) was inhibited at high-planting density (Takeda et al. 2003). In addition, inhibition of bud outgrowth by defoliation in sorghum was independent of changes in the expression of SbTB1 (Kebrom et al. 2010a). Therefore, it is likely that there is a tb1 -independent mechanism that inhibits bud outgrowth. The expression of the SbMAX2 and SbDRM1 genes in sorghum was up-regulated in buds inhibited by both shade and defoliation suggesting the presence of a common downstream molecular mechanism inhibiting bud outgrowth (Kebrom etal. 2010b). MAX2 is an F-box protein first identified in Arabidopsis and max2 mutants are highly branched (Stirnberg etal. 2002). MAX2 also functions in light signalling (Shen et al. 2007). The DRM1 gene is a commonly used marker for bud dormancy first identified in pea, however, its function is unknown (Stafstrom etal. 1998; Rae etal. 2013).

Although many aspects of hormonal and environmental signals regulating shoot branching have been discovered, the models developed to explain apical dominance, and dormancy versus outgrowth fates of axillary buds, are incomplete (Domagalska & Leyser 2011).This may be because the level of sucrose supplied to the buds by the parent shoot has not been fully accounted for in the models (Kebrom et al. 2012). Although the role of sucrose in shoot branching was reported by pioneers of research on apical dominance (Ballard & Wildman 1964), it was only recently that sucrose supply has been examined in depth as a regulator of bud outgrowth. The reduction in tillering in the tin mutant of

wheat (Triticum aestivum L.) is due to early cessation of tillering (Duggan et al. 2002). The inhibition of bud outgrowth in tin is associated with precocious internode development in the main shoot (Kebrom et al. 2012). The level of sucrose in the inhibited buds of tin was also reduced and sucrose starvation-inducible genes were up-regulated. Kebrom et al. (2012) hypothesized that tiller inhibition in the tin mutant of wheat was due to utilization of sucrose by growing internodes. Furthermore, they suggested that the unknown components of apical dominance including the early auxin-independent signal that promotes bud outgrowth in response to decapitation could be sucrose. Recently, elegant experiments in pea by Mason et al. (2014) demonstrated that the early auxin-independent signal associated with apical dominance is sucrose.

Sucrose supply and demand are complex and influenced by many endogenous and environmental signals. The leaf is the main plant organ that supplies sucrose once seed reserves are depleted following germination. In this paper, using a simple defoliation method and molecular markers for sucrose level, dormancy and growth, we demonstrate that bud outgrowth is extremely sensitive to the photosynthetic leaf area of the main shoot. The results obtained using this method contributes significantly to the understanding of the regulation of shoot branching and integrating sucrose into models for the regulation of bud outgrowth by hormonal and environmental signals.

MATERIALS AND METHODS

Plant materials and growing conditions

Sorghum inbred line 100M seed was planted in flats containing 9 cm deep cells and 30 cm2 surface area. The cells were filled with a soil mix prepared from peat moss, vermiculite, perlite and fertilizers as described by Beall et al. (1991). The seedlings were grown in growth chamber illuminated with fluorescent and incandescent lamps. The photosynthetically active radiation (PAR) in the growth chamber was about 450 jMol m-2 s-1. The photoperiod and temperatures in the growth chamber were 14/10 h light/dark and 31 °C/22 °C day/ night, respectively.

Microscopy documentation of axillary bud development in 100M sorghum seedlings

At 9 d after planting (DAP), a 5 mm section from the base of 100M sorghum shoot was sampled and fixed in formalin-acetic acid-alcohol (FAA) (70% ethanol, 37% formaldehyde-acetic acid, 18:1:1) for at least 24 h (Fig. 1a, red box). The tissue was dehydrated in a tertiary butyl alcohol series, embedded in Tissueprep (Fisher Scientific, Waltham, MA, USA), sectioned at 10 jum with a rotary microtome and placed on microscopy slide. The slide was kept at 40 to 50 °C for at least 24 h and stained in Safranin-O and fast-green series using an HMS series programmable slide stainer (Carl Zeiss Inc., Thornwood, NY). The slide was mounted using two drops of Permount

Figure 1. Axillary bud development in sorghum. (a) sorghum plant at 9 d after planting (9 DAP) with four leaves. Leaves are numbered according to their age, leaf number 1 the oldest. The red box at the base shows the location of the shoot apical meristem and axillary buds. (b) A ~ 10 jm microscopic section of the base of the sorghum indicated by the red box. The asterisk shows the shoot apical meristem and the numbers show the buds in the axil of leaves corresponding to those shown on (a).

medium (Fisher Scientific, Waltham, MA, USA), covered with a cover glass and then observed with a bright-field microscope (Carl Zeiss Inc., Thornwood, NY).

