Scholarly article on topic 'Exercise Training Protects Against Acute Myocardial Infarction via Improving Myocardial Energy Metabolism and Mitochondrial Biogenesis'

Exercise Training Protects Against Acute Myocardial Infarction via Improving Myocardial Energy Metabolism and Mitochondrial Biogenesis Academic research paper on "Basic medicine"

0
0
Share paper
Academic journal
Cellular Physiology and Biochemistry
OECD Field of science
Keywords
{""}

Academic research paper on topic "Exercise Training Protects Against Acute Myocardial Infarction via Improving Myocardial Energy Metabolism and Mitochondrial Biogenesis"

and Biochemistry Publ^ed onhne: August 17, 2015_

Accepted: July/ 06, 2015

© 2015 S. Karger AG, Basel www.karger.com/cpb

1421-9778/15/0371-0162$39.50/0

Karger Openaccess

This is an Open Access article licensed under the terms of the Creative Commons Attribution-Noncommercial 3.0 Unported license (CC BY-NC) (www.karger.com/OA-license), applicable to the online version of the article only. Distribution permitted for non-commercial purposes only.

Original Paper

Exercise Training Protects Against Acute Myocardial Infarction via Improving Myocardial Energy Metabolism and Mitochondrial Biogenesis

Lichan Taoa Yihua Beibc Shenghui Linad Haifeng Zhang3 Yanli Zhoua Jingfa Jiange Ping Chenbc Shutong Shena Junjie Xiaobc Xinli Lia

department of Cardiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Regeneration and Ageing Lab and Experimental Center of Life Sciences, School of Life Science, Shanghai University, Shanghai, cShanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai, department of Cardiology, Jinjiang Municipal Hospital, Jinjiang, department of Cardiology, Tongji Hospital, Tongji University School of Medicine, Shanghai, China

Key Words

Acute myocardial infarction • Exercise training • Metabolism • Mitochondria • PGC-la Abstract

Background/Aims: Acute myocardial infarction (AMI) represents a major cause of morbidity and mortality worldwide. Exercise has been proved to reduce myocardial ischemia-reperfusion (I/R) injury. However it remains unclear whether, and (if so) how, exercise could protect against AMI. Methods: Mice were trained using a 3-week swimming protocol, and then subjected to left coronary artery (LCA) ligation, and Anally sacrificed 24 h after AMI. Myocardial infarct size was examined with triphenyltetrazolium chloride staining. Cardiac apoptosis was determined by TUNEL staining. Mitochondria density was checked by Mito-Tracker immunofluorescent staining. Quantitative reverse transcription polymerase chain reactions and Western blotting were used to determine genes related to apoptosis, autophagy and myocardial energy metabolism. Results: Exercise training reduces myocardial infarct size and abolishes AMI-induced autophagy and apoptosis. AMI leads to a shift from fatty acid to glucose metabolism in the myocardium with a downregulation of PPAR-a and PPAR-y. Also, AMI induces an adaptive increase of mitochondrial DNA replication and transcription in the acute phase of MI, accompanied by an activation of PGC-la signaling. Exercise abolishes the derangement of myocardial glucose and lipid metabolism and further enhances the adaptive increase of mitochondrial biogenesis. Conclusion: Exercise training protects against AMI-induced acute cardiac injury through improving myocardial energy metabolism and enhancing the early adaptive change of mitochondrial biogenesis.

Copyright © 2015 S. Karger AG, Basel

L. Tao, Y. Bei and S. Lin contributed equally to this work.

Prof. Xinli Li Department of Cardiology, The First Affiliated Hospital of Nanjing Medical University,

and Dr. Junjie Xiao 300 Guangzhou Road, Nanjing 210029, (China); and Regeneration and Ageing Lab and

Experimental Center of Life Sciences, School of Life Science, Shanghai University, 333 Nan Chen Road, Shanghai 200444, (China)

E-Mail xinli3267_nj@hotmail.com and E-Mailjunjiexiao@shu.edu.cn

KARG ER 125

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Introduction

Acute myocardial infarction (AMI] is in many cases the first manifestation of coronary artery disease (CAD] and represents a major cause of morbidity and mortality worldwide [1-3]. The cardiac cell death comprising necrosis, apoptosis, and autophagy is one of the most important pathological features of AMI [4-8]. Cardiac cell death can be triggered by a complexity of interrelated events such as dysregulated myocardial energy metabolism and mitochondrial injury during prolonged myocardial ischemia [4-8].

Accumulating evidence indicates the protective effect of exercise against diverse cardiovascular diseases, which is supposed to be related with reduced cardiovascular risk factors, as well as improved physiological cardiac growth, cytosolic antioxidant capacity and mitochondrial viability in response to endurance exercise activity [9, 10]. Notably, exercise-based cardiac rehabilitation has been shown to improve exercise tolerance and reduce mortality in CAD patients [11-13]. Meanwhile, it has been documented in animal models that short-term exercise training (e.g. several bouts of endurance exercise] is sufficient to produce preconditioning stimuli [14-19], thus making the heart more resistant to cardiac injury following myocardial ischemia-reperfusion (I/R) [20-23]. Also, it has previously been demonstrated that long-term exercise training (e.g. 4-week voluntary exercise training] protects the heart from myocardial I/R injury via stimulation of p3-adrenergic receptor (P3-AR] and activation of nitric oxide (NO) signaling in mice [24]. However, little is known about whether, and (if so] how, long-term regular exercise training could attenuate AMI.

