Scholarly article on topic 'Genotypic and bioinformatic evaluation of the alpha-l-iduronidase gene and protein in patients with mucopolysaccharidosis type I from Colombia, Ecuador and Peru'

Genotypic and bioinformatic evaluation of the alpha-l-iduronidase gene and protein in patients with mucopolysaccharidosis type I from Colombia, Ecuador and Peru Academic research paper on "Biological sciences"

CC BY-NC-ND
0
0
Share paper
OECD Field of science
Keywords
{"Mucopolysaccharidosis type I" / α-l-Iduronidase / Hurler / Scheie / "Mutational analysis" / "Bioinformatic model"}

Abstract of research paper on Biological sciences, author of scientific article — Tatiana Pineda, Sulie Marie, Janneth Gonzalez, Ana L. García, Amparo Acosta, et al.

Abstract Mucopolysaccharidosis type I (MPSI) is a rare autosomal recessive disorder caused by mutations in the gene encoding the lysosomal enzyme α-l-iduronidase (IDUA), which is instrumental in the hydrolysis of the glycosaminoglycans, dermatan and heparan sulfate. The accumulation of unhydrolyzed glycosaminoglycans leads to pathogenesis in multiple tissue types, especially those of skeletal, nervous, respiratory, cardiovascular, and gastrointestinal origin. Although molecular diagnostic tools for MPSI have been available since the identification and characterization of the IDUA gene in 1992, Colombia, Ecuador, and Peru have lacked such methodologies. Therefore, the mutational profile of the IDUA gene in these countries has largely been unknown. The goal of this study was to characterize genotypes in 14 patients with MPSI from Colombia, Ecuador, and Peru. The most common mutation found at a frequency of 42.8% was W402X. Six patients presented with seven novel mutations, a high novel mutational rate in this population (32%). These novel mutations were validated using bioinformatic techniques. A model of the IDUA protein resulting from three of the novel missense mutations (Y625C, P385L, R621L) revealed that these mutations alter accessible surface area values, thereby reducing the accessibility of the enzyme to its substrates. This is the first characterization of the mutational profile of the IDUA gene in patients with MPSI in Colombia, Ecuador, and Peru. The findings contribute to our understanding of IDUA gene expression and IDUA enzyme function, and may help facilitate early and improved diagnosis and management for patients with MPSI.

Academic research paper on topic "Genotypic and bioinformatic evaluation of the alpha-l-iduronidase gene and protein in patients with mucopolysaccharidosis type I from Colombia, Ecuador and Peru"

MGM

Reports

ELSEVIER

Contents lists available at ScienceDirect

Molecular Genetics and Metabolism Reports

journal homepage: http://www.journals.elsevier.com/molecular-genetics-and-

metabolism-reports/

Genotypic and bioinformatic evaluation of the alpha-L-iduronidase gene and protein in patients with mucopolysaccharidosis type I from Colombia, Ecuador and Peru

Tatiana Pineda a,\ Sulie Marie b,2< Janneth Gonzalez c3, Ana L. García d,4< Amparo Acosta e, Manuel Moralesf,s, Luz N. Correa g, Ricardo Vivas h,6I Xiomara Escobar ',7, Ana Protzel J,8I Maria Barba k, Sandra Ospina ',9, Clara Corredor m,1°, Sandra Mansilla n, Harvy M. Velasco a*

a Genetics Institute, Faculty of Medicine, National University of Colombia, Bogotá DC, Colombia b Faculty of Medicine, Sao Paulo University, Sao Paulo, Brazil c Nutrition Department, Faculty of Sciences, Javeriana University, Bogotá, DC, Colombia d Pediatrics Neurology Department, Simon Bolívar Hospital, Bogotá, DC, Colombia e Department of Pediatrics, Faculty of Medicine, Cauca University, Popayán, Colombia f Pediatrics Neurology Department, Children Colsubsidio Hospital, Bogotá, DC, Colombia g Pediatrics Neurology Department, La Misericordia Hospital, Bogotá, DC, Colombia h Pediatrics Neurology Department, Sogamoso Regional Hospital, Sogamoso, Colombia i Pediatrics Neurology Department, San Jeronico Regional Hospital of Montería, Monteria, Colombia J Genetics Department, National E Rebagliati Martins Hospital, Lima, Peru k Cordero E 9-39 y 6 de Diciembre, Edificio San Francisco, Consultorio, 31, Quito, Ecuador l Clinica Salud Coop, Bogotá, Colombia

m Pediatrics Department, Duitama Regional Hospital, Duitama, Colombia n Pediatrics Neurology Department, Federico Lleras Hospital, Ibagué, Colombia