Defoliation experiments and axillary bud length measurements

At 6 DAP, the first and second leaf blades of 100M sorghum seedlings were fully expanded and the third leaf was just emerging. The bud in the first leaf axil was fully developed. Therefore, defoliation treatments were started at 6 DAP. Since the first and second leaf blades were fully expanded, once defoliated, these leaves did not grow, while the third leaf blade continued growth after defoliation. Therefore, the third leaf was defoliated at least twice during the 48 h experimental period as it emerges from the collar of the second leaf. The length of the bud in the first leaf axil was measured at 8 DAP (48 h after defoliation) using a digital caliper under a dissecting microscope. Subsequent studies on the effect of selective defoliation on the overall growth of the plant, progressive defoliation and time course responses were done by defoliating the second leaf blade. All sampling time points were during the light period. Defoliation was done at 1000 h and post-defoliation 1, 6 and 24 h correspond to 1100, 1600 and the next day 1000 h, respectively. The 14 h light period was from 0800 to 2200 h.

Gene expression analyses by quantitative real-time PCR (qPCR)

For analysis of gene expression by qPCR, at least six buds were harvested from the axil of the first leaves under a dissecting microscope and immersed in 10 jL of lysis/binding solution at room temperature (Ambion, Austin, TX, USA).

The samples were stored in -80 °C until RNA extraction. Total RNA was extracted by the TRIzol method (Invitrogen, Carlsbad, CA, USA) in 1.7 mL microcentrifuge tube. About 1.5 jg total RNA from each sample was treated with DNase I (Invitrogen) in a 20 jL reaction and 8 jL was used for cDNA synthesis (+Rt) using SuperScript III (SS III) and random hexamers in a 20 jL reaction according to the manufacturer's instructions (Invitrogen). For negative controls (-RT), 8 jL from the Dnase-treated RNA was used during all steps of cDNA synthesis without adding SS III. The +RT and -RT control were diluted in 300 jL water and 2 jL was used in a 10 jL qPCR reaction containing 2 jL of ~250 ng primer pairs and 6 jL KiCqStart® SYBR Green qPCR Ready Mix (Sigma-Aldrich, St Louis, MO, USA). The +RT qPCR reactions were run in duplicate on an ABI 7900HT (Applied Biosystems, Foster City, California, USA). One -RT reaction corresponding to every +RT qPCR reaction was run at the same time as controls. The threshold cycle (cT) values of 18s rRNA were used to normalize target cT. The fold change was calculated using the 2A-(AACt) method and the average normalized cT as a reference as described in Kebrom etal. (2010a). The primers for SbTB1, SbMAX2, SbDRM1, SbHis4, SbPCNA, SbCycD2, SbCycB and 18S rRNA used for qPCR were published in (Kebrom et al. 2010a). The primers for SbGT1 were also published by Whipple et al. (2011). The forward and reverse primers for the sugar-responsive genes SbASN1 (accession number Sb05g000440) and SbPFP (accession number Sb04g030000) are GTCTTCTCCTT CGTGCTGCT/CGATGTAGAGTGGCGTGACA and AT ATGCAAGGTGAACGCACA/GAAGCCTTACGTCCCA TCAG, respectively.

RESULTS

Response of axillary buds to selective defoliation

Sorghum plants develop tiller buds in the axil of each leaf (Fig. 1). The development of these buds is sequential and corresponds to the development of the subtending leaves. The sorghum 100M plants develop tillers sequentially starting from the first leaf axil. Previous studies demonstrated that defoliation of all fully expanded and young leaf blades of sorghum seedlings at 7 DAP arrested bud outgrowth immediately (Kebrom et al. 2010a). In this study, at 6 DAP, the first two leaves of 100M seedling were fully expanded and the third leaf was partially emerged from the ligule of the second leaf. Therefore, we investigated the response of the bud in the first leaf axil by defoliating one or two leaf blades at different positions at 6 DAP and by subsequently measuring bud length at 8 DAP. Removal of any of the leaf blades repressed bud outgrowth (Fig. 2). The average length of the buds was reduced from about 4.3 mm in the control to 2.2, 1.5 and 1.2 mm by defoliating the first, second and third leaf blades, respectively. Defoliation of the first and the second leaf blades further reduced the average length of buds to 1.1 mm and defoliation of the second and third reduced bud length to about 0.8 mm.

Control First Second First Third Second and and

second third

Defoliated leaf blades

Figure 2. Inhibition of the growth of the bud in the first leaf axil of 100M sorghum seedling by selective defoliation. At 6 d after planting (DAP), the first, which is the oldest, and the second leaf blades were fully expanded and the third leaf blade was young and just emerged from the ligule of the second leaf. Selective defoliation of the first, second, third or a combination of any two of the leaf blades was done at 6 DAP and bud length was measured at 8 DAP. Data are means ± SE;n = 5 axillary buds.

