CC BY-NC-ND
0Available online at www.sciencedirect.com ^^^^^^^^^^^^^^^
ScienceDirect PfOCGCl ¡Q
Food Science
Procedia Food Science 5 (2015) 14 - 17
International 58th Meat Industry Conference "Meat Safety and Quality: Where it goes?"
Molecular characterization of lactic acid bacteria in levacka sausage
Branka Borovica*, Branko Velebita, Slavica Veskovic Moracanina, Brankica Lakicevica,
Tatjana Baltica
aInstitute of Meat Hygiene and Technology, Kacanskog 13, 11040 Belgrade, Serbia
Abstract
Levacka sausage is traditionally fermented dry sausage which is produced in central Serbia. It is made of beef and pork with the addition of solid fat and natural spices. The whole manufacturing process lasted for 21 days. The goal of this study was to create a collection of lactic acid bacteria isolated during the fermentation and identify them using molecular methods. A total of 50 isolates from different stages of fermentation were identified by molecular methods. Pediococcuspentosaceus, Ln. mesenteroides were predominant microorganisms in levacka sausage. Lb. curvatus, Lb. sakei and Lb. carnosum were also identified.
© 2015TheAuthors. PublishedbyElsevierLtd.This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-reviewunderresponsibilityof scientificcommittee of The 58th International Meat Industry Conference (MeatCon2015) Keywords: fermented dry sausages; LAB; molecular methods
1. Introduction
For the last few decades, increasing attention has been paid to research related to the study of epiphytic microbiota in traditionally produced dry sausages, with particular emphasis on lactic acid bacteria (LAB). Traditional fermented sausages with a specific geographical origin have unique sensory characteristics and are generally of high quality1.
Quality of traditionally fermented sausage is influenced by many factors such as selection of raw material, metabolic activity of epiphytic flora and physico-chemical properties developed during ripening, smoking and
CrossMark
* Corresponding author. Tel.: +381-11-2650-655; fax: +381-11-2651-825. E-mail address: branka@inmesbgd.com
2211-601X © 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of scientific committee of The 58th International Meat Industry Conference (MeatCon2015) doi: 10.1016/j.profoo.2015.09.004
drying of meat2. The microorganisms that are most often responsible for these transformations are LAB, coagulase negative cocci (CNC) and yeasts3. Lactic acid bacteria are essential for dry sausage production. Their ability to lower the pH of the mixture by producing acid from sugars leads to the development of the desirable organoleptic properties, prevents the growth of pathogens and ensures the stability and safety of the final product4,5. Even if their initial levels varied their final levels were close to the one of industrial products manufactured with starter cultures6.
LAB isolated from traditional dry sausages belong to different genera, such as Lactobacillus, Enterococcus, Leuconostoc, Weissella, Pediocococcus, Lactococcus7,8,9,10,11,12. In traditionally fermented European sausages, facultative homofermentative lactobacilli constitute the predominant flora through ripening. Lb. sakei or/and Lb. curvatus generally dominate the fermentation process13,14,15. Other lactobacilli that may be found, albeit generally at minor levels, include Lb. plantarum, Lb. bavaricus (now reclassified as Lb. sakei or Lb. curvatus), Lb. brevis, Lb. buchneri and Lb. paracaseili'u. In order to protect the traditional approach to sausage manufacturing, it is essential to understand the microbial diversity and to select autochthonous starter cultures that can be used in the production of innovative foods with a geographical origin16. In Serbia, one of the traditional fermented dry sausages is levacka which is produced in the central Serbian region, Sumadija. Due to scarce literature data regarding microbiological profiles of this sausage, the goal of this paper was to create a collection of LAB isolated during the fermentation and complete their molecular identification.
2. Materials and methods
2.1. Levacka sausage
Levacka sausage was composed of pork, beef and fat in a percentage ratio 47%:20%:33%, respectively. Meat and fat were ground to the size of 3 mm and mixed with nitrite curing salt (2.5%), sucrose (0.33%) and spice mixture (0.25%; composed of sweet and hot red peppers, black pepper and garlic). Prepared stuffing was filled into pig small intestine (diameter of 34-36 mm). Sausages were cold smoked for 4 days. The whole manufacturing process (smoking, fermentation/ ripening and drying), in the traditional way, lasted for 21 days.
2.2. Microbiological investigation
Sausage samples for microbiology examinations were taken at 0, 2nd, 4th, 7th, 14th and 21st day. The experiment was repeated three times. Three samples at each step of sampling were collected and used for analysis.
Each sample weighing 25 g was homogenized in 225 ml of MRD (Oxoid, UK) in a stomacher (AES, France) for 90 s. Serial dilutions (10-fold) were plated onto MRS agar (Oxoid, UK) in duplicate, and incubated for 48 h at 30°C under microaerophilic conditions. From each plate, single colonies were randomly picked and streaked on new agar plates in order to obtain pure cultures. The LAB isolates from MRS agar were checked by Gram straining and catalase reaction. A total of 50 Gram-positive and catalase-negative isolates were further identified and characterized by molecular methods.