CrossMark

ARTICLE INFO

ABSTRACT

Article history:

Received 24 July 2014

Received in revised form 1 October 2014

Accepted 1 October 2014

Available online 30 October 2014

Keywords:

Mucopolysaccharidosis type I

a-L-Iduronidase

Hurler

Scheie

Mutational analysis Bioinformatic model

Mucopolysaccharidosis type I (MPSI) is a rare autosomal recessive disorder caused by mutations in the gene encoding the lysosomal enzyme a-L-iduronidase (IDUA), which is instrumental in the hydrolysis of the glycos-aminoglycans, dermatan and heparan sulfate. The accumulation of unhydrolyzed glycosaminoglycans leads to pathogenesis in multiple tissue types, especially those of skeletal, nervous, respiratory, cardiovascular, and gastrointestinal origin.

Although molecular diagnostic tools for MPSI have been available since the identification and characterization of the IDUA gene in 1992, Colombia, Ecuador, and Peru have lacked such methodologies. Therefore, the mutational profile of the IDUA gene in these countries has largely been unknown. The goal of this study was to characterize genotypes in 14 patients with MPSI from Colombia, Ecuador, and Peru.

The most common mutation found at a frequency of 42.8% was W402X. Six patients presented with seven novel mutations, a high novel mutational rate in this population (32%). These novel mutations were validated using bioinformatic techniques. A model of the IDUA protein resulting from three of the novel missense mutations (Y625C, P385L, R621L) revealed that these mutations alter accessible surface area values, thereby reducing the accessibility of the enzyme to its substrates.

* Corresponding author at: Genetics Institute, National University of Colombia, Entrada Calle 53 con Cra. 37 edificio 426, Bogotá, Colombia. E-mail addresses: tatiana2121@hotmail.com (T. Pineda), sknmarie@usp.br (S. Marie), Janneth.gonzalez@gmail.com (J. Gonzalez), lolyped@hotmail.com (AL. García), morin1924@gmail.com (A. Acosta), mmoralesd@cable.net.co (M. Morales), luznorela@yahoo.com (L.N. Correa), dansavi39@hotmail.com (R. Vivas), xiomaraescobar@latinmail.co (X. Escobar), ana.protzel@gmail.com (A. Protzel), mbarba303@yahoo.com (M. Barba), solospina@yahoo.es (S. Ospina), cic_70@hotmail.com (C. Corredor), mansillasand@yahoo.es (S. Mansilla), hmvelascop@unal.edu.co (H.M. Velasco).

1 Avenida Carrera, 30 # 45, Bogotá, Colombia.

2 Av. Prof. Almeida Prado, n° 1280, Butanta, Sao Paulo, SP, Brazil.

3 Crr 7N40-62, Bogotá, Colombia.

4 Calle 165, # 7-6, Bogotá, Colombia; Amparo Acosta: Calle 5, No. 4-70 Popayan, Colombia.

5 Calle 67, No. 10-67, Bogotá, Colombia; Luz Norela Correa: Av. Caracas, No. 1-13 Bogotá, Colombia.

6 Calle 8, No. 11-43, Sogamoso, Colombia.

7 Cr14 22-50, Monteria, Colombia.

8 Jr Edgardo Rebagliati 490, Jesús María, Lima, Peru.

9 Autopista Norte, Numero 104-33, Bogotá, Colombia.

10 Av. Américas, Carrera 35 Duitama, Bogotá; Sandra Mansilla: Calle 33, No. 4' 50, Ibagué, Colombia.

http://dx.doi.org/10.10167j.ymgmr.2014.10.001

2214-4269/© 2014 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

This is the first characterization of the mutational profile of the IDUA gene in patients with MPSI in Colombia, Ecuador, and Peru. The findings contribute to our understanding of IDUA gene expression and IDUA enzyme function, and may help facilitate early and improved diagnosis and management for patients with MPSI.

© 2014 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license

(http://creativecommons.org/licenses/by-nc-nd/3.0/).