Here we show that mice subjected to a 3-week swimming protocol are more resistant to AMI, as indicated by reduced infarct size and attenuated cardiac cell death 24 h after the ligation of left coronary artery (LCA), where long-term exercise training improves myocardial glucose and lipid metabolism and further enhances adaptive increase of mitochondrial biogenesis following MI accompanied by an activation of PGC-la signaling.

Materials and Methods

This study was approved by the ethical committees of the Nanjing Medical University and all animal experiments were conducted under the guidelines on humane use and care of laboratory animals for biomedical research published by National Institutes of Health (No. 85-23, revised 1996].

Animals

Male C57BL/6 mice aged 10-12 weeks were purchased from Nanjing University (Nanjing, China). Mice were maintained in a temperature-controlled room on a 12/12 h light/dark cycle. Mice received a swimming training program to induce cardiac physiological hypertrophy. Briefly, mice received a ramp protocol, which lasted for 10 minutes 2 times daily and increased with 10 minutes each day until training time reached 90 minutes 2 times per day. The protocol was ended after 21 days. To induce AMI, mice received coronary artery ligation surgery after anesthetized with ketamine and sevoflurane. The left coronary artery (LCA] about 2 mm under the left auricle was ligated with 7-0 silk sutures. Twenty-four hours after the establishment of AMI, the hearts were harvested. The heart weight/body weight ratio and the heart weight/tibia length ratio were determined to evaluate exercise-induced cardiac growth. Myocardial infarct size was examined with triphenyltetrazolium chloride (TTC] staining and quantified with the ratio of area-at-risk relative to total area (AAR/Total) and the ratio of infarct size relative to AAR (INF/AAR).

Tunel staining

Heart tissues were harvested and embedded with paraffin. The 4 |im-thick tissues were subjected to TdT-mediated dUTP nick end labeling (TUNEL) staining using in situ cell death detection Kit (cat. 11684817910, Roche) according to the manufacturer's instructions.

KAKGER

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Mito-Tracker immunofluorescent staining

Primary rat neonatal cardiomyocytes were isolated and subjected to serum deprivation with or without treatment of Insulin-like Growth Factor-1 (IGF-l,0.1|iM] for 24 h. Cells were then stained with Mitotracker (Beyotime Biotechnology, Nantong, Jiangsu, China) at a concentration of 200nM for 45 minutes, and after that cells were fixed in 4% formaldehyde in pre-warmed media and stained with DAPI (Invitrogen.Carlsbad, CA, USA] to marker cell nuclei. 15-20 fields/well (400x magnification] were imaged by using confocalmicroscope (Carl Zeiss, Thuringia, Germany], Cell fluorescence intensity were measured with Zeiss software.

Western blot

The heart tissues were lysed in RIPA buffer (Beyondtime, China) containing 0.5 mM PMSF (Beyondtime, China], Western blot was done using standard 12% SDS-PAGE gel and loading 20 |ig of protein per lane, with detection by ECL system (Bio-Rad, USA) after incubated with proper antibodies. The expressions of autophagy-associated protein LC3-I/II and p62 were detected with specific primary antibodies against LC3I/II (1:1000, Cell Signaling Technology, Boston, Massachustts, USA, #4108) and p62 (1:1000, Cell Signaling Technology, Boston, Massachustts, USA, #5114). Apoptotic protein expressions were detected with primary antibodies against Bax (1:1000, Cell Signaling Technology, Boston, Massachustts, USA, #2772), Bcl-2 (1:1000, Cell Signaling Technology, Boston, Massachustts, USA, #3498), caspase-3 (1:1000, Cell Signaling Technology, Boston, Massachustts, USA, #9662), and cleaved-caspase-3 (1:1000, Cell Signaling Technology, Boston, Massachustts, USA, #9661]. PPAR-a, PPAR-y, and PGC-la expressions were measured with primary antibodies against PPAR-a (1:1000, Abeam, Cambridge, UK, ab8934], PPAR-y (1:500, Abeam, Cambridge, UK, abl9481], and PGC-la (1:1000, NOVUS, colo, Littleton, USA, NBP1-04676], GAPDH (1:10000, Kangchen] was used for loading control. All the primary antibodies were incubated overnight at 4°C.

Quantitative reverse transcription polymerase chain reactions (qRT-PCRs)

Total RNA of heart tissues was extracted using TRIZOL reagent (Invitrogen). A total of 300 ng RNA was used for cDNA synthesis with the PrimeScript RT Reagent Kit Perfect Real Time (TaKaRa, China). PCR amplification was performed with SYBR Premix ExTaq TM II (TaKaRa, China], For each sample, 18s rRNA expression was analyzed to normalize target gene expression. The utilized primers are listed in Table 1.

