Scholarly article on topic 'Exercise Prevents Cardiac Injury and Improves Mitochondrial Biogenesis in Advanced Diabetic Cardiomyopathy with PGC-1a and Akt Activation'

Exercise Prevents Cardiac Injury and Improves Mitochondrial Biogenesis in Advanced Diabetic Cardiomyopathy with PGC-1a and Akt Activation Academic research paper on "Basic medicine"

0
0
Share paper
Academic journal
Cellular Physiology and Biochemistry
OECD Field of science
Keywords
{""}

Academic research paper on topic "Exercise Prevents Cardiac Injury and Improves Mitochondrial Biogenesis in Advanced Diabetic Cardiomyopathy with PGC-1a and Akt Activation"

Cellular Physiology Ce" Physiol Biochem 2015;35:2159-2168

DOI: 10.1159/000374021

and Biochemistry ^ns^d onnne: Apri1 07, 2015

© 2015 S. Karger AG, Basel www.karger.com/cpb

Karger Open access

Accepted: February 13, 2015

1421-9778/15/0356-2159S39.50/0

This is an Open Access article licensed under the terms of the Creative Commons Attribution-NonCommercial 3.0 Unported license (CC BY-NC) (www.karger.com/OA-license), applicable to the online version of the article only. Distribution permitted for non-commercial purposes only.

Original Paper

Exercise Prevents Cardiac Injury and Improves Mitochondrial Biogenesis in Advanced Diabetic Cardiomyopathy with PGC-1a and Akt Activation

Hui Wanga Yihua Beibc Yan Lua Wei Suna Qi Liud Yalong Wangbc Yujie Caobc Ping Chenb,c Junjie Xiaob,c Xiangqing Konga

aDepartment of Cardiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Regeneration and Ageing Lab and Experimental Center of Life Sciences, School of Life Science, Shanghai University, Shanghai, cShanghai Key Laboratory of Bio-Energy Crops, School of Life Science, Shanghai University, Shanghai, dDepartment of Endocrinology, Tongji Hospital, Tongji University School of Medicine, Shanghai, China

Key Words

Diabetic cardiomyopathy • Exercise • Mitochondria • PGC-1a • Akt Abstract

Background/Aims: Diabetic cardiomyopathy (DCM) represents the major cause of morbidity and mortality among diabetics. Exercise has been reported to be effective to protect the heart from cardiac injury during the development of DCM. However, the potential cardioprotective effect of exercise in advanced DCM remains unclear. Methods: Seven-week old male C57BL/6 wild-type or db/db mice were either subjected to a running exercise program for 15 weeks or kept sedentary. Cardiac function, myocardial apoptosis and fibrosis, and mitochondrial biogenesis were examined for evaluation of cardiac injury. Results: A reduction in ejection fraction and fractional shortening in db/db mice was significantly reversed by exercise training. DCM induced remarkable cardiomyocyte apoptosis and increased ratio of Bax/Bcl-2 at the protein level. Meanwhile, DCM caused slightly myocardial fibrosis with elevated mRNA levels of collagen I and collagen III. Also, DCM resulted in a reduction of mitochondrial DNA (mtDNA) replication and transcription, together with reduced mtDNA content and impaired mitochondrial ultrastructure. All of these changes could be abolished by exercise training. Furthermore, DCM-associated inhibition of PGC-1a and Akt signaling was significantly activated by exercise, indicating that exercise-induced activation of PGC-1a and Akt signaling might be responsible for mediating cardioprotective effect of exercise in DCM. Conclusion: Exercise preserves cardiac function, prevents myocardial apoptosis and fibrosis, and improves mitochondrial biogenesis in the late stage of dCm. Exercise-induced activation of PGC-1a and Akt signaling might be promising therapeutic targets for advanced DCM.

Copyright © 2015 S. Karger AG, Basel

H. Wang, Y. Bei and Y. Lu contributed equally to this work.

Prof. Xiangqing Kong Department of Cardiology, The First Affiliated Hospital of Nanjing Medical University,

and Dr. Junjie Xiao 300 Guangzhou Road, Nanjing 210029, (China) and Regeneration and Ageing Lab and

Experimental Center of Life Sciences, School of Life Science, Shanghai University, 333 Nan Chen Road, Shanghai 200444, (China) E-Mail xiangqingkong_nj@163.com, E-Mail junjiexiao@shu.edu.cn

KARGEM 25

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2160

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

Introduction

Diabetic cardiomyopathy (DCM), a common complication of diabetes, represents the leading cause of morbidity and mortality among diabetic patients [1]. It is widely accepted that DCM is characterized by a set of structural and functional abnormalities in the heart of diabetics, including impaired diastolic and systolic contractility, cardiomyocyte hypertrophy and apoptosis, and myocardial fibrosis [2]. Of note, the impaired mitochondrial viability is essentially involved in the complex pathophysiological mechanisms of DCM [3, 4], which can be critically regulated by peroxisome proliferator-activated receptor y coactivator-1a (PGC-1a) [5, 6]. Despite the awareness of diabetes as a risk factor for heart failure, there is currently no specific clinical interventions for DCM or diabetes-associated heart failure [7, 8].