1. Introduction

Mucopolysaccharidosis type I (MPSI) is an autosomal recessive lysosomal storage disorder [1] resulting from the deficiency of the lysosomal enzyme a-L-iduronidase (IDUA,) (EC 3.2.1.76, OMIM ID: 252800) [2], which is required for the hydrolysis of the glycosaminoglycans (GAGs), dermatan and heparan sulfates. Lysosomal accumulation of these GAGs leads to multisystemic pathology involving predominantly the skeletal, respiratory, cardiovascular, gastrointestinal, and nervous systems [1]. Depending on the age of onset, how rapidly the disease progresses, and the presence or absence of neurocognitive involvement, MPS I is broadly categorized into three forms: Hurler syndrome (MPS IH), the most severe, neuropathic form, with onset in infancy; Hurler-Scheie syndrome (MPS I H/S) is intermediate in severity with onset in early childhood and mild to moderate cognitive impairment; and Scheie syndrome (MPS IS), the least severe form of MPS I, with an onset in childhood and no cognitive impairment [1]. MPS I is characterized by coarse facial features, joint stiffness and contractures, short stature, cardiopathy and respiratory problems; without treatment, expected survival in the most severely affected patients with Hurler syndrome is less than 10 years [1,3,4].

Screening for MPS I is done by measurement of urinary GAG levels; a formal diagnosis is based on an enzyme activity assay measuring the levels of IDUA in cultured fibroblasts, peripheral blood leukocytes, or dried blood spots [3,5-7]. Molecular analyses to identify mutations in the IDUA gene enable diagnosis of MPS I by genotyping. However, not all mutations are known, and there are regional variations in mutations [8,9]. Despite these limitations, genotyping is a powerful tool for disease confirmation, prenatal diagnosis [10], screening of newborns [11], and for the decision of the better treatment that should be established (HSCT, ERT or both) based on the phenotype-genotype correlation [3]. To date, more than 100 IDUA mutations have been identified [3,8]. These include deletions, insertions, missense, nonsense, and splice site mutations. The most common are the W402X and Q70X nonsense mutations; 37% of reported mutations are novel [9]. Enzyme assays are not very reliable in detecting heterozygotes, but some biochemical methods have shown positive results [12].

Until recently, Colombia, Ecuador and Peru lacked the molecular diagnostic laboratories to characterize the mutational profile of IDUA in Andean patients with MPS I. The goal of this study was to characterize the genotypes of Colombian, Ecuadorian, and Peruvian patients diagnosed with MPS I using molecular and bioinformatic techniques.

2. Material and methods

2.1. Study population

Patients from Colombia, Ecuador and Peru with a clinical diagnosis of MPS I confirmed by biochemical and genotype analysis were included in this study. The responsible adult for each patient signed an informed consent form agreeing to study participation. These forms were then approved by the ethics committee of the Medical Faculty of the National University of Colombia.

22. Experimental phase

Genomic DNA was extracted from blood samples of patients using the Ultra Clean TM DNA Blood Isolation kit (MO BIO Laboratories, Inc.,

Carlsbad, California, USA). Amplicons for sequencing were generated by polymerase chain reaction (PCR) using oligonucleotides as described previously [13,14]. Oligonucleotide sequences are listed in Table 1. The 5' UTR and 3' UTR segments were not evaluated because no known mutations have been identified in these regions to date.

PCR-generated amplicons were purified with a Purelink™ PCR Purification kit (Invitrogen, Carlsbad, California, USA), prepared for sequencing using the Big Dye® Terminator 3.1 sequence kit (Applied Biosystems, Foster City, California, USA), and purified again as described above. Resulting DNA was analyzed with an Applied Biosystems 3500 Genetic Analyzer sequencer (Applied Biosystems, Foster City, California, USA). The sequence analyses were done with Sequencher 5.2 (Gene Codes Corporation, Ann Arbor, Michigan, USA). Quality control of the results was done in the molecular biology laboratory of the Faculty of Medicine of the Sao Paulo University in Brazil.

23. Analysis of new mutations

Novel mutations were analyzed with the software Splice site prediction by Neural Network [15], with the software for the annotation and prediction of pathological mutations PMUT [16,17], and with PolyPhen, a bioinformatic tool to use to predict the possible impact of an amino acid substitution on the structure and function of a human protein [18].