Table 1. List of utilized primers for qRT-PCR

Gene Species Forward Primer Reverse Primer

Atg3 mouse ACACGGTGAAGGGAAAGGC TGGTGGACTAAGTGATCTCCAG

Atg5 mouse TGTGCTTCGAGATGTGTGGTT GTCAAATAGCTGACTCTTGGCAA

Atg7 mouse GTTCGCCCCCTTTAATAGTGC TGAACTCCAACGTCAAGCGG

Beclinl mouse ATGGAGGGGTCTAAGGCGTC TCCTCTCCTGAGTTAGCCTCT

LC3 mouse GGCTACGGCTACTATCGCAC AGGAGGGCATGACAAAGGAGA

CathepsinB mouse TCCTTGATCCTTCTTTCTTGCC ACAGTGCCACACAGCTTCTTC

CathepsinD mouse GCTTCCGGTCTTTGACAACCT CACCAAGCATTAGTTCTCCTCC

GSY1 mouse GAGAACGCAGTGCTTTTCGA TCATCCCCTGTCACCTTCG

GLUT-1 mouse TCTCGGCTTAGGGCATGGAT TCTATGACGCCGTGATAGCAG

GLUT-4 mouse ACTCTTGCCACACAGGCTCT CCTTGCCCTGTCAGGTATGT

CPT-1 mouse CTCCGCCTGAGCCATGAAG CACCAGTGATGATGCCATTCT

MCAD mouse TTTCTAGATAGGTTTGGCTTTTGG ACAGAAATGCTGCTATGTCACAGT

LPL mouse GGTTGCGCGTAGAGAGGATG CTCACGCTCTGACATGCCTTC

PPAR-a mouse AGAGCCCCATCTGTCCTCTC ACTGGTAGTCTGCAAAACCAAA

PPAR-y mouse TCCTGTAAAAGCCCGGAGTAT GCTCTGGTAGGGGCAGTGA

16sRNA mouse TGCCTGCCCAGTGACTAAAGT AACAAGTGATTATGCTACCTTTGCA

ND1 mouse GCGCTTTGAGACCTGGAAAAA GGCCAGTGCGATAAAAGTTCAG

ND6 mouse GCTCAAGAAACTAATCACAGCCA GGTGGGCTTATTCTACCATTG

CYTB mouse AAGTCATGGTG G GC AACTAACTAT TGTAGTGTTGAACATCCTCTCCAT

SSBP1 mouse CAACAAATGAGATGTGGCGATCA ACGAGCTTCTTACCAGCTATGA

TWINKLE mouse TTCTCCGACGTGCATATCCC GCGCTTCTTTTCTGTACCTTCT

TOP1MT mouse GTTTCCAGCATGTCCCCTG TTGCCATCGTAGAGGAAGTGC

PLOG mouse GAGCCTGCCTTACTTGGAGG GGCTGCACCAGGAATACCA

PGC-la mouse TATGGAGTGACATAGAGTGTGCT CCACTTCAATCCACCCAGAAAG

NRF1 mouse AGCACGGAGTGACCCAAAC TGTACGTGGCTACATGGACCT

NRF2B2 mouse GCTGGGGAATTTGCACTCCAT CTGTCGGTATTTCTGGGCCTC

TFAM mouse ATTCCGAAGTGTTTTTCCAGCA TCTGAAAGTTTTGCATCTGGGT

TFB2M mouse GGCCCATCTTGCATTCTAGGG CAGGCAACGGCTCTATATTGAAG

18s rRNA mouse TCAAGAACGAAAGTCGGAGG GGACATCTAAGGGCATCAC

KARGER J

Cellular Physiology Cell Physiol Biochem 2015;37:162-175

DOI: 10.1159/000430342

and Biochemistry Published online: August 17, 2015

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Statistical analysis

Relative mRNA expression levels were calculated using the 2 AACt method. All data were presented as mean ± SEM. A Chi-squared test or one-way ANOVA was conducted to evaluate the one-way layout data. If a significant difference was observed, Bonferroni's post-hoc test was conducted to identify groups with significant differences. All analyses were performed using SPSS 19.0. A two-sided P value less than 0.05 was considered to be statistically significant.

Results

Exercise training reduces the infarct size following AMI

To determine whether long-term exercise training attenuates acute myocardial ischemia, mice were subjected to a swimming protocol for 3 weeks. At the end of training period, acute

Fig. 1. Exercise training reduces myocardial infarct size after acute myocardial infarction. Exercise training induces an increase in the heart weight/body weight ratio (A) and the heart weight/tibia length ratio (B) compared with sedentary mice regardless of the LCA ligation. Myocardial infarct size was measured with TTC staining (C] and quantified with the ratio of area-at-risk (AAR] to total area (AAR/Total] and the ratio of infarct size to AAR (INF/AAR) (D). N=6 per group. **, p<0.01; ***, p<0.001.

KARGER

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Fig. 2. Exercise training attenuates acute myocardial infarction induced autophagy. (A) mRNA levels of au-tophagy-associated genes. N=6 per group. Western blot (B) and quantitative analysis (C) for protein levels of LC3A/BI, LC3A/BII and p62 relative to GAPDH. N=3 per group. *, p<0.05; **, p<0.01; ***, p<0.001.

myocardial ischemia was induced by LCA ligation and 24 h later the subsequent infarction was evaluated. Exercised mice displayed an increase in the heart weight/body weight ratio and the heart weight/tibia length ratio compared with sedentary mice regardless of the LCA ligation, indicative of a physiological cardiac growth due to endurance exercise (Fig. 1A and B). Exercise was associated with a reduction in the infarct size as demonstrated by TTC staining (Fig. 1C and D).

Exercise training attenuates AMI-induced autophagy and apoptosis

Permanent myocardial ischemia induces autophagy and apoptosis of cardiomyocytes [6]. In this work, the autophagy-associated genes, including Atg3, Atg5, Atg7, Beclin1, LC3, cathepsin B and cathepsin D, were significantly induced 24 h after LCA ligation (Fig. 2A). Meanwhile, immunoblotting analysis showed that the conversion of LC3 from LC3I to LC3II was increased, while the expression of p62, a selective autophagy substrate, was downregulated in hearts subjected to LCA ligation (Fig. 2B and C). Markedly, exercise training reversed upregulation of autophagy-associated genes (Fig. 2A), and was associated with reduced conversion of LC3I/II and increased protein level of p62 (Fig. 2B and C) in