Exercise training represents nowadays a useful nonpharmacological strategy for the treatment of cardiovascular diseases. The cardioprotective effect of exercise is not only associated with reduced cardiovascular risk factors, but also linked to improved antioxidant capacity and mitochondrial viability and activated physiological cardiac growth that is mediated by distinct cellular and molecular mechanisms from those for pathological hypertrophy [9, 10]. Several molecular signaling, such as PGC-1a and Akt, have been known to be crucial in mediating cardioprotective effects of exercise [11]. The benefit of exercise on the prevention and treatment of diabetes and its associated cardiac dysfunction has increasingly been reported [12-15]. It has been shown in animal models that exercise could prevent ventricular remodeling, attenuate derangement of glucose and lipid metabolism, and improve mitochondrial function and antioxidant capacity, thus leading to ameliorated cardiac performance in the early stage of DCM [16-23]. However, little is known about the effect of exercise on the late stage of DCM at an advanced age.

The aim of the study was to evaluate the potential of exercise on the structural and functional changes of diabetic hearts, and in particular, to further investigate the effect of exercise on mitochondrial biogenesis in the late stage of DCM at an advanced age by using a transgenic db/db mouse model. Here we show that exercise preserves cardiac function, prevents myocardial apoptosis and fibrosis, and improves mitochondrial biogenesis in the late stage of DCM, accompanied by an activation of PGC-1a and Akt signaling.

Materials and Methods

Animals and exercise training

Seven-week old male C57BL/6 wild-type mice and db/db mice were obtained from Model Animal Research Center of Nanjing University, maintained in specific pathogen-free (SPF) conditions under a 12h-light-12h-dark cycle, and fed ad libitum on a standard rodent diet. Mice were randomized into four groups: (1) sedentary wild-type mice (sedentary control, SC); (2) exercised wild-type mice (exercised control, EC); (3) sedentary db/db mice (SD); and (4) exercised db/db mice (ED). For mice engaged in a running program, the training course was carried out for 15 weeks at speed of 10 m/min for 1 hour running per day using a specialized designed mice treadmill. At the end of the study, ejection fraction (EF%) and fractional shortening (FS%) were measured using echocardiography. Mice aged 22 weeks were then sacrificed followed by examination of body weight and heart weight. This study was approved by the ethical committees of the Nanjing Medical University and all animal experiments were conducted under the guidelines on humane use and care of laboratory animals for biomedical research published by National Institutes of Health (No. 85-23, revised 1996).

TUNEL assay

Heart tissues were harvested, embedded with paraffin, and sectioned into 4 |m slides. Apoptotic assay was carried out by TdT-mediated dUTP nick end labeling (TUNEL) reaction using in situ cell death detection Kit (cat. 11684817910, Roche).