The expression of dormancy-associated gene SbDRMI in buds by selective defoliation

The dormancy-associated gene (SbDRM1) was used as a marker for bud dormancy in 100M sorghum lines. Shade signals or complete defoliation started at 7 DAP inhibited bud outgrowth, and increased expression of SbDRM1 in the buds of shade-treated or defoliation-treated buds at 9 DAP by 18- and 56-fold higher, respectively, compared with untreated controls (Kebrom et al. 2006, 2010a). The average length of the bud was reduced more by defoliation than shade signals. In the current study, because the average length of the bud in the first leaf axil was reduced more by defoliating the second leaf blade than the first leaf blade (Fig. 2), we analysed the expression level of the SbDRM1 gene at 8 DAP (2 d after defoliation) to see if expression of this gene corresponds to the degree of inhibition of bud growth. Contrary to our expectations, the expression level of SbDRM1 was slightly reduced in the buds of defoliated seedlings compared with the control (Fig. 3a). Because defoliation in this study was less severe than the complete defoliation experiments used previously (Kebrom et al. 2010a), it is possible that at 2 d after defoliation the buds were recovering from inhibition. The reduction in bud length because of defoliation could be due to inhibition of bud outgrowth soon after defoliation. Therefore, the expression of SbDRM1 was examined at earlier time points. As shown in Fig. 3b, the expression level of SbDRM1 increased at 1 h after defoliation, and further up-regulated at 6 h after defoliation, and was reduced at 24 h after defoliation.

The effect of progressive defoliation on bud and seedling growth and expression of SbDRMI

At 6 DAP, the average length of the second leaf blade of 100M seedlings was 7 cm. It is possible that the bud may be inhibited by partial defoliation of the second leaf blade. Therefore, we progressively defoliated the second leaf blade by removing 1, 2, 3, 4 or 5 cm from the tip of the second leaf and determined the response of the bud in the first leaf axil

by measuring its length at 8 DAP. As shown in Fig. 4a, bud outgrowth was inhibited when 2 cm or more was defoliated from the tip of the second leaf blade. The reduction in the length of the bud by defoliating 2 or 5 cm from the second leaf blade was comparable. Defoliation might also affect the growth of young immature leaves. At the time of defoliation, the third leaf had emerged from the collar of the second leaf while the fourth leaf was not visible. At 8 DAP, the length of the fourth leaf was reduced by defoliation of 3 cm or more from the tip of the second leaf blade, while the length of the third leaf blade was not affected (Fig. 4b,c).

The expression of SbDRM1 in buds repressed by progressive defoliation was analysed by qPCR. Because the expression level of SbDRM1 was up-regulated around 6 h after defoliation of the second leaf blade (Fig. 3b), we sampled buds from the first leaf axil at 6 h after defoliating 1,3 or 5 cm from the second leaf blade. The expression of SbDRM1 in the buds was slightly increased by defoliating 1 cm from the tip of the second leaf blade (Fig. 5). The expression level of SbDRM1 in the buds was significantly increased at 6 h after defoliating 3 or 5 cm. This is consistent with the inhibition of the growth of the buds by partial defoliation of the second leaf blade (Fig. 4a).

The expression of tillering, cell cycle and sucrose-responsive genes in the bud suppressed by selective defoliation

In the previous study by Kebrom et al. (2010a), the expression level of the bud dormancy marker (SbDRM1) gene was up-regulated at 2 d after complete defoliation. The expression level of the putative strigolactone receptor SbMAX2 was increased in the defoliated buds, whereas that of SbTB1

(a) 2-,

Control

•I (b)

■ Defoliated □ Control

1 6 24

Hours post-defoliation of Lb2

Figure 3. Relative expression level of the sorghum dormancy-associated (SbDRM1) gene in buds in the first leaf axil of 100M seedlings repressed by selective defoliation. (a) Expression level of SbDRM1 at 48 h after defoliation of either the first leaf blade (Lb1) or the second leaf blade (Lb2). (b) Time course expression level of SbDRM1 at 1, 6 or 24 h after defoliation of Lb2. All sampling time points were during the light period. Data are means ± SE; n = 3 biological replicates.