KARGER

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Fig. 3. Exercise training reverses acute myocardial infarction induced apoptosis. (A) TUNEL staining for evaluation of the apoptosis in the heart. N=6 per group.Scale bar, 20|im. (B] Western blot analysis for the ratio of Bax/ Bcl-2 and the ratio of cleaved-cas-pase3/caspase3 at protein levels. N=3 per group. *, p<0.05; **, p<0.01; ***, p<0.001.

the hearts with myocardial ischemia, indicating that AMI-induced autophagy was attenuated by exercise training. Meanwhile, Tunel staining was performed to evaluate the apoptosis in the heart and the protein levels of pro-apoptotic Bax and anti-apoptotic Bcl-2, as well as the caspase-3 activation (cleaved-caspase 3 relative to caspase 3) were measured with immunoblotting. AMI caused an increase in the TUNEL positive cells (%] as well as an increase in the Bax/Bcl-2 ratio and the cleaved-caspase 3/caspase 3 ratio at protein level in heart tissues, which was abolished by exercise training (Fig. 3A and B).

Exercise training abrogates glucose and fatty acid metabolic changes in ischemic hearts

Myocardial enzymes related to glucose and fatty acid metabolism change rapidly after myocardial ischemia with and without reperfusion, which can be importantly regulated by peroxisome proliferator-activated receptors (PPAR) [25-29]. Here we demonstrated that the mRNA levels of glucose transporter (GLUT]-1 and glycogen synthase 1 (GSY1] were significantly induced in ischemic hearts, despite unchanged expression of GLUT-4 (Fig. 4A). Meanwhile, the enzymes involved in fatty acid metabolism, including carnitine

KARGER

and Biochemistry published onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Fig. 4. Exercise improves myocardial glucose and fatty acid metabolism following acute myocardial infarction. (A) mRNA levels of transporters and enzymes involved in glucose metabolism. (B) mRNA levels of enzymes involved in fatty acid metabolism. mRNA (C] and protein (D] levels of PPAR-a and PPAR-y. N=6 for qPCRs and N=3 for Western blot per group. *, p<0.05; **, p<0.01; ***, p<0.001.

palmitoyltransferase 1 (CPT1), medium-chain acyl-CoA dehydrogenase (MCAD), and lipoprotein lipase (LPL) were downregulated in the hearts subjected to LCA ligation (Fig. 4B], In addition, myocardial ischemia was associated with a downregulation of PPAR-a and PPAR-y at mRNA and protein levels (Fig. 4C and D], All of these changes were reversed by exercise training (Fig. 4A-D).

Adaptive increase of mitochondrial biogenesis and activation ofPGC-la pathway following AMI is further induced by exercise training

Although impaired mitochondrial biogenesis following AMI is responsible for altered energy production in hearts, the adaptive regulation of mitochondrial biology in the acute phase after myocardial ischemia is largely unknown. Our results demonstrated that mtDNA encoded genes (16sRNA, ND1, and ND6], as well as genes involved in mtDNA replication

KARGER

and Biochemistry published onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

d control □ swim

■ control+AMI

■ swim+AMI

□ control a swim !■ control+AMI ■ swim+AMI

control control+IGF-1

serum deprivation 4 scrum ilcprivation+IGF-1

( "«sfr

Fig. 5. Exercise enhances the adaptive increase of mitochondrial biogenesis in the acute phase of AMI. (A) mRNA levels of mtDNA encoded genes. (B) mRNA levels of genes involved in mtDNA replication. (C) Representative images and quantitative analysis of immunofluorescent staining for mitochondria. AMI, mimicked by serum deprivation; Exercise, mimicked by Insulin-like Growth Factor-1 treatment. N=6 for qPCRs and

N=3 for immunofluorescence per group. *, p<0.05; **, p<0.01; ***, p<0.001.

(SSBP1, TWINKLE, TOP1MT, and PLOG), were upregulated in hearts 24 h after AMI (Fig. 5A and B). Noteworthy, the genes encoding 16sRNA, ND1, ND6, CYTB, T0P1MT and PLOG were induced to a greater extent in exercised mice with AMI (Fig. 5A and B). Meanwhile, immunofluorescent staining for mitochondria showed that the mitochondria fluorescence intensity was markedly increased by serum deprivation mimicking AMI in vitro, which was further enhanced with IGF-1 treatment mimicking exercise (Fig. 5C). These data indicate that the adaptive increase of mitochondria biogenesis could be further enhanced by exercise training.

As PGC-la is a key regulator of mitochondrial biology which can be induced by exercise, and plays critical roles in the metabolic control of myocardium in cardiac diseases [30, 31], we further investigated the PGC-la cascade in ischemic hearts with and without exercise. In the present study, AMI was associated with an upregulation of PGC-la at both mRNA and protein levels (Fig.6A and B). In addition, its downstream transcription factors such as NRF2B2, TFAM and TFB2M were also upregulated at mRNA level in ischemic hearts (Fig. 6A). The gene expressions of PGC-la, NRF2B2 and TFAM were further induced in exercised mice with AMI (Fig. 6A], Although cardiac NRF1 gene expression was not significantly changed in ischemic hearts, its mRNA level was markedly upregulated by exercise in mice subjected to LCA ligation (Fig. 6A).

KAR.GER.

and Biochemistry Published onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Fig. 6. PGC-la pathway is activated to a greater extent in the acute phase of AMI. (A) mRNA levels of PGC-la and its downstream effectors. (B) Western blot and quantitative analysis for protein level of PGC-la. N=6 for qPCRs and N=3 for Western blot per group. *, p<0.05; **, p<0.01; ***, p<0.001.