KARGER

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2161

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

Table 1. List of utilized primers for qRT-PCR

Gene Species Forward Primer Reverse Primer

Collagen I mouse ACACGGTGAAGGGAAAGGC TGGTGGACTAAGTGATCTCCAG

Collagen III mouse TGTGCTTCGAGATGTGTGGTT GTCAAATAGCTGACTCTTGGCAA

16sRNA mouse TGCCTGCCCAGTGACTAAAGT AACAAGTGATTATGCTACCTTTGCA

ND1 mouse GCGCTTTGAGACCTGGAAAAA GGCCAGTGCGATAAAAGTTCAG

ND6 mouse GCTCAAGAAACTAATCACAGCCA GGTGGGCTTATTCTACCATTG

CYTB mouse AAGTCATGGTGGGCAACTAACTAT TGTAGTGTTGAACATCCTCTCCAT

SSBP1 mouse CAACAAATGAGATGTGGCGATCA ACGAGCTTCTTACCAGCTATGA

TWINKLE mouse TTCTCCGACGTGCATATCCC GCGCTTCTTTTCTGTACCTTCT

TOP1MT mouse GTTTCCAGCATGTCCCCTG TTGCCATCGTAGAGGAAGTGC

PGC-la mouse TATGGAGTGACATAGAGTGTGCT CCACTTCAATCCACCCAGAAAG

NRF1 mouse AGCACGGAGTGACCCAAAC TGTACGTGGCTACATGGACCT

TFAM mouse ATTCCGAAGTGTTTTTCCAGCA TCTGAAAGTTTTGCATCTGGGT

TFB2M mouse GGCCCATCTTGCATTCTAGGG CAGGCAACGGCTCTATATTGAAG

GAPDH mouse CCTTCCGTGTTCCTACCCC GCCCAAGATGCCCTTCAGT

Masson's trichrome staining

Masson's trichrome staining was used to detect collagen distribution. Heart sections were prepared as described in TUNEL assay. Masson's trichrome staining was performed according to instructions. Images were taken under light microscopy at 400x magnification for analysis.

Western blot analysis

Heart tissues were lysed in RIPA buffer (P0013C, Beyondtime) containing 1 mM PMSF (ST505, Beyondtime). Total protein of 30 ng was subjected to electrophorese on 12%-6% SDS-Page gels and transferred to PVDF membranes. Antibodies against Bax (1:1000; cat.2772, Cell Signaling Technology), Bcl-2 (1:1000; cat.2876, Cell Signaling Technology), PGC-1a (1:1000, cat. NBP1-04676, NOVUS), p-Akt473 (1:1000; cat.4060, Cell Signaling Technology), and total Akt (1:1000; cat.4685, Cell Signaling Technology) were used as primary antibodies. Mouse or rabbit IgG antibodies coupled to horseradish peroxidase (HRP) were used as secondary antibodies. Actin (1:1000; cat.4967, Cell Signaling Technology) was used as loading control. An enhanced chemiluminescence (ECL) system was used for detection of protein bands.

Quantitative real time-PCR (qRT-PCR)

Total RNA of heart tissues was isolated using TRIZOL RNA extraction kit (Invitrogen). 400 ng of RNA was subjected to reverse transcription-PCR with iScript™ cDNA Synthesis Kit (cat.170-8891, Biorad) according to the instruction. Quantitative RT-PCR was performed with PCR primers listed in Table 1. SYBR-Green supermix Kit (cat. 170-8882, Bio-rad) was employed to detect mRNA levels of these genes. All reactions were repeated 3 times and GAPDH was used to normalize target genes.

Transmission electron microscopy

The heart was fixed in 2.5% glutaraldehyde for 1 h, treated with 1% osmium tetroxide, and then dehydrated and embedded in Durcupan. Samples were then sectioned into 60 nm and mounted on Cu-grids, contrasted with uranyl acetate and lead citrate, and finally examined by electron microscopy. Images were taken at 30000x magnification for analysis.

Statistical analysis

All data were presented as mean ± SEM. One-way ANOVA was conducted to evaluate the one-way layout data. If a significant difference was observed, Bonferroni's post-hoc test was conducted to identify groups with significant differences. The relative mRNA levels were calculated using the 2-iiCt method. All analyses were performed using SPSS 19.0. Differences were considered significant with p<0.05.

KARGER

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2162

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

Table 2. Effects of exercise on experimental parameters. *, p <0.05 db/wt VS db/wt +Run; #, p <0.05 db/wt VS db/db; A, p <0.05 db/db VS db/db +Run

Parameter db/wt db/wt + Run db/db db/db+Run

_(n=5")_(~n=5)_(n=9)_0=5]

Ejection Fractions (%) 70.20±0.97 78.20±1.16 55.78±2.01# 71.20±4.19"

Fractional Shortening (%} 34.50±0.92 40.00±1.53 24.89±1.15# 35.40±3.56~

Body weight (g) 25.10±0.56 23.45±0.75 48.90±1.49# 31.42±2.66"

Heart weight (nig) 136.60±4.30 154.7±9.68* 131.90±1.43 147.70±7.53

Results

Effects of exercise on experimental parameters

Experimental parameters of sedentary and exercised wild-type and db/db mice were shown in Table 2. Body weight was not significantly different between SC and EC group, while exercise induced a significant increase of heart weight in EC group compared to SC group. Body weight was markedly greater for db/db mice (SD group] compared to wild-type mice, while exercise significantly reduced body weight gain in exercised db/db mice (ED group]. Meanwhile, the impaired ejection fraction (EF) and fractional shortening (FS) for db/db mice were significantly restored by exercise in ED group.