(b) 19 n

(c) 10 -,

■a =

Progressive defoliation of Lb2 (cm)

Figure 4. The response of axillary buds and young leaves of sorghum 100M seedlings to partial defoliation. At 6 d after planting (DAP), the first and second leaves were fully expanded and the third was young and just emerged from the ligule of the second leaf. The length of the second leaf blade (Lb2) was about 6 cm. About 1 cm from the tip of the second leaf blade was defoliated from a set of seedlings and 2 cm from a second set and so on up to 5 cm. The lengths of the bud in the first leaf axil (a) and the third (b) and fourth (c) leaves (leaf blade and sheath) were measured at 8 DAP. Data are means ± SE;n = 5.

was not altered. In addition, several markers for cell cycle progression including Histone H4 (SbHis4),proliferating cell nuclear antigen (SbPCNA), cyclin D2 (CycD2) and cyclin B (CycB) were down-regulated in buds repressed by defoliation. Because selective defoliation altered the expression level of SbDRM1 at earlier time points, we analysed the expression of the tillering and cell cycle-related genes at 1, 6, 24 and 48 h after defoliation of the second leaf blade to see if inhibition of bud outgrowth was associated with changes in the expression of these genes. In general, there was no significant difference in the expression of tillering-related genes between the buds of control and defoliated plants at all sampling time points (Fig. 6). The expression of SbMAX2 and SbTBl in buds at 24 and 48 h was slightly increased in the buds suppressed by defoliation of the second leaf blade compared with controls (Fig. 6a,c).

The expression level of cell cycle-related genes including SbHis4, SbPCNA and SbCycB was down-regulated in buds of defoliated plants at 6 h after defoliation (Fig. 7). The expression of SbHis4 and SbCycB was also lower at 24 h in buds inhibited by defoliation (Fig. 7a,d). The expression of SbCycD was also slightly reduced at 6 h post-defoliation. At 48 h after defoliation, the expression of the cell cycle genes in the buds repressed by defoliation was not different from buds in the control.

Control

Partial defoliation of Lb2 (cm)

Figure 5. Relative expression level of the sorghum dormancy-associated gene (SbDRM1) in buds at 6 h after partial defoliation of the second leaf blade. At 6 d after planting (6 DAP), the second leaf blade (Lb2) was fully expanded and about 6 cm long. It was partially defoliated about 1 cm from the tip of a set of seedlings, 3 cm from a second set of seedlings and 5 cm from a third set of seedlings. Buds from the first leaf axils of defoliated and control seedlings were sampled at 6 h post-defoliation and the expression of SbDRM1 was determined by qPCR. Data are means ± SE; n = 3 biological replicates.

It is likely that the supply of sucrose to the buds is altered by defoliation. In the dormant buds of the tin mutant of wheat, the expression of TaASl (Gln-dependent Asn synthase1), which is induced by sucrose starvation was up-regulated and a putative pyrophosphate-fructose-6-phosphate 1-phosphotransferase (PFP), which is a sucrose-inducible gene, was down regulated (Kebrom et al. 2012). These genes were

~\SbTBl ® Defoliated

□ Control

" SbMAX2 ifitt

1 6 24 48

Hours after defoliation

Figure 6. Tillering-related gene expression in axillary buds of 100M sorghum seedlings suppressed by defoliation of the second leaf blade (Lb2). The expression levels of SbTBl (a), SbGTl (b) and SbMAX2 (c) were determined at 1, 6, 24 and 48 h post-defoliation in buds in the first leaf axil of defoliated and control seedlings. All sampling time points were during the light period. Data are means ± SE; n = 3 biological replicates.

(a) 3 -|

c 2 -

% V E 1 -

es © Ml ■c <u 0 -

H u a. u (b) 2

Cfi 0

SbHis4 ■Defoliated (c) 2-.Sbc m

□ Control [

Mjii ::MH

SbPCNA (d) 2 -| SbCycB

ikM Mm

24 ' 48 Hours after defoliation

24 ' 48 Hours after defoliation

Figure 7. Cell cycle-related gene expression in axillary buds of 100M sorghum seedlings suppressed by defoliation of the second leaf blade (Lb2). The expression levels of SbHis4 (a), SbPCNA (b), SbCycD2 (c) and SbCycB (d) were determined at 1, 6,24 and 48 h post-defoliation in buds in the first leaf axil of defoliated and control seedlings. All sampling time points were during the light period. Data are means ± SE; n = 3 biological replicates.

identified as sucrose responsive in studies by Gonzali et al. (2006).The ASN1 gene in Arabidopsis is also known as dark inducible6 (DIN6) (Rolland et al. 2006).Therefore, we examined the expression of these genes in buds of defoliated and control plants at 1,6,24 and 48 h post-defoliation. The expression of the sucrose starvation-inducible gene in the buds inhibited by defoliation was up-regulated at 24 h post-defoliation (Fig. 8a). Expression of the sucrose-inducible gene was down-regulated at 6 h post-defoliation (Fig. 8b). At 48 h post-defoliation, the sucrose starvation-inducible gene was down-regulated while the expression level of sucrose-inducible gene in defoliated buds was equivalent to controls.

DISCUSSION

defoliation reduces availability of sucrose to the growing zone (Schnyder & de Visser 1999). However, factors in addition to sucrose might also influence the response of buds to defoliation. In this paper, we demonstrate the sensitivity of bud outgrowth to defoliation of the photosynthetic leaf area of the main shoot during early sorghum seedling development.