3. Results

3.1. Patient profiles

A total of 15 patients were evaluated for enrollment in this study. One patient had enzyme levels indicative of MPS I, but she was a heterozygous carrier. Therefore, this patient was excluded from the study. Of the 14 remaining patients, 12 were diagnosed with Hurler syndrome (85.7%), and two with Hurler-Scheie (14.3%) (Table 2). The average age at diagnosis was 7.8 years; 28.6% of the patients were female. Participation by country included 12 patients from Colombia and one patient each from Ecuador and Peru.

Phenotypic characteristics of the 14 patients are provided in Table 3. All patients had variable degrees of multisystem disease involvement: all presented with joint and bone manifestations, coarse facial features, and hernias, and most also had ocular and respiratory abnormalities, visceromegaly, and short stature. All patients with Hurler syndrome had mental retardation and global developmental delay, while neither of the patients diagnosed with Hurler-Scheie syndrome had neurocognitive manifestations. At the time of this analysis, 93% of patients were receiving enzyme replacement therapy (ERT) with laronidase (Aldurazyme®, Genzyme, a Sanofi company, Cambridge, Massachusetts, USA and BioMarin Pharmaceutical Inc, Novato, California, USA); 14% had consanguineous parents, but no family history of MPS I.

3.2. Mutational genetic analyses

32.1. Previously-reported mutations

Of the 14 patients studied, eight had previously-reported mutations, as shown in Table 4. The most common mutation W402X, was found at a frequency of 42.8% in our study population. Other previously-reported mutations found were A327P, E404X, and Arg48del in patients with

Table 1

List of oligonucleotides used in this study.

Exon Name (strand) Sequence Nucleotide

1 IDUA1 ( + ) ACCCAACCCCTCCCAC 437-425

IDUA1 (-) GCTCCGGTCTCTGAAGCT 834-817

2 IDUA2 ( + ) GAACGTGTGTGTCAGCCG 1236-1253

IDUA2 (-) GCTCGGAAGACCCCTTGT 1539-1522

3 IDUA3 ( + ) TCCCACATGCTCCGTTGT 337-354

IDUA3 (-) TCTGAGTCCTTGGATGTCCATTC 609-587

4 IDUA4 ( + ) ACCCTCTCCCTCACCCAG 565-582

IDUA4 ( — ) GTTGCACCCCTATCACGC 876-859

5 IDUA5 ( + ) CATCACCTTGCACCCTCC 1202-1219

IDUA5 ( —) CCAGGGCAGGTGTAGACG 1474-1457

6 IDUA6 ( + ) GAGGAAGGCAGGAGCAGAG 1422-1440

IDUA6 ( —) GACCCTGGTGGTGCTGAG 1780-1763

7 IDUA7 ( + ) TGCGGCTGGACTACATCT 1465-1483

IDUA7 ( —) GCAGCATCAGAACCTGCTACT 2112-2092

8 IDUA8 ( + ) CCACCTTCCTCCCGAGAC 2010-2027

IDUA8 ( —) GGAGCGCACTTCCTCCAG 2395-2378

9 IDUA9 ( + ) TCCTTCACCAAGGGGAGG 2442-2459

IDUA9 ( —) CCGAGGCCTGAGTGTCAG 2841-2824

10 IDUA10 ( + ) GGTGACCCTGCGGCTG 2722-2737

IDUA10 ( —) CCTGGAGAACCCTGAGGA 3142-3125

11 and 12 IDUA11/12 ( + ) GTGTGGGTGGGAGGTGGA 3055-3072

IDUA11/12 ( —) CTTCACCCATGCGGTCAC 3520-3503

13 IDUA13 ( + ) GGGGCTTGAGGGAATGAG 3721-3738

IDUA13 ( —) GAGAAGCCTGGGGTCAGG 4020-4003

14 IDUA14 ( + ) CAGGGCAGTACTGGGTGG 3978-3995

IDUA14 ( —) CATCACCCCCTTTGCAATATA 4308-4288

Hurler syndrome, and R89W identified in one of the two patients with Hurler-Scheie syndrome.

3.2.2. Novel mutations and bioinformatic analysis

Our analysis led to the identification of seven novel mutations. Among these, three were missense mutations (Y625C, P385L, R621L), one was a nonsense mutation (Q148X), one was a deletion (Asp298Glu+Ala299del), one was an insertion (1557-1558insC), and one was a splice site mutation (lVS9+1g>t) (Table 5).