Exercise prevents diabetes-induced cardiomyocyte apoptosis and myocardial fibrosis Diabetes-induced cardiomyocyte apoptosis and myocardial fibrosis are typical features of DCM. Tunel assay showed increased cardiomyocyte apoptosis in diabetic hearts compared to normal hearts, which was significantly reduced by exercise for ED group (Fig. 1A). The increased ratio of Bax/Bcl-2 at protein level in diabetic hearts was reversed by exercise training (Fig. 1B and C). Furthermore, Masson's trichrome staining showed slightly myocardial fibrosis in db/db mice, which was attenuated by exercise for ED group (Fig. 2A). The increased mRNA levels of collagen I and III in diabetic hearts were also reversed by exercise (Fig. 2B). Exercise alone exerted no significant effect on cardiomyocyte apoptosis or myocardial fibrosis compared to normal hearts (Fig. 1 and 2].

Exercise preserves mitochondrial biogenesis in diabetic hearts

The defective mitochondrial biogenesis critically contributes to the development of DCM [24, 25]. The expressions of 16sRNA, ND1, ND6 and CYTB encoded by mtDNA, as well as the genes involved in mtDNA replication such as single strand DNA binding protein 1 (SSBP1), TWINKLE and TOP1MT, were downregulated in diabetic hearts (Fig. 3A and B). These impairments in mtDNA transcription and replication were however significantly restored by exercise in db/db mice (Fig. 3A and B). Meanwhile, we detected a remarkable reduction in mtDNA content (normalized by nDNA) in diabetic hearts, which was reversed by exercise (Fig. 3C). Exercise also induced elevated mRNA levels of ND6 and CYTB (Fig. 3A) and an increase in mtDNA content (Fig. 3C) in wild-type mice as compared to SC group. Furthermore, we performed electron microscopy which showed that SD group demonstrated damaged mitochondrial integrity in diabetic hearts, while exercise preserved the mitochondrial ultrastructure for ED group (Fig. 3D).

Exercise activates PGC-1a and Akt signalings in diabetic hearts

As PGC-1a is a master regulator of mitochondrial metabolism [5], we further investigated the effect of exercise on PGC-1a and its downstream transcription factors in diabetic hearts. Exercise upregulated NRF1 and TFB2M mRNA levels in wild-type mice (Fig. 4A). Furthermore, the mRNA levels of PGC-1a, NRF1, TFAM, and TFB2M (known as the partner of TFAM] were downregulated in diabetic hearts, while exercise significantly upregulated these molecules involved in PGC-1a signaling pathway (Fig. 4A). Although the protein level

KAR.GER i

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2163

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

A Tune I / DAP I

db/wt+Run db/db

db/db+Run

Bax/Bcl-2

;n ■ m

Fig. 1. Exercise attenuates diabetes-induced cardiomyocyte apoptosis. [A] Representative images of Tunel staining for mice hearts (n=3). Western blot [B] and quantitative analysis [C] for the ratio of BAX/Bcl-2 at protein level (n=3). ***, p<0.001.

Fig. 2. Exercise prevents diabetes-induced myocardial fibrosis. [A] Representative images of Masson's trichrome staining for mice hearts (n=3). [B] mRNA levels of collagen I and collagen III in the heart (n=5). ***, p<0.001.

of PGC-1a was not changed in diabetic hearts, it was significantly upregulated by exercise in db/db mice (Fig. 4B and C). Akt, a serine/threonine kinase, is a well-known molecule

KARGER

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2164

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

□ db/wt

„. ■db/wt+Run 37- T □ db/db

□ db/db+Run

■52 22 ° 1

□ db/wt

I db/wt+Run

□ db/db

□ db/db+Run

fllnl I III. J

IS" -H1- r^l

ni'inlJ

Fig. 3. Exercise improves mitochondrial biogenesis in diabetic hearts. [A] mRNA levels of genes encoded by mtDNA (n=5). [B] mRNA levels of genes involved in mtDNA replication (n=5). [C] mtDNA content normalized by nDNA (n=5). [D] Representative images of electron microscopy for detection of mitochondrial ultrastructure in mice hearts (n=3). *, p<0.05; **, p<0.01; ***, p<0.001.

contributing to exercise-induced cardioprotection [26]. While diabetes-associated insulin resistance contributes to decreased activation of Akt [24]. Here, we show that db/db mice displayed a significant inhibition of Akt phosphorylation in the heart, which was markedly reversed by exercise training (Fig. 4B and C). Thus, the cardioprotective effect of exercise in the late stage of DCM is accompanied by an activation of PGC-1a and Akt signaling.