Defoliation experiments have been used in the past to study tillering or shoot branching (Murphy & Briske 1992; Zhang & Romo 1995).The effect of defoliation on the dormancy versus outgrowth fates of axillary buds depends on the developmental status of the plant (Murphy & Briske 1992). A recent study in 100M sorghum indicated that defoliation of all leaf blades at 7 DAP immediately inhibits the growth of the bud in the first leaf axil (Kebrom et al. 2010a). In the current study, to better understand the effect of defoliation on the growth of the bud in the axil of the first leaf, we selectively removed the subtending leaf blade (the first leaf blade) or any other leaf blades, one or two at a time. Defoliation of any one of the leaf blades inhibited bud outgrowth (Fig. 2). In addition, the inhibition was increased by removing two leaf blades. The results indicate that the subtending leaf blade does not have a specific role on the developmental progression of the bud. Dormancy and outgrowth of buds instead depends on the total photosyn-thetic leaf area on the main shoot.

In previous experiments in 100M sorghum plants, the expression of SbDRM1 in the buds at 48 h after defoliation of all the leaf blades was up-regulated by about 56-fold (Kebrom et al. 2006, 2010a). In the current study, when bud outgrowth was inhibited by defoliating only one of the leaf blades, the expression level of SbDRM1 was up-regulated with a peak of expression at 6 h post-defoliation, then returning to control levels 24 to 48 h post-defoliation. The trend in the expression of SbDRM1 indicates that the buds were inhibited immediately after selective defoliation and started to regrow after 24 to 48 h. The trend in the expression level of the cell

The development of axillary branches has been investigated for many decades. Most of the major hormonal and environmental factors that regulate shoot branching have been discovered (Beveridge etal. 2009; Domagalska & Leyser 2011; Kebrom et al. 2013). However, their mode of action and interaction is an active area of research because current models cannot predict with certainty transitions from dormancy to outgrowth of axillary buds in response to environmental and hormonal signals (Domagalska & Leyser 2011). A search for a branching signal that functions in the MAX pathway led to the discovery of strigolactones as a hormone that regulates branching. However, although strigolactone is a branching inhibitor, it can also promote shoot branching under some conditions (Shinohara et al. 2013). Strigolactones are also involved in several aspects of plant growth that could indirectly affect shoot branching. Recently, sucrose was rediscovered as playing a key role in shoot branching (Kebrom et al. 2012; Mason et al. 2014). Sucrose status results from complex interplay between supply and demand dependent on environmental and endogenous factors and small changes in local sucrose level may have significant impact on bud outgrowth. Sucrose is synthesized by the photosynthetic leaves and severe

Figure 8. The expression of genes responsive to sucrose level in axillary buds of 100M sorghum seedlings suppressed by defoliation of the second leaf blade (Lb2). The expression levels of SbASN1 (sucrose starvation-inducible) (a), SbPFP (sucrose-inducible) (b) were determined at 1, 6, 24 and 48 h post-defoliation in buds in the first leaf axil of defoliated and control seedlings. All sampling time points were during the light period. Data are means ± SE;n = 3 biological replicates.

cycle-related genes provides additional evidence for the recovery of buds from inhibition by selective defoliation. Most of the cell cycle-related genes were down-regulated in the buds at 6 h after defoliation. At 48 h, the expression of the cell cycle-related genes in buds from defoliated plants was similar to the level in the buds from undefoliated controls indicating that recovery from defoliation occurs within this time frame.

Defoliating 1 cm from the tip of the second leaf blade did not inhibit bud outgrowth indicating the physical act of leaf blade removal had no effect on bud outgrowth. The buds were inhibited by defoliating 2 cm or more from the tip of the second leaf blade. This inhibition was associated with up-regulation of the SbDRMl at 6 h after defoliation. In addition to the bud, the growth of the fourth leaf blade was reduced by partial defoliation. However, unlike the buds that responded to defoliation of 2 cm from the tip of the second leaf, the growth of the fourth leaf was inhibited by defoliating 3 cm. It is possible that when photosynthetic leaf area is limited, axillary buds rather than leaves in the main shoot are affected preferentially. Preferential allocation of limited resources to competing growing points is not uncommon in plants. For example, stem elongation in the tin mutant of wheat and in Fuchsia (Fuchsia hybrida) reduces sucrose supplied from the leaves to the bud and shoot apex, respectively (King & Ben-Tal 2001; Kebrom et al. 2012). Inhibition of bud outgrowth by shade signals is associated with enhanced growth of the main shoot indicating diversion of resource towards elongation growth (Kebrom et al. 2006). However, when resources are more abundant, the response could be different. In Arabidopsis, inhibition of bud outgrowth by phyB deficiency is suppressed by high light intensity (Su et al. 2011).