Sequence and bioinformatic analysis of the splice site mutation lVS9+1g>t allowed further characterization of this mutation. In patients with MPS I who carry this mutation, the guanine residue at the 5' donor splice site of intron 9 is replaced by a thymine residue. This results in a defective splice site, and preservation of the entire intron 9, as shown in Fig. 1.

Sequence alignments showed a high level of interspecies conservation of the three missense mutations Y625C, P385L, and R621L (Fig. 2). All three mutated residues were conserved among 5 different species, further confirming the importance of these residues in preserving normal IDUA function.

Table 2

Patient demographics.

Patient Age Gender Phenotype

MPS] [001 8 F Hurler

MPS] 002 7 F Hurler

MPS] 003 9 F Hurler

MPS] 004 2 M Hurler

MPS] 005 28 M Hurler-Scheie

MPS 006 5 M Hurler

MPS 007 5 M Hurler

MPS 008 7 M Hurler

MPS 009 8 M Hurler

MPS [ 010a 8 M Hurler

MPS [ 011a 10 M Hurler

MPS 012 5 M Hurler-Scheie

MPS 013 3 F Hurler

MPS 014 4 M Hurler

a These patients are siblings.

4. Discussion

This study aimed to characterize the genetic profile of the IDUA gene in patients with MPSI from Colombia, Ecuador and Peru through molecular and bioinformatic techniques. The majority (86%) of patients in our study had a clinical and biochemical diagnosis of MPS I Hurler syndrome, the severe form of the disease, and two patients were diagnosed with MPS I Hurler-Scheie syndrome.

The most common mutation found in our study population was W402X. This mutation was previously described in a Brazilian population [19] with a similar frequency (37%) as reported here. Two other frequently-reported mutations worldwide (Q70X [8,9,20] and P533R [20-22]), were not found in our population.

In 1994, Bunge et al. described a differential pattern of the most common found mutation frequencies: W402x was more frequent than Q70X in west Europe (48% vs. 19%) while Q70X was more frequent than W402X in east Europe, including Scandinavia (62% vs 17%) [9]. Later on, other studies like Voskoboeva et al. found the same data suggesting an east Europe origin for the Q70X mutation. According to the studies in Spain [21], the W402X mutation was found with a frequency of 60% while Q70X was found with a frequency of 10%; showing a clinal east-west frequency reduction of the Q70X, and then when we looked inside our population this mutation was not found. The other probable explanation for the absent Q70X mutation in our Andean population is because the racial mixture in this region was with individuals ofSpanish origin and not with east Europe individuals [23].

We identified a total of five mutations (W402X, A327P, E404X, Arg48del, and R89W) in our Andean population which were previously reported [8,9,13,19,24]. Two of these mutations, Arg48del and E404X, occurred in a heterozygous state in a pair of siblings (patient MPSI 010 and MPSI 011). Arg48del was previously reported in an analysis of IDUA mutations in a Brazilian MPS I population [19]; E404X was identified in a patient from Iran with MPS I Hurler syndrome [24]. Another mutation found in one of our patients was A327P, which has been reported frequently in the literature and is associated with a severe MPS I phenotype [13]. Additionally, we identified the R89W mutation in one patient with Hurler-Scheie syndrome. This mutation was previously reported in a German patient with an attenuated Hurler-Scheie phenotype [24]. A previous analysis [25] found that this mutation alters

Table 3

Patient's phenotype characteristics.

Mental retardation / Coarse Visual Respiratory Cardiac Visceromegaly Hernias Joint Bone Short Enzyme Consanguinity Family

developmental facial impairment disease disease disease disease stature replacement history

delay features therapy

MPS Y Y Y Y N Y Y Y Y Y Y N N

MPS Y Y N N N Y Y Y Y Y Y N N

MPS Y Y Y Y N Y Y Y Y Y Y N N

MPS Y Y N Y N Y Y Y Y Y Y N N

MPS N Y Y Y N Y Y Y Y Y Y N N

MPS Y Y Y Y N Y Y Y Y Y Y N N

MPS Y Y Y Y Y Y Y Y Y Y N Y N

MPS Y Y Y Y N Y Y Y Y Y Y N N

MPS Y Y Y N N N Y Y Y N Y N N

MPS Y Y Y Y N Y Y Y Y Y Y N Y

MPS Y Y Y Y N Y Y Y Y Y Y N Y

MPS N Y Y Y N N Y Y Y Y Y N N

MPS Y Y Y Y N Y Y Y Y Y Y N Y

MPS Y Y Y Y N Y Y Y Y Y Y Y N

Y: yes, N: no.

a key residue required for the catalytic activity of the IDUA enzyme, suggesting that the residual enzyme activity resulting from this mutation is associated with an attenuated phenotype [26].