Discussion

Although exercise has been confirmed as an adjuvant therapy for diabetes and its associated cardiac dysfunction, the pathophysiological and molecular mechanisms underlying the beneficial effect of exercise in the late stage of DCM are poorly understood. The present study shows that long-term moderate intensity exercise prevents myocardial apoptosis and fibrosis, ameliorates mitochondrial biogenesis, and preserves cardiac function in advanced DCM, accompanied by an activation of PGC-1a and Akt signaling.

Diabetes-associated myocardial apoptosis and fibrotic replacement account for a loss of cardiac function [2]. Concomitant with previous studies [9], long-term moderate intensity exercise leads to physiological cardiac growth with increased EF and FS indicating an improved cardiac function, while no significant cardiomyocyte apoptosis or myocardial fibrosis has been found in exercised wild-type mice compared to sedentary wild-type mice. Importantly, exercise exerts beneficial effects to prevent myocardial apoptosis and fibrosis in diabetic hearts. In fact, exercise has been shown to diminish mitochondria-mediated cardiomyocyte apoptosis and to reduce myocardial fibrosis in the aging heart [27, 28]. Here, we speculate that the improved cardiac function in aging diabetic hearts is at least in part attributable to reduced myocardial apoptosis and fibrosis.

KAR.GEK

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2165

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

** t jl.

In ***

I n^n nl.

□ db/wt db/wt+Run

_ _ db/db

*** n db/db+Run

db/wt db/wt + Run db/db db/db+ Run

PGC-1a

p-Akt473 total Akt Actin

J! 1.5

2 1.0 o

0.5 0.0

p-Akt473/total Akt

1.5-1 *** ***

u 00 S i-o- -C —1

•a Ö 0.5-

0.0 ■ n

Fig. 4. Diabetes-associated inhibition of PGC-1a and Akt phosphorylation is reversed by exercise. [A] mRNA levels of PGC-1a and its downstream transcription factors including NRF1, TFAM, and TFB2M (n=5). Western blot [B] and quantitative analysis [C] for PGC-1a, p-Akt473 and total Akt normalized by Actin (n=3). *, p<0.05; **, p<0.01; ***, p<0.001.

There has been increasing evidence indicating that impaired mitochondrial biogenesis attributes to cardiac dysfunction in diabetic states [2, 3, 24, 25, 29]. The present study shows defective mtDNA replication and impaired mitochondrial biogenesis in the hearts of db/ db mice, which can be abolished by exercise training. PGC-1a, a transcriptional coactivator, plays key roles in the regulation of myocardial energy metabolism [5, 6] and participates in the control of mitochondrial biogenesis and function through regulating its downstream transcription factors such as NRF and TFAM [30, 31]. It is known that the expression of PGC-1a can be induced with exercise activity [5, 32, 33], while downregulated in pathological cardiac hypertrophy and heart failure [34-36]. Also, the PGC-1a can be regulated with aging process and aging-associated diseases [37]. However, the defective regulation of PGC-1a in diabetes is contradictory, since PGC-1a expression has been found to be either upregulated or unchanged in animal models of diabetes, closely related to the age and the stage of diabetes in mice [37-40]. Here we demonstrate reduced expressions of PGC-1a at mRNA level and its downstream transcription factors such as NRF1, TFAM and TFB2M in diabetic hearts. Of note, the stage of the disease and the age of db/db mice were different between our study (late stage at old age) and previous ones (early stage at young age). Thus, although PGC-1a has been reported to be upregulated in diabetes, the downregulation of PGC-1a is probably inevitable with the progress of DCM into advanced stage. More importantly, exercise significantly activates the PGC-1a signaling in the hearts of db/db mice. These data suggest that the beneficial effect of exercise might be mediated by the activation of PGC-1a, although the direct relationship between PGC-1a activation and the impact of exercise on mitochondrial biogenesis in DCM remains to be further clarified. Noteworthy, it has previously been reported that although PGC-1a promoted cardiac mitochondrial biogenesis,

KAR.GEK

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2166

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

the expansion of mitochondria density could lead to sarcomeric disruption and impaired cardiac contractile function [41]. Thus, PGC-1a regulation and mitochondrial biogenesis need to be discreetly controlled to exert beneficial effects on cardiac function. Last but not least, given that glucose and lipid metabolic disorders as well as insulin resistance also contribute to diabetic status and impaired cardiac function in DCM which can be regulated by PGC-1a [4, 24], it would be of great interest to look into the regulatory effect of PGC-1a on glucose and lipid metabolism by measurements of serum glucose, c-peptide, insulin, and lipid levels in the future work.