Discussion

Although exercise has been shown to be effective to reduce I/R-induced myocardial injury, it remains unclear whether long-term regular exercise training could attenuate acute cardiac injury following myocardial ischemia. Here we demonstrate that a 3-week swimming training reduces infarct size and attenuates the apoptosis and autophagy of cardiomyocytes. The cardioprotective effect of exercise is attributable to improved myocardial glucose and lipid metabolism, as well as enhanced adaptive increase of mitochondrial biogenesis, which is accompanied by PGC-la activation.

It is known that the autophagy is induced in the acute phase of MI as an adaptive response of the heart to protect itself from cardiac injury [32, 33]. In the current study, we show that AMI upregulates a set of autophagy-associated genes and increases the conversion of LC3I/ II and p62 degradation, indicative of augmented autophagy 24 h after LCA ligation. However, long-term exercise training significantly reduces myocardial infarct size and abolishes the induction of autophagy in mice with AMI, which might be an important phenomenon of reduced myocardial injury due to exercise activity. The increased apoptosis is a hallmark of the loss of cardiomyocytes during AMI [34, 35]. It has previously been demonstrated that Bax deficiency or Bcl-2 overexpressingmice displayed reduced infarct size after MI [36, 37].

KARGER.

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

Noteworthy, our data show that the AMI-induced increase in Bax/Bcl2 ratio and caspase3 cleavage can also be attenuated by exercise training, suggesting that the exercise-induced cardioprotection against AMI is at least in part attributable to reduced apoptosis.

Cardiac ischemia has a strong influence on myocardial glucose and fatty acid metabolism [38]. The upregulation of GLUT-1 has been widely demonstrated in acute myocardial ischemia with and without reperfusion [25-27, 39], although the expression of GLUT-4 could be either upregulated [25] or downregulated [26] due to different animal models of myocardial ischemia. In the present study, we show that GLUT-1 was markedly induced in hearts with AMI, while no significant change was found with GLUT-4. Meanwhile, we found that GSY1, an enzyme involved in glucose metabolism, was also induced in mice subjected to LCA ligation. In addition to increased glucose uptake and metabolism, the downregulation of genes encoding enzymes involved in fatty acid metabolism has previously been reported in hearts with AMI [27, 28]. Consistently, we detected a reduction in the expression of CPT-1, MCAD and LPL in ischemic hearts, indicative of impaired fatty acid transport and oxidation during AMI. Genes encoding enzymes of glucose and fatty acid metabolism are transcriptionally regulated by PPAR [40-42]. Although some studies fail to show a cardioprotective effect of PPAR activation in myocardial ischemia [43-45], some lines of evidence indicates that agonists of PPAR-a or PPAR-y are beneficial to protect the heart from ischemia injury [4648]. Here we detected a downregulation of PPAR-a and PPAR-y at both mRNA and protein levels in hearts with AMI. Intriguingly, we found that AMI-induced derangement of cardiac metabolism as well as impaired expression of PPAR-a and PPAR-y could be remarkably reversed by exercise training. These data indicate that long-term exercise training could be an effective way to improve cardiac glucose and fatty acid metabolism in AMI, although the potential roles of PPAR-a and PPAR-y need to be further elucidated.

A decline in mitochondrial biogenesis and function plays a key role in the development of heart failure after MI [23]. Of note, previous studies particularly focused on the mitochondrial impairment during the late stage of MI (e.g. several weeks after establishment of MI] [49, 50], whereas the early change of mitochondria in the acute phase of MI remains largely unclear. In the current study, we detected an increase in mtDNA encoded gene expressions and an upregulation of genes involved in mtDNA replication 24 h after LCA ligation. These data reveal that mitochondria might have a rapid adaption to AMI through increasing mtDNA replication and transcription. Furthermore, we demonstrated that long-term exercise training could further enhance mtDNA biogenesis in mice with AMI. Knowing that the impaired mitochondrial biogenesis is a central mechanism responsible for myocardial injury following MI, we propose that the early change of mitochondrial replication and transcription might probably be a beneficial response in the acute phase of MI which could be further enhanced by exercise. PGC-la is a master transcriptional regulator of mitochondrial biology, which can be induced by exercise [51]. Decreased cardiac PGC-la level has been demonstrated in the late stage of MI in rats [52]. However, it has also been reported that PGC-la could be induced and detected in the blood samples of patients 72 h after the onset of an ST-segment elevation AMI, which is supposed to be a cellular response to AMI and probably serves as a potential marker for cardiac recovery capacity after AMI [53]. In the present study, we found that the enhanced mitochondrial biogenesis in the acute phase of AMI was accompanied with an induction of PGC-la. Importantly, the AMI-induced upregulation of PGC-la could be further enhanced by exercise, suggesting that long-term exercise might be beneficial to enhance the early adaptive response of mitochondrial biogenesis in the acute phase of AMI which might be related to an upregulation of PGC-la.

It has to be mentioned that the protective effect of exercise against the acute myocardial injury following AMI should be more complex than involving myocardial energy metabolism and mitochondrial biogenesis. It has recently been reported that telocytes, a novel interstitial cell type, with extremely long and thin processes, play important roles in tissue repair and regeneration [54-58]. Telocytes have been found to be decreased in myocardium during AMI and increased number of telocytes was beneficial to induce angiogenesis and reduce myocardial infarction [59-61]. Besides that, although the current study shows that

KARGER.

and Biochemistry published onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

exercise exerts protection against acute myocardial injury after AMI, the effect of exercise in ameliorating the adverse remodeling after permanent occlusion of coronary arteries still remains to be explored. Finally, though we have showed data based on TUNEL stainings, it would be interesting to use PI uptake to show directly cell death differences in the future.