Importantly, our analyses identified seven novel mutations occurring in 42.8% of our study population; three missense mutations (Y625C, P385L, R621L), one nonsense mutation (Q148X), one deletion (Asp298Glu+Ala229del), one insertion (1557-1558insC), and one splice site mutation (IVS9+1g>t). Further sequence and bioinformatic analysis of the missense mutations revealed that there is a high degree of interspecies conservation of the residue which is mutated in patients with MPS I, suggesting that each of the amino acid changes were pathogenic rather than polymorphic (Fig. 2).

The P385L mutation was found in a heterozygous state in a patient with an R89W mutation and Hurler-Scheie phenotype. The attenuated phenotype is associated with the R89W mutation as well as the

Table 4

IDUA mutations found in the 14 patients with MPS I.

Patient Mutation Phenotype

MPSI 001 W402Xa Hurler

MPSI 002 W402Xa Hurler

MPSI 003 W402Xa Hurler

MPSI 004 W402Xa Hurler

MPSI 005 W402X Y625Cb Hurler-Scheie

MPSI 006 1557-1558insCb Hurler

MPSI 007 A327Pa Hurler

MPSI 008 IVS9+1g>ta,b Hurler

MPSI 009 Q148Xb Hurler

Asp298Glu+Ala299delb

MPSI 010 E404X Arg48del Hurler

MPSI 011 E404X Arg48del Hurler

MPSI 012 R89W P385Lb Hurler-Scheie

MPSI 013 W402Xa Hurler

MPSI 014 W402X R621Lb Hurler

a This patient is homozygous for this mutation. b Novel mutations.

presence of some residual IDUA activity [26]. Since R89W is not a severe mutation, we propose that the P385L mutation is associated with a severe phenotype because it replaces a small and cyclic amino acid (proline) with a larger and branched one (leucine), resulting in the disruption of the secondary structure (alpha or beta) of the IDUA protein.

The R621L missense mutation was found in a heterozygous state with mutation W402X in a patient (MPSI 014) with severe phenotype. We believe that this novel mutation is also associated with a severe phenotype because it involves the substitution of a basic and charged amino acid (arginine) with a smaller, polar one (leucine) at a conserved site. Furthermore, a nonsense mutation in the same codon (R621X) has already been described as severe [27].

Another novel mutation was found in combination with W402X. This mutation was Y625C in a patient with a Hurler-Scheie phenotype (MPS I 005). We do not consider this mutation to be severe even though it substitutes a smalleramino acid (cysteine), which is capable of assembling sulfur bridges, with a larger aromatic one (tyrosine).

In addition to missense mutations, we found a nonsense mutation (Q148X) in a heterozygous state in a Hurler patient (MPS I 009). Nonsense mutations generate much shorter (truncated) proteins with no significant residual activity, and generally result in severe phenotypes [8]. This patient also had a 3-amino acid deletion (Asp298Glu+Ala299del), which alters the reading frame of the protein; this type of mutation is considered severe [27].

In another Hurler patient (MPS I 006), we found a homozygous insertion (1557-1558insC); this mutation could be associated with a severe phenotype [8,28]. This type of mutation has been shown to alter the reading frame of the protein [29]. Finally, one Hurler patient (MPS I 008) had a splice site mutation (IVS9+1g>t). Our bioinformatic analyses suggest that this type of mutation results in the loss of the donor splice site, thereby altering mRNA maturation and protein translation by generating new and aberrant reading frames, which constitutes a severe change. Similar findings were reported by Terlato and Cox [8]. In the present study, we found that loss of the 5' donor splice site results in the loss of the required sequence for attachment of the

Table 5

Novel mutations found in the 14 patients with MPS I.