Hormonal and environmental signals control the dormancy and outgrowth of axillary buds by regulating the expression of genes expressed within the bud that modify tillering (Janssen et al. 2014).The inhibition of bud outgrowth in 100M sorghum by defoliating all the leaf blades was associated with increased expression of SbMAX2 (Kebrom et al. 2010a).The expression level of SbTBl was similar in buds from defoliated and undefoliated controls. In the current study, expression of SbMAX2 and SbTBl in buds at 24 and 48 h after defoliation of the second leaf blade was slightly higher than in buds from undefoliated controls. The expression of SbGtl was not altered by defoliation. In wheat and pea, the expression of Tbl -like genes in the buds was negatively correlated with the level of sucrose (Kebrom et al. 2012; Mason etal. 2014). In addition, in dormant buds of the tin mutant of wheat, the expression of sucrose-inducible gene was reduced and a sucrose starvation-inducible gene was up-regulated. The expression of orthologs of these genes was also modulated by defoliation in the current study. The sucrose-starvation gene, SbASNl, was up-regulated at 24 h post-defoliation. The sucrose-inducible gene, SbPFP, was down-regulated at 6 h post-defoliation. At 48 h post-defoliation, SbASNl RNA levels were lower than at 24 h post-defoliation and expression of SbPFP was equivalent in the buds of defoliated and undefoliated controls. Together with the expression patterns of cell cycle-related and SbDRMl genes, the results indicate induction of factors that inhibit bud outgrowth during the first

24 h post-defoliation and a return to more normal levels of these factors from 24 to 48 h post-treatment.The recovery that occurs during the latter portion of the 48 h post-defoliation period is correlated with increased photosynthetic leaf area principally because of the growth of the third and fourth leaves. Our results demonstrate that small changes in photo-synthetic leaf area cause changes in the factors that affect the propensity for outgrowth of the bud in the first leaf axil during the 48 h experimental period.

CONCLUSION

The regulation of shoot branching by hormonal and environmental signals is well established; however, their mechanisms of action are not well understood. The rediscovery of sucrose as a major factor affecting the propensity of axillary bud outgrowth provides a more complete understanding of how shoot branching is regulated during plant growth and development. Sucrose levels that affect bud outgrowth are determined by photosynthetic leaf area and factors that modulate photosynthetic activity and sucrose utilization (i.e. metabolism, growth). Using selective defoliation experiments, we demonstrate that bud outgrowth during the early seedling growth of sorghum is extremely sensitive to photosynthetic leaf area. Bud outgrowth occurs for the most part during a narrow developmental window (Cline 1997; Kebrom et al. 2006). As a consequence, a small change in leaf area or pho-tosynthetic activity may result in failure of bud outgrowth resulting lower final branch number and altered plant architecture. Therefore, the integration of sucrose into models for the regulation of shoot branching by hormonal and environmental signals should take into consideration the sensitivity of buds to fluctuations in photosynthetic activity and sucrose utilization.

ACKNOWLEDGMENT

This research was supported in part by grant number DE-SC0009885 from the Department of Energy.

REFERENCES

Aguilar-Martinez J.A., Poza-Carrion C. & Cubas P. (2007) Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds. The Plant Cell 19, 458-472. Alam M.M., Hammer G.L., van Oosterom E.J., Cruickshank A.W., Hunt C.H. & Jordan D.R. (2014) A physiological framework to explain genetic and environmental regulation of tillering in sorghum. The New Phytologist 203, 155-167.

Arite T., Iwata H., Ohshima K., Maekawa M., Nakajima M., Kojima M., . . . Kyozuka J. (2007) DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud outgrowth in rice. The Plant Journal 51,1019-1029. Bainbridge K., Sorefan K., Ward S. & Leyser O. (2005) Hormonally controlled expression of the Arabidopsis MAX4 shoot branching regulatory gene. The Plant Journal 44, 569-580. Ballard L.A.T. & Wildman S.G. (1964) Induction of mitosis by sucrose in excised + attached dormant buds of sunflower (Helianthus annuus L ). Australian Journal of Biological Sciences 17, 36-43. Ballare C.L., Scopel A.L. & Sanchez R.A. (1990) Far-red radiation reflected from adjacent leaves: an early signal of competition in plant canopies. Science 247, 329-332. BeallF.D., Morgan P.W.,ManderL.N., Miller F.R. & Babb K.H. (1991) Genetic regulation of development in sorghum bicolor: V. The ma(3) allele results in gibberellin enrichment. Plant Physiology 95,116-125.

Beveridge C.A., Dun E.A. & Rameau C. (2009) Pea has its tendrils in branching discoveries spanning a century from auxin to strigolactones. Plant Physiology 151, 985-990.

Chatfield S.P., Stirnberg P., Forde B.G. & Leyser O. (2000) The hormonal regulation of axillary bud growth in Arabidopsis. The Plant Journal 24, 159-169.