In summary, the present study shows that long-term exercise training exerts cardioprotective effects to reduce infarct size and attenuates cardiomyocyte apoptosis and autophagy in the acute phase of AMI. Furthermore, exercise training improves myocardial glucose and lipid metabolism and further enhances the adaptive increase of mitochondrial biogenesis in response to AMI which is accompanied by an induction of PGC-la. Further knowledge on the molecular mechanisms that mediate protective effects of exercise against AMI might enable us to develop novel pharmacological strategies to salvage cardiac function in the acute phase of AMI.

Acknowledgments

This work was supported by the grants from National Natural Science Foundation of China (81370332 and 81170201 to XL Li, 81200169 to JJ Xiao), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD20102013 to XL Li), Innovation Program of Shanghai Municipal Education Commission (13YZ014 to JJ Xiao], Foundation for University Young Teachers by Shanghai Municipal Education Commission (year 2012, to JJ Xiao), Innovation fund from Shanghai University (sdcx2012038 to JJ Xiao), and Program for the integration of production, teaching and research for University Teachers supported by Shanghai Municipal Education Commission (year 2014, to JJ Xiao). Dr XL Li is an Associate Fellow at the Collaborative Innovation Center For Cardiovascular Disease Translational Medicine.

Disclosure Statement

The authors declare there are no conflicts of interest.

References

1 White HD, Chew DP: Acute myocardial infarction. The Lancet 2008;372:570-584.

2 Dominguez-Rodriguez A, Abreu-Gonzalez P, Reiter RJ: Cardioprotection and pharmacological therapies in acute myocardial infarction: Challenges in the current era. World J Cardiol 2014;6:100-106.

3 Gill R, Kuriakose R, Gertz ZM, Salloum FN, Xi L, Kukreja RC: Remote ischemic preconditioning for myocardial protection: update on mechanisms and clinical relevance. Mol Cell Biochem 2015;402:41-49.

4 Shah B, Amoroso NS, Sedlis SP: Hyperglycemia in nondiabetic patients presenting with acute myocardial infarction. Am J Med Sci 2012;343:321-326.

5 Ong SB, Hall AR, Hausenloy DJ: Mitochondrial dynamics in cardiovascular health and disease. Antioxid Redox Signal 2013;19:400-414.

6 Tian XF, Cui MX, Yang SW, Zhou YJ, Hu DY: Cell death, dysglycemia and myocardial infarction. Biomed Rep 2013;1:341-346.

7 Melo SF, Fernandes T, Barauna VG, Matos KC, Santos AA, Tucci PJ, Oliveira EM: Expression of MicroRNA-29 and Collagen in Cardiac Muscle after Swimming Training in Myocardial-Infarcted Rats. Cell Physiol Biochem. 2014;33:657-669.

8 Wang R, Liu YY, Liu XY, Jia SW, Zhao J, Cui D, Wang L: Resveratrol protects neurons and the myocardium by reducing oxidative stress and ameliorating mitochondria damage in a cerebral ischemia rat model. Cell Physiol Biochem. 2014;34:854-864.

9 Ellison GM, Waring CD, Vicinanza C, Torella D: Physiological cardiac remodelling in response to endurance exercise training: cellular and molecular mechanisms. Heart Br Card Soc 2012;98:5-10.

KARG EH J

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

10 Weiner RB, Baggish AL: Exercise-induced cardiac remodeling. Prog Cardiovasc Dis 2012;54:380-386.

11 Heran BS, Chen JM, Ebrahim S, Moxham T, Oldridge N, Rees K, Thompson DR, Taylor RS: Exercise-based cardiac rehabilitation for coronary heart disease. Cochrane Database Syst Rev 2011:CD001800.

12 Lawler PR, Filion KB, Eisenberg MJ: Efficacy of exercise-based cardiac rehabilitation post-myocardial infarction: a systematic review and meta-analysis of randomized controlled trials. Am Heart J 2011;162:571-584.

13 O'Connor GT, Buring JE, Yusuf S, Goldhaber SZ, Olmstead EM, Paffenbarger RS, Hennekens CH: An overview of randomized trials of rehabilitation with exercise after myocardial infarction. Circulation 1989;80:234-244.

14 Frasier CR, Moukdar F, Patel HD, Sloan RC, Stewart LM, Alleman RJ, La Favor JD, Brown DA: Redox-dependent increases in glutathione reductase and exercise preconditioning: role of NADPH oxidase and mitochondria. Cardiovasc Res 2013;98:47-55.

15 French JP, Hamilton KL, Quindry JC, Lee Y, Upchurch PA, Powers SK: Exercise-induced protection against myocardial apoptosis and necrosis: MnSOD, calcium-handling proteins, and calpain. FASEB J 2008;22:2862-2871.

16 Lee Y, Min K, Talbert EE, Kavazis AN, Smuder AJ, Willis WT, Powers SK: Exercise protects cardiac mitochondria against ischemia-reperfusion injury. Med Sci Sports Exerc 2012;44:397-405.

17 Lennon SL, Quindry J, Hamilton KL, French J, Staib J, Mehta JL,Powers SK: Loss of exercise-induced cardioprotection after cessation of exercise. J Appl Physiol 2004;96:1299-1305.

18 Quindry JC, Hamilton KL, French JP, Lee Y, Murlasits Z, Turner N, Powers SK: Exercise-induced HSP-72 elevation and cardioprotection against infarct and apoptosis. J Appl Physiol 2007;103:1056-1062.