Total DNA from LAB was extracted from a single colony by using the DNeasy Blood and Tissue Kit (Qiagen GmbH, Germany) according to the manufacturer's protocol for Gram-positive bacteria.
PCR was performed in a final volume of 50 |L containing 1 x PCR buffer (10x PCR buffer: 500 mM KCl, 100 mM Tris-HCl, 0.8% Nonidet P40), 2.5 mM MgCl2, 10 ^M dNTP, 200 nM of each primer, 1 U of Taq polymerase (Fermentas, Lithuania) and 100 ng of DNA template.
The samples were amplified in a thermal cycler (Techne, UK) using primers P1V1 (GCGGCGTGCCTAATACATGC) and P4V3 (ATCTACGCATTTCACCGCTAC), complementary to the V1-V3 region of the 16S rRNA, 5 min at 95°C, 35 cycles of 1 mm at 95°C, 1 mm at 42°C, 2 min at 72°C and the final extension of 5 min at 72°C. PCR products were purified by QIAquick PCR purification kit (Qiagen, Germany) and sent for sequencing to IIT Biotech (Bielefeld, Germany). The BLAST algorithm was used to determine the most related sequence relatives in the NCBI nucleotide sequence database (http://blast.ncbi.nim.nih.gov).
3. Results and discussion
Table 1 shows LAB strains identified by molecular methods.
Table 1. LAB strains from levacka sausage identified by molecular methods.
Day of fermentation 16S rRNA gene sequencing
Ln. mesenteroides strain LHICA 53 3
Pediococcus pentosaceus isolate FB-301 16S
0 Pediococcus pentosaceus isolate: L2-2
Pediococcus pentosaceus strain CTSPLI (2 isolates)
Pediococcus pentosaceus strain YTX4BMX (2 isolates)
Lb. curvatus IMAU:10189
Lb. sakei strain CRL 1467
Ln. carnosum strain KNUC23
2 Ln. mesenteroides strain MBF5-9
Ln. mesenteroides strain SK kimchi 6 (4 isolates)
Ln. mesenteroides subsp. mesenteroides IMAU:10231
Ln. mesenteroides subsp. mesenteroides strain J9 (4 isolates)
Lb. curvatus IMAU:10284 (2 isolates)
4 Lb. curvatus strain L5
Ln. mesenteroides subsp. mesenteroides strain J9 (3 isolates)
7 Ln. mesenteroides subsp. mesenteroides strain J9 (4 isolates)
Lb. curvatus IMAU:10284
Ln. mesenteroides strain IMAU60148
Ln. mesenteroides subsp. mesenteroides strain J9 (9 isolates) Pediococcus pentosaceus strain CTSPL1 Ln. mesenteroides strain AaD8 Ln. mesenteroides strain MU10
Ln. mesenteroides subsp. mesenteroides strain J9 (5 isolates) Pediococcus pentosaceus strain YTX32BMX
The most dominant microorganisms in levacka sausage were Pediococcus pentosaceus, Ln. mesenteroides. Besides them, Lb. curvatus, Lb. sakei and Ln. carnosum were also identified, although in lower numbers.
The prevalence of Pediococcus pentosaceus, isolated from levacka sausage, was lower than prevalence of this strain in Petrovska klobasa11. However, it is in accordance with results obtained for Iberian dry sausage18 and Italian fermented sausage19. The dominant presence of Ln. mesenteroides found in levacka sausage is not in agreement with findings of authors who studied traditionally fermented sausages7,20. However, this is in accordance with results obtained for Petrovska klobasa11 in which Ln. mesenteroides, Lactobacillus and Pediococcus pentosaceus constitute the majority of the microbiota. Some of the Leuconostoc strains isolated from fermented sausages play an important role in the flavour development and could also exhibit strong antimicrobial activity21,22. Interestingly, the role of Leuconostoc species in the sausage ripening has not yet been well understood.
4. Conclusion
Results of this study showed that during the fermentation of levacka sausage, Pediococcus pentosaceus, Leuconostoc mesenteroides, Lb. curvatus, Lb. sakei and Ln. carnosum are the most dominant species.
At the beginning of the production, Pediococcus pentosaceus prevails. From the second day until the end of fermentation, the dominant strain was Leuconostoc mesenteroides. On the second day of fermentation, Lactobacillus sakei was identified. Also, isolates of Lactobacillus curvatus were identified on the second, fourth and fourteenth day. Strains of LAB isolated in this study could be used as starter cultures in fermentation of traditional dry sausages.
Acknowledgement
This research was funded by grants TR 20127 and III 46009 from the Ministry of Education, Science and Technological Development, Republic of Serbia.
References
1. Raseta M, Veskovic-Moracanin S, Borovic B, Karan D, Vranic D, Trbovic D, Lilic S. Microclimate conditions during ripening of traditionally
produced fermented sausages. Tehn mesa 2010;51(1):45-51.