Cline M. (1997) Concepts and terminology of apical dominance. American Journal of Botany 84,1064-1069.

Cumming B.G. (1963) The dependence of germination on photoperiod, light quality, and temperature in Chenopodium spp. Canadian Journal of Botany 41, 1211-1233.

Doebley J., Stec A. & Hubbard L. (1997) The evolution of apical dominance in maize. Nature 386, 485^88.

Domagalska M.A. & Leyser O. (2011) Signal integration in the control of shoot branching. Nature Reviews. Molecular Cell Biology 12, 211-221.

Duggan B.L., Richards R.A. & Tsuyuzaki H. (2002) Environmental effects on stunting and the expression of a tiller inhibition (tin) gene in wheat. Functional Plant Biology 29, 45-53.

Dun E.A., Brewer P.B. & Beveridge C.A. (2009) Strigolactones: discovery of the elusive shoot branching hormone. Trends in Plant Science 14, 364-372.

Dun E.A., de Saint Germain A., Rameau C. & Beveridge C.A. (2012) Antagonistic action of strigolactone and cytokinin in bud outgrowth control. Plant Physiology 158, 487-498.

Dun E.A., de Saint Germain A., Rameau C. & Beveridge C.A. (2013) Dynamics of strigolactone function and shoot branching responses in Pisum sativum. Molecular Plant 6, 128-140.

Ferguson B.J. & Beveridge C.A. (2009) Roles for auxin, cytokinin, and strigolactone in regulating shoot branching. Plant Physiology 149, 19291944.

Finlayson S.A. (2007) Arabidopsis teosinte branched1-like 1 regulates axillary bud outgrowth and is homologous to monocot teosinte branched1. Plant & Cell Physiology 48, 667-677.

Finlayson S.A., Krishnareddy S.R., Kebrom T.H. & Casal J.J. (2010) Phytochrome regulation of branching in Arabidopsis. Plant Physiology 152, 1914-1927.

Gocal G.F., Pharis R.P., Yeung E.C. & Pearce D. (1991) Changes after decapitation in concentrations of indole-3-acetic acid and abscisic acid in the larger axillary bud of Phaseolus vulgaris L. cv tender green. Plant Physiology 95, 344-350.

Gonzalez-Grandio E., Poza-Carrion C., Sorzano C.O. & Cubas P. (2013) BRANCHED1 promotes axillary bud dormancy in response to shade in Arabidopsis. The Plant Cell 25, 834-850.

Gonzali S., Loreti E., Solfanelli C., Novi G., Alpi A. & Perata P. (2006) Identification of sugar-modulated genes and evidence for in vivo sugar sensing in Arabidopsis. Journal of Plant Research 119, 115-123.

Hammer G.L. (2006) Pathways to prosperity: breaking the yield barrier in sorghum. Agricultural Science 19, 16-22.

Janssen B.J., Drummond R.S. & Snowden K.C. (2014) Regulation of axillary shoot development. Current Opinion in Plant Biology 17, 28-35.

Kebrom T.H., Burson B.L. & Finlayson S.A. (2006) Phytochrome B represses teosinte branched1 expression and induces sorghum axillary bud outgrowth in response to light signals. Plant Physiology 140,1109-1117.

Kebrom T.H., Brutnell T.P. & Finlayson S.A. (2010a) Suppression of sorghum axillary bud outgrowth by shade, phyB and defoliation signalling pathways. Plant, Cell & Environment 33, 48-58.

Kebrom T.H., Brutnell T.P., Hays D.B. & Finlayson S.A. (2010b) Vegetative axillary bud dormancy induced by shade and defoliation signals in the grasses. Plant Signaling & Behavior 5, 317-319.

Kebrom T.H., Chandler P.M., Swain S.M., King R.W., Richards R.A. & Spielmeyer W. (2012) Inhibition of tiller bud outgrowth in the tin mutant of wheat is associated with precocious internode development. Plant Physiology 160, 308-318.

Kebrom T.H., Spielmeyer W. & Finnegan E.J. (2013) Grasses provide new insights into regulation of shoot branching. Trends in Plant Science 18, 41-48.

Kim H.K., van Oosterom E., Dingkuhn M., Luquet D. & Hammer G. (2010) Regulation of tillering in sorghum: environmental effects. Annals of Botany 106, 57-67.

King R.W. & Ben-Tal Y. (2001) A florigenic effect of sucrose in Fuchsia hybrida is blocked by gibberellin-induced assimilate competition. Plant Physiology 125, 488-496.

Kirby E.J.M., Appleyard M. & Fellowes G. (1985) Leaf emergence and tillering in barley and wheat. Agronomie 5, 193-200.