19 Quindry JC, Miller L, McGinnis G, Kliszczewicz B, Irwin JM, Landram M, Urbiztondo Z, Nanayakkara G, Amin R: Ischemia reperfusion injury, KATP channels, and exercise-induced cardioprotection against apoptosis. J Appl Physiol 2012;113:498-506.

20 Frasier CR, Moore RL, Brown DA: Exercise-induced cardiac preconditioning:how exercise protects your achy-breaky heart. J Appl Physiol 2011;111:905-915.

21 Kavazis AN: Exercise preconditioning of the myocardium. Sports Med Auckl NZ 2009;39:923-935.

22 Powers SK, Quindry JC, Kavazis AN: Exercise-induced cardioprotection against myocardial ischemia-reperfusion injury. Free Radic Biol Med 2008;44:193-201.

23 Powers SK, Smuder AJ, Kavazis AN, Quindry JC: Mechanisms of exercise-induced cardioprotection. Physiol Bethesda Md 2014;29:27-38.

24 Calvert JW, Condit ME, Aragon JP, Nicholson CK, Moody BF, Hood RL, Sindler AL, Gundewar S, Seals DR, Barouch LA, Lefer DJ: Exercise protects against myocardial ischemia-reperfusion injury via stimulation of p(3)-adrenergic receptors and increased nitric oxide signaling: role of nitrite and nitrosothiols. Circ Res 2011;108:1448-1458.

25 Feldhaus LM, Liedtke AJ: mRNA expression of glycolytic enzymes and glucose transporter proteins in ischemic myocardium with and without reperfusion. J Mol Cell Cardiol 1998;30:2475-2485.

26 Tardy-Cantalupi I, Montessuit C, Papageorgiou I, Remondino-Muller A, Assimacopoulos-Jeannet F, Morel DR, Lerch R: Effect of transient ischemia on the expression of glucose transporters GLUT-1 and GLUT-4 in rat myocardium. J Mol Cell Cardiol 1999;31:1143-1155.

27 Rosenblatt-Velin N, Montessuit C, Papageorgiou I, Terrand J, Lerch R: Postinfarction heart failure in rats is associated with upregulation of GLUT-1 and downregulation of genes of fatty acid metabolism. Cardiovasc Res 2001;52:407-416.

28 Yue T, Bao W, Jucker BM, Gu J, Romanic AM, Brown PJ, Burns-Kurtis CL, Mirabile RC, Aravinhan K, Ohlstein EH: Activation of peroxisome proliferator-activated receptor-alpha protects the heart from ischemia/ reperfusion injury. Circulation 2003;108:2393-2399.

29 Ravingerova T, Carnicka S, Ledvenyiova V, Barlaka E, Galatou E, Chytilova A, Mandikova P, Nemcekova M, Adameova A, Kolar F, Lazou A: Upregulation of genes involved in cardiac metabolism enhances myocardial resistance to ischemia/reperfusion in the rat heart. Physiol Res 2013;62:S151-S163.

30 Ventura-Clapier R, Gamier A, Veksler V: Transcriptional control of mitochondrial biogenesis: the central role of PGC-1alpha. Cardiovasc Res 2008;79:208-217.

31 Rowe GC, Jiang A, Arany Z: PGC-1 coactivators in cardiac development and disease. Circ Res 2010;107:825-838.

KAR.GER

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

32 Wu X, He L, Chen F, He X, Cai Y, Zhang G, Yi Q, He M, Luo J: Impaired autophagy contributes to adverse cardiac remodeling in acute myocardial infarction. PloS One 2014;9:e112891.

33 Kanamori H, Takemura G, Goto K, Maruyama R, Ono K, Nagao K, Tsujimoto A, Ogino A, Takeyama T, Kawaguchi T, Watanabe T, Kawasaki M, Fujiwara T, Fujiwara H, Seishima M, Minatoguchi S: Autophagy limits acute myocardial infarction induced by permanent coronary artery occlusion. Am J Physiol Heart Circ Physiol 2011;300:H2261-H2271.

34 Olivetti G, Quaini F, Sala R, Lagrasta C, Corradi D, Bonacina E, Gambert SR, Cigola E, Anversa P: Acute myocardial infarction in humans is associated with activation of programmed myocyte cell death in the surviving portion of the heart. J Mol Cell Cardiol 1996;28:2005-2016.

35 Fliss H, Gattinger D: Apoptosis in ischemic and reperfused rat myocardium. Circ Res 1996;79:949-956.

36 Chen Z, Chua CC, Ho YS, Hamdy RC, Chua BH: Overexpression of Bcl-2 attenuates apoptosis and protects against myocardial I/R injury in transgenic mice. Am J Physiol Heart Circ Physiol 2001;280:H2313-H2320.

37 Hochhauser E, Cheporko Y, Yasovich N, Pinchas L, Offen D, Barhum Y, Pannet H, Tobar A, Vidne BA, Birk E: Bax deficiency reduces infarct size and improves long-term function after myocardial infarction. Cell Biochem Biophys 2007;47:11-20.

38 Stanley WC, Recchia FA, Lopaschuk GD: Myocardial substrate metabolism in the normal and failing heart. Physiol Rev 2005;85:1093-1129.

39 Egert S, Nguyen N, Schwaiger M: Myocardial glucose transporter GLUT1: translocation induced by insulin and ischemia. J Mol Cell Cardiol 1999;31: 1337-1344.

40 Finck BN, Lehman JJ, Leone TC, Welch MJ, Bennett MJ, Kovacs A, Han X, Gross RW, Kozak R, Lopaschuk GD, Kelly DP: The cardiac phenotype induced by PPARalpha overexpression mimics that caused by diabetes mellitus. J Clin Invest 2002;109:121-130.