Akt has been known to be required for exercise-induced cardiac physiological remodeling and to protect the heart from pressure overload and ischemia-reperfusion injury [42, 43]. Whereas the hyperglycemia and insulin resistance are associated with an inactivation of Akt signaling leading to the impairment of glucose metabolism [24, 44]. Our findings demonstrate that diabetes-associated inhibition of Akt phosphorylation could be significantly reversed by exercise training, suggesting that exercise might also prevent cardiac injury in DCM via regulating Akt. In fact, it has previously been shown that the phosphorylation of Akt results in the upregulation of glucose transporter (GLUT]-4 in cardiomyocytes, thus facilitating glucose metabolism in diabetic hearts [4, 45]. Knowing that Akt appears to be crucial in diabetes, further research is required to determine the functional influence of exercise-induced Akt activation in the treatment of DCM.

In summary, the present study shows the beneficial effect of long-term exercise on the treatment of DCM at an advanced disease stage, via reduced myocardial apoptosis and fibrosis as well as improved mitochondrial biogenesis. The upregulated PGC-1a and Akt signaling in the hearts of exercised db/db mice might be considered as promising molecular targets for the development of novel pharmacotherapy for DCM.

Disclosure Statement

The authors declare there are no conflicts of interest.

Acknowledgments

This work was supported by the grants from National Natural Science Foundation of China (81200169 to JJ Xiao), Innovation Program of Shanghai Municipal Education Commission (13YZ014 to JJ Xiao), Foundation for University Young Teachers by Shanghai Municipal Education Commission (year 2012, to JJ Xiao), Innovation fund from Shanghai University (sdcx2012038 to JJ Xiao), and Program for the integration of production, teaching and research for University Teachers supported by Shanghai Municipal Education Commission (year 2014, to JJ Xiao). Dr XQ Kong is a Fellow at the Collaborative Innovation Center For Cardiovascular Disease Translational Medicine.

References

1 Chavali V, Tyagi SC, Mishra PK: Predictors and prevention of diabetic cardiomyopathy. Diabetes Metab Syndr Obes Targets Ther 2013;6:151-160.

2 Huynh K, Bernardo BC, McMullen JR, Ritchie RH: Diabetic cardiomyopathy: Mechanisms and new treatment strategies targeting antioxidant signaling pathways. Pharmacol Ther 2014;142:375-415.

3 Boudina S, Sena S, O'Neill BT, Tathireddy P, Young ME, Abel ED: Reduced mitochondrial oxidative capacity and increased mitochondrial uncoupling impair myocardial energetics in obesity. Circulation 2005;112:2686-2695.

4 Iliadis F, Kadoglou N, Didangelos T: Insulin and the heart. Diabetes Res Clin Pract 2011;93 Suppl 1:S86-91.

5 Finck BN, Kelly DP: Peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1) regulatory cascade in cardiac physiology and disease. Circulation 2007;115:2540-2548.

KARGER i

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2167

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

6 Rowe GC, Jiang A, Arany Z: PGC-1 coactivators in cardiac development and disease. Circ Res 2010;107:825-838.

7 Aksnes TA, Kjeldsen SE, Rostrup M, Omvik P, Hua TA, Julius S: Impact of new-onset diabetes mellitus on cardiac outcomes in the Valsartan Antihypertensive Long-term Use Evaluation (VALUE) trial population. Hypertension 2007;50:467-473.

8 Cohen-Solal A, Beauvais F, Logeart D: Heart failure and diabetes mellitus: epidemiology and management of an alarming association. J Card Fail 2008;14:615-625.

9 Ellison GM, Waring CD, Vicinanza C, Torella D: Physiological cardiac remodelling in response to endurance exercise training: cellular and molecular mechanisms. Heart Br Card Soc 2012;98:5-10.

10 Tabet JY, Meurin P, Driss AB, Weber H, Renaud N, Grosdemouge A, Beauvais F, Cohen-Solal A: Benefits of exercise training in chronic heart failure. Arch Cardiovasc Dis 2009;102:721-730.

11 Mann N, Rosenzweig A: Can exercise teach us how to treat heart disease? Circulation 2012;126:2625-2635.

12 De Angelis KL, Oliveira AR, Dall'Ago P, Peixoto LR, Gadonski G, Lacchini S, Fernandes TG, Irigoyen MC: Effects of exercise training on autonomic and myocardial dysfunction in streptozotocin-diabetic rats. Braz J Med Biol Res Rev Bras Pesqui Médicas E Biológicas Soc Bras Biofísica Al 2000;33:635-641.