2. Veskovic-Moracanin S. The influence of bactericides isolated from Leuconostoc mesenteroides E 131 and Lactobacillus sakei I 154 on Listeria
monocytogenes during production of "Sremska" sausage. MSc Thesis, Agriculture Faculty, University of Belgrade, Serbia; 2005.
3. Hutkins RW. Microorganisms and metabolism. In R. Hutkins editor. Microbiology and technology of fermented foods. Oxford: UK: Blackwell
Publishing Professional; 2006. p. 15-66.
4. Bacus JN. Fermented meat and poultry products. In: Pearson AM, Dutson TR, editors. Advances in Meat Research, Meat and Poultry Microbiology. London: Macmillan; 1986. p. 123-164.
5. Lucke FK. Fermented sausages. In: Wood BJB, editor. Microbiology of Fermented Foods. New York: Elsevier Applied Science; 1985.
6. Talon R, Leroy S, Lebert I. Microbial ecosystems of traditional fermented meat products: The importance of indigenous starters. Meat Sci
2007;77:55-62.
7. Comi G, Urso R, Iacumin L, Rantsiou K, Cattaneo P, Cantoni C, Cocolin L. Characterisation of naturally fermented sausages produced in the
North East of Italy. Meat Sci 2005;69:381- 92.
8. Drosinos E, Mataragas M, Xiraphi N, Moschonas G, Gaitis F, Metaxopoulos J. Characterization of the microbial flora from a traditional Greek
fermented sausage. Meat Sci 2005;69:307-17.
9. Rantsiou K, Drosinos EH, Gialitaki M, Urso R, Krommer J, Gasparik-Reichardt J, Toth S, Metaxopoulos I, Comi G, Cocolin L. Molecular
characterization of Lactobacillus species isolated from naturally fermented sausages produced in Greece, Hungary and Italy. Food Microbiol 2005a;22:19-28.
10. Rantsiou K, Urso R, Iacumin L, Cantoni C, Cattaneo P, Comi G. Culture dependent and independent methods to investigate the microbial ecology of Italian fermented sausages. Appl EnvironMicrob 2005 b;71:1977- 86.
11. Garriga M and Aymerich T. The microbiology of fermentation and ripening. In: Toldrá F, editor. Handbook of Fermented Meat and Poultry. Blackwell Publishing; 2007. p. 125-135.
12. Lebert I, Leroy S, Talon R. Microorganisms in traditional fermented meats. In: Toldrá F, editor. Handbook of Fermented Meat and Poultry. Blackwell Publishing; 2007. p. 113-24.
13. Aymerich T, Martín B, Garriga M, Hugas M. Microbial quality and direct PCR identification of lactic acid bacteria and nonpathogenic Staphylococci from artisanal low-acid sausages. Appl Environ Microbiol 2003;69:4583-94.
14. Papamanoli E, Tzanetakis N, Litopoulou-Tzanetaki E, Kotzekidou P. Characterization of lactic acid bacteria isolated from a Greek dry-fermented sausage in respect of their technological and probiotic properties. Meat Sci 2003;65:859-67.
15. Rantsiou K, Comi G, Cocolin L. The rpoB gene as a target for PCR DGGE analysis to follow lactic acid bacteria population dynamics during food fermentations. Food Microbiol 2004;21:481- 87.
16. Rantsiou K, Cocolin L. New developments in the study of the microbiota of naturally fermented sausages as determined by molecular methods. A review. Int J Food Microbiol 2006;108:255-67.
17. Danilovic B, Jokovic N, Petrovic Lj, Veljovic K, Tolinacki M, Savic D. The characterisation of lactic acid bacteria during the fermentation of an artisan Serbian sausage (Petrovská Klobása). Meat Sci 2011;88:668-74.
18. Benito M, Serradilla MJ, Ruiz-Moyano S, Martín A Pérez-Nevado F, Córdoba G. Rapid differentiation of lactic acid bacteria from autochthonous fermentation of Iberian dry-fermented sausages. Meat Sci 2008;80:656-61.
19. Di Cagno R, Lopez CC, Tofalo R, Gallo G, De Angelis M, Paparella A, Hammes W, Gobbetti M. Comparison of the compositional, microbiological, biochemical and volatile profile characteristics of three Italian PDO fermented sausages. Meat Sci 2008;79:224-35.
20. Urso R, Comi G, Cocolin L. Ecology of lactic acid bacteria in Italian fermented sausages: isolation, identification and molecular characterization. Syst Appl Microbiol 2006;29:671-90.
21. Lee JY, Kim CJ, Kunz B. Identification of lactic acid bacteria isolated from kimchi and studies on their suitability for application as starter culture in the production of fermented sausages. Meat Sci 2006;72:437-45.
22. Xiraphi N, Georgalaki M, Rantsiou K, Cocolin L, Tsakalidou E, Drosinos EH. Purification and characterization of a bacteriocin produced by Leuconostoc mesenteroides E131. Meat Sci 2008;80:194-203.