Kuraparthy V., Sood S. & Gill B.S. (2008) Genomic targeting and mapping of tiller inhibition gene (tin3) of wheat using ESTs and synteny with rice. Functional & Integrative Genomics 8, 33-42.

Lafarge M. (2006) Reproductive tillers in cut tall fescue swards: differences according to sward age and fertilizer nitrogen application, and relationships with the local dynamics of the sward. Grass and Forage Science 61,182-191.

Luquet D., Dingkuhn M., Kim H., Tambour L. & Clement-Vidal A. (2006) EcoMeristem, a model of morphogenesis and competition among sinks in rice. 1. Concept, validation and sensitivity analysis. Functional Plant Biology 33, 309-323.

Mason M.G., Ross J.J., Babst B.A., Wienclaw B.N. & Beveridge C.A. (2014) Sugar demand, not auxin, is the initial regulator of apical dominance. Proceedings of the National Academy of Sciences of the United States of America 111, 6092-6097.

Murphy J.S. & Briske D.D. (1992) Regulation of tillering by apical dominance - chronology, interpretive value, and current perspectives. Journal of Range Management 45, 419^29.

Prasad T.K., Li X., Abdelrahman A.M., Hosokawa Z., Cloud N.P., Lamotte C.E. & Cline M.G. (1993) Does auxin play a role in the release of apical dominance by shoot inversion in ipomoea-nil. Annals of Botany 71,223-229.

Rae G.M., David K. & Wood M. (2013) The dormancy marker DRM1/ARP associated with dormancy but a broader role in planta. Developmental Biology Journal Article ID 632524, 12 pages. doi: 10.1155/2013/632524.

Rolland F., Baena-Gonzalez E. & Sheen J. (2006) Sugar sensing and signaling in plants: conserved and novel mechanisms. Annual Review of Plant Biology 57, 675-709.

Schnyder H. & de Visser R. (1999) Fluxes of reserve-derived and currently assimilated carbon and nitrogen in perennial ryegrass recovering from defoliation. The regrowing tiller and its component functionally distinct zones. Plant Physiology 119,1423-1435.

Shen H., Luong P. & Huq E. (2007) The F-Box protein MAX2 functions as a positive regulator of photomorphogenesis in Arabidopsis (1[C][W][OA]). Plant Physiology 145, 1471-1483.

Shinohara N., Taylor C. & Leyser O. (2013) Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of the auxin efflux protein PIN1 from the plasma membrane. PLoS Biology 11, e1001474.

Stafstrom J.P., Ripley B.D., Devitt M.L. & Drake B. (1998) Dormancy-associated gene expression in pea axillary buds. Cloning and expression of PsDRM1 and PsDRM2. Planta 205, 547-552.

Stirnberg P., van de Sande K. & Leyser H.M.O. (2002) MAX1 and MAX2 control shoot lateral branching in Arabidopsis. Development (Cambridge, England) 129,1131-1141.

Su H., Abernathy S.D., White R.H. & Finlayson S.A. (2011) Photosynthetic photon flux density and phytochrome B interact to regulate branching in Arabidopsis. Plant, Cell & Environment 34, 1986-1998.

TakedaT.,SuwaY., SuzukiM.,KitanoH.,Ueguchi-TanakaM.,AshikariM.,.. . Ueguchi C. (2003) The OsTB1 gene negatively regulates lateral branching in rice. The Plant Journal 33, 513-520.

Tanaka M., Takei K., Kojima M., Sakakibara H. & Mori H. (2006) Auxin controls local cytokinin biosynthesis in the nodal stem in apical dominance. The Plant Journal 45,1028-1036.

Thimann K.V. & Skoog F. (1933) Studies on the growth hormone ofplants: III. the inhibiting action of the growth substance on bud development. Proceedings of the National Academy of Sciences of the United States of America 19, 714-716.

Thimann K.V., Skoog F. & Kerckhoff W.G. (1934) On the inhibition of bud development and other functions of growth substance in Vicia Faba. Proceedings of the Royal Society of London. Series B, Containing Papers of a Biological Character 114, 317-339.

Turnbull C.G.N., Raymond M.A.A., Dodd I.C. & Morris S.E. (1997) Rapid increases in cytokinin concentration in lateral buds of chickpea (Cicer arietinum L) during release of apical dominance. Planta 202, 271-276.

Whipple C.J., Kebrom T.H., Weber A.L., Yang F., Hall D., Meeley R., . . . Jackson D.P. (2011) Grassy tillers1 promotes apical dominance in maize and responds to shade signals in the grasses. Proceedings of the National Academy of Sciences of the United States ofAmerica 108, E506-E512.

Zhang J. & Romo J.T. (1995) Impacts of defoliation on tiller production and survival in Northern Wheatgrass. Journal of Range Management 48,115-120.

Received 17 October 2014; received in revised form 19 November

2014; accepted for publication 1 December 2014