13 Bidasee KR, Zheng H, Shao C-H, Parbhu SK, Rozanski GJ, Patel KP: Exercise training initiated after the onset of diabetes preserves myocardial function: effects on expression of beta-adrenoceptors. J Appl Physiol Bethesda Md 1985 2008;105:907-914.

14 Li S, Culver B, Ren J: Benefit and risk of exercise on myocardial function in diabetes. Pharmacol Res Off J Ital Pharmacol Soc 2003;48:127-132.

15 Loganathan R, Novikova L, Boulatnikov IG, Smirnova IV: Exercise-induced cardiac performance in autoimmune (type 1) diabetes is associated with a decrease in myocardial diacylglycerol. J Appl Physiol Bethesda Md 1985 2012;113:817-826.

16 Castellar A, Remedio RN, Barbosa RA, Gomes RJ, Caetano FH: Collagen and reticular fibers in left ventricular muscle in diabetic rats: physical exercise prevents its changes? Tissue Cell 2011;43:24-28.

17 Epp RA, Susser SE, Morissette MP, Kehler DS, Jassal DS, Duhamel TA: Exercise training prevents the development of cardiac dysfunction in the low-dose streptozotocin diabetic rats fed a high-fat diet. Can J Physiol Pharmacol 2013;91:80-89.

18 Hafstad AD, Lund J, Hadler-Olsen E, Höper AC, Larsen TS, Aasum E: High- and moderate-intensity training normalizes ventricular function and mechanoenergetics in mice with diet-induced obesity. Diabetes 2013;62:2287-2294.

19 Korte FS, Mokelke EA, Sturek M, McDonald KS: Exercise improves impaired ventricular function and alterations of cardiac myofibrillar proteins in diabetic dyslipidemic pigs. J Appl Physiol Bethesda Md 1985 2005;98:461-467.

20 Loganathan R, Bilgen M, Al-Hafez B, Zhero SV, Alenezy MD, Smirnova IV: Exercise training improves cardiac performance in diabetes: in vivo demonstration with quantitative cine-MRI analyses. J Appl Physiol Bethesda Md 1985 2007;102:665-672.

21 Saraceni C, Broderick TL: Cardiac and metabolic consequences of aerobic exercise training in experimental diabetes. Curr Diabetes Rev 2007;3:75-84.

22 Searls YM, Smirnova IV, Fegley BR, Stehno-Bittel L: Exercise attenuates diabetes-induced ultrastructural changes in rat cardiac tissue. Med Sci Sports Exerc 2004;36:1863-1870.

23 Silva E, Natali AJ, Silva MF, Gomes GJ, Cunha DNQ Ramos RM, Toledo MM, Drummond FR, Belfort FG, Novaes RD, Maldonado IR: Ventricular remodeling in growing rats with experimental diabetes: The impact of swimming training. Pathol Res Pract 2013;209:618-626.

24 Mandavia CH, Aroor AR, Demarco VG, Sowers JR: Molecular and metabolic mechanisms of cardiac dysfunction in diabetes. Life Sci 2013;92:601-608.

25 Zhang X, Chen C: A new insight of mechanisms, diagnosis and treatment of diabetic cardiomyopathy. Endocrine 2012;41:398-409.

26 Bernardo BC, Weeks KL, Pretorius L, McMullen JR: Molecular distinction between physiological and pathological cardiac hypertrophy: experimental findings and therapeutic strategies. Pharmacol Ther 2010;128:191-227.

KARGER

and Biochemistry Published online: April 07, 2015_[www.karger.com/cpb__2168

Wang et al.: Exercise Prevents Advanced Diabetic Cardiomyopathy

27 Kwak H-B, Kim J, Joshi K, Yeh A, Martinez DA, Lawler JM: Exercise training reduces fibrosis and matrix metalloproteinase dysregulation in the aging rat heart. FASEB J Off Publ Fed Am Soc Exp Biol 2011;25:1106-1117.

28 Kwak H-B: Effects of aging and exercise training on apoptosis in the heart. J Exerc Rehabil 2013;9:212-219.

29 Ren J, Pulakat L, Whaley-Connell A, Sowers JR: Mitochondrial biogenesis in the metabolic syndrome and cardiovascular disease. J Mol Med Berl Ger 2010;88:993-1001.

30 Russell LK, Mansfield CM, Lehman JJ, Kovacs A, Courtois M, Saffitz JE, Medeiros DM, Valencik ML, McDonald JA, Kelly DP: Cardiac-specific induction of the transcriptional coactivator peroxisome proliferator-activated receptor gamma coactivator-1alpha promotes mitochondrial biogenesis and reversible cardiomyopathy in a developmental stage-dependent manner. Circ Res 2004;94:525-533.