41 Robinson E, Grieve DJ: Significance of peroxisome proliferator-activated receptors in the cardiovascular system in health and disease. Pharmacol Ther 2009;122:246-263.

42 Finck BN: The PPAR regulatory system in cardiac physiology and disease. Cardiovasc Res 2007;73:269-277.

43 Duerr GD, Heinemann JC, Arnoldi V, Feisst A, Kley J, Ghanem A, Welz A, Dewald 0: Cardiomyocyte specific peroxisome proliferator-activated receptor-a overexpression leads to irreversible damage in ischemic murine heart. Life Sci 2014;102:88-97.

44 Sambandam N, Morabito D, Wagg C, Finck BN, Kelly DP, Lopaschuk GD: Chronic activation of PPARalpha is detrimental to cardiac recovery after ischemia. Am J Physiol Heart Circ Physiol 2006;290:H87-H95.

45 Xu Y, Lu L, Greyson C, Rizeq M, Nunley K, Wyatt B, Bristow MR, Long CS, Schwartz GG: The PPAR-alpha activator fenofibrate fails to provide myocardial protection in ischemia and reperfusion in pigs. Am J Physiol Heart Circ Physiol 2006;290:H1798-1807.

46 Ito H, Nakano A, Kinoshita M, Matsumori A: Pioglitazone, a peroxisome proliferator-activated receptor-gamma agonist, attenuates myocardial ischemia/reperfusion injury in a rat model. Lab Investig 2003;83:1715-1721.

47 Yue T1TL, Chen J, Bao W, Narayanan PK, Bril A, Jiang W, Lysko PG, Gu JL, Boyce R, Zimmerman DM, Hart TK, Buckingham RE, Ohlstein EH: In vivo myocardial protection from ischemia/reperfusion injury by the peroxisome proliferator-activated receptor-gamma agonist rosiglitazone. Circulation 2001;104:2588-2594.

48 Wayman NS, Ellis BL, Thiemermann C: Ligands of the peroxisome proliferator-activated receptor-PPAR-a reduce myocardial infarct size. Med Sci Monit 2002;8:BR243-BR247.

49 Ikeuchi M, Matsusaka H, Kang D, Matsushima S, Ide T, Kubota T, Fujiwara T, Hamasaki N, Takeshita A, Sunagawa K, Tsutsui H: Overexpression of mitochondrial transcription factor a ameliorates mitochondrial deficiencies and cardiac failure after myocardial infarction. Circulation 2005;112:683-690.

50 Kemi OJ, H0ydal MA, Haram PM, Gamier A, Fortin D, Ventura-Clapier R, Ellingsen 0: Exercise training restores aerobic capacity and energy transfer systems in heart failure treated with losartan. Cardiovasc Res 2007;76:91-99.

51 Schilling J, Kelly DP: The PGC-1 cascade as a therapeutic target for heart failure. J Mol Cell Cardiol 2011;51:578-583.

52 Sun CK, Chang LT, Sheu JJ, Wang CY, Youssef AA, Wu CJ, Chua S, Yip HK: Losartan preserves integrity of cardiac gap junctions and PGC-1 alpha gene expression and prevents cellular apoptosis in remote area of left ventricular myocardium following acute myocardial infarction. Int Heart J 2007;48: 533- 546.

KARGER

and Biochemistry Publ^ed onhne: August 17, 2015_

Tao et al.: Exercise Prevents Acute Myocardial Infarction in Mice

53 Fabregat-Andres 0, Tierrez A, Mata M, Estornell-Erill J, Ridocci-Soriano F, Monsalve M: Induction of PGC-la expression can be detected in blood samples of patients with ST-segment elevation acute myocardial infarction. PloS One 2011;6:e26913.

54 Cretoiu D, Hummel E, Zimmermann H, Gherghiceanu M, Popescu LM: Human cardiac telocytes: 3D imaging by FIB-SEM tomography. J Cell Mol Med 2014; 18:2157-2164.

55 Popescu LM, Curici A, Wang E, Zhang H, Hu S, Gherghiceanu M: Telocytes and putative stem cells in ageing human heart. J Cell Mol Med 2015;19:31-45.

56 Cismajiu VB, Popescu LM: Telocytes transfer extracellular vesicles loaded with microRNAs to stem cells. J Cell Mol Med 2015;19:351-358.

57 Tao L, Wang H, Wang X, Kong X, Li X: Cardiac Telocytes. Curr Stem Cell Res Ther 2015.

58 Zheng Y, Cretoiu D, Yan G, Cretoiu SM, Popescu LM, WangX: Comparative proteomic analysis of human lung telocytes with fibroblasts. J Cell Mol Med 2014;18:568-589.

59 Manole CG, Cismajiu V, Gherghiceanu M, Popescu LM: Experimental acute myocardial infarction: telocytes involvement in neo-angiogenesis. J Cell Mol Med 2011;15:2284-2296.

60 Zhao B, Chen S, Liu J, Yuan Z, Qi X, Qin J, Chan JY, Cai D: Cardiac telocytes were decreased during myocardial infarction and their therapeutic effects for ischaemic heart in rat. J Cell Mol Med 2013;17:123-133.

61 Zhao B, Liao Z, Chen S, Yuan Z, Yilin C, Lee KKH, Qi X, Shen X, Zheng X, Quinn T, Cai D: Intramyocardial transplantation of cardiac telocytes decreases myocardial infarction and improves post-infarcted cardiac function in rats. J Cell Mol Med 2014;18:780-789.

KARGER