31 Sebastiani M, Giordano C, Nediani C, Travaglini C, Borchi E, Zani M, Feccia M, Mancini M, Petrozza V, Cossarizza A, Gallo P, Taylor RW, d'Amati G: Induction of mitochondrial biogenesis is a maladaptive mechanism in mitochondrial cardiomyopathies. J Am Coll Cardiol 2007;50:1362-1369.

32 Leone TC, Lehman JJ, Finck BN, Schaeffer PJ, Wende AR, Boudina S, Courtois M, Wozniak DF, Sambandam N, Bernal-Mizrachi C, Chen Z, Holloszy JO, Medeiros DM, Schmidt RE, Saffitz JE, Abel ED, Semenkovich CF, Kelly DP: PGC-1alpha deficiency causes multi-system energy metabolic derangements: muscle dysfunction, abnormal weight control and hepatic steatosis. PLoS Biol 2005;3:e101.

33 Watson PA, Reusch JEB, McCune SA, Leinwand LA, Luckey SW, Konhilas JP, Brown DA, Chicco AJ, Sparagna GC, Long CS, Moore RL: Restoration of CREB function is linked to completion and stabilization of adaptive cardiac hypertrophy in response to exercise. Am J Physiol Heart Circ Physiol 2007;293:H246-259.

34 Arany Z, Novikov M, Chin S, Ma Y, Rosenzweig A, Spiegelman BM: Transverse aortic constriction leads to accelerated heart failure in mice lacking PPAR-gamma coactivator 1alpha. Proc Natl Acad Sci U S A 2006;103:10086-10091.

35 Sihag S, Cresci S, Li AY, Sucharov CC, Lehman JJ: PGC-1a and ERRa target gene downregulation is a signature of the failing human heart. J Mol Cell Cardiol 2009;46:201-212.

36 Ventura-Clapier R, Garnier A, Veksler V: Transcriptional control of mitochondrial biogenesis: the central role of PGC-1alpha. Cardiovasc Res 2008;79:208-217.

37 Anderson R, Prolla T: PGC-1alpha in aging and anti-aging interventions. Biochim Biophys Acta 2009 0ct;1790:1059-1066.

38 Botta A, Laher I, Beam J, Decoffe D, Brown K, Halder S, Devlin A, Gibson DL, Ghosh S: Short term exercise induces PGC-1a, ameliorates inflammation and increases mitochondrial membrane proteins but fails to increase respiratory enzymes in aging diabetic hearts. PloS One 2013;8:e70248.

39 Boudina S, Sena S, Theobald H, Sheng X, Wright JJ, Hu XX, Aziz S, Johnson JI, Bugger H, Zaha VG, Abel ED: Mitochondrial energetics in the heart in obesity-related diabetes: direct evidence for increased uncoupled respiration and activation of uncoupling proteins. Diabetes 2007;56:2457-2466.

40 Pohjoismäki JLO, Boettger T, Liu Z, Goffart S, Szibor M, Braun T: Oxidative stress during mitochondrial biogenesis compromises mtDNA integrity in growing hearts and induces a global DNA repair response. Nucleic Acids Res 2012;40:6595-6607.

41 Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM, Kelly DP: Peroxisome proliferator-activated receptor gamma coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 2000;106:847-856.

42 DeBosch B, Treskov I, Lupu TS, Weinheimer C, Kovacs A, Courtois M, Muslin AJ: Akt1 is required for physiological cardiac growth. Circulation 2006;113:2097-2104.

43 Shiraishi I, Melendez J, Ahn Y, Skavdahl M, Murphy E, Welch S, Schaefer E, Walsh K, Rosenzweig A, Torella D, Nurzynska D, Kajstura J, Leri A, Anversa P, Sussman MA: Nuclear targeting of Akt enhances kinase activity and survival of cardiomyocytes. Circ Res 2004;94:884-891.

44 Kitagishi Y, Nakanishi A, Minami A, Asai Y, Yasui M, Iwaizako A, Suzuki M, Ono Y, Ogura Y, Matsuda S: Certain Diet and Lifestyle May Contribute to Islet ß-cells Protection in Type-2 Diabetes via the Modulation of Cellular P13K/AKT Pathway. Open Biochem J 2014;8:74-82.

45 Pulakat L, Aroor AR, Gul R, Sowers JR: Cardiac insulin resistance and microRNA modulators. Exp Diabetes Res 2012;2012:654904.

KARGER