Mutation

cDNA Position (ATG = 1 )

M747152 cDNA position

Nucleotide alteration

Protein change

Frequency (28 alleles)

Patient origin

Y625C 14 1874A ^ G 1962A ^ G TAC ^ TGC Tyr ^ Cys 1/28 (3.57%) Colombia (Cundinamarca)

1557-1558insC 11 1557-1558insC 1645-1646insC FRAMESHIFT - 2/28 (7.14%) Colombia (Boyacâ)

IVS9+1g>t Intr9 1402+1G ^ T 1293 + 1G ^ T MUT. SPLICING - 2/28 (7.14%) Ecuador

Q148X 4 442C ^ T 530C ^ T CAG ^ TAG Gln ^ Stop 1/28 (3.57%) Peru

Asp298Glu+Ala299del 7 894_896delCGA 982_984delCGA - Asp ^ Glu + Ala ^ del. 1/28 (3.57%) Peru

P385L 8 1154C ^ T 1242C ^ T CCG ^ CTG Pro ^ Leu 1/28 (3.57%) Colombia (Cundinamarca)

R621L 14 1862G ^ T 1950G ^ T CGA ^ CTA Arg ^ Leu 1/28 (3.57%) Colombia (Boyacâ)

Exon 9 CCGG TTAAGC Intron 9 CCGCAG GCCTGGTC Exon 10

Exon 9 Intron 9 Exon 10

Fig. 1. Model of splice site alteration in the lVS9+1g>t mutation. Model of the lVS9+1g>t mutation in exon 9 of patient MPSI008. The guanine (G) to thymine (T) substitution at the donor splice site leads to the loss of recognition of this sequence by the spliceosome, and retention of intron 9.

spliceosomal proteins; consequently, intron 9 remains intact and is not excised (Fig. 1).

The exclusion of one patient from this study with low enzyme activity indicative of MPS I, but no confirmatory mutations, implies the importance of both biochemical and molecular analyses in the diagnosis of MPS I. The 6-month-old patient underwent enzyme testing and genotyping because she was the younger sibling of patient MPS 004 who was diagnosed with MPS I (homozygous for the W402X mutation). While her enzyme levels were below the reference range, she was found to be a healthy, heterozygous carrier for the W402X mutation.

Clinical follow-ups further confirmed her asymptomatic status; the patient has remained healthy with no signs of MPS l through her 2-year clinical follow-up. Thus, it is important to take such information into account as part of establishing a standard for the diagnosis of MPS I in infants under one year of age who do not have obvious clinical symptoms. Additional support for this notion comes from newborn screening programs in the United States, which have identified apparent pseudo-deficiency alleles in the IDUA gene of newborns with low enzyme activity but no clinical manifestations [30]. A recent study by Kingma and colleagues [11] describing an algorithm for the early determination of

P385L Mutation

Human LTARFQVNNTRPPHVQLLRK

Mus musculus LTARFQVNNTHPPHVQLLRK

Bos taurus LTARFQVNNTHPPHVQLLRK

Danio rerio LTARFQVNNTHPPHVQJ LRK

Gallus gallus LTARFQMMNTKPPHVQMVRK

VLTAMGLLALLDEEQ

VLTVMGLMALLDGEQ

VLTAMALLALLDGEQ

VLTVMGLLALLGETQ

VLTVMGLLALLGEKQ

R621L and Y625C Mutation

Human YTPVSRKPSTFNLFVFSPDTGAVSGSYRV Mus musculus YAPINRRPSTFNLFVFSPDTAWSGSYRV Bos taurus FAPISRKPSTFNLFVFSPDTAWSGSYRV Danio rerio INHRDTIFTYFTYSPESLEVSGFYRA

Gallus gallus YKRINAKDTIFTLYVYSPGS-SVSGFYRV

R ALD Y WARPG

R ALD Y WARPG

C AVD Y WARPG

R AVD Y WGRNG

R AID Y WGKAG

Fig. 2. Sequence alignment of the novel missense mutations among species. Alignment of the IDUA protein sequence in five species. The missense mutations Y625C, P385L and R621L occur in highly conserved sites.

phenotypic severity in patients with MPS I, suggests that IDUA enzyme activity be measured only in newborns in whom the genotype is inconclusive of a phenotypic severity. The presence of early clinical symptoms of MPS I (upper airway obstruction and hernia) is the last step in the algorithm, as these may be difficult to diagnose in newborns [11]. Further data will be required to establish the utility of biochemical analysis (enzyme activity in leukocytes) in this age group, since it can be difficult to diagnose MPS I in children younger than one year of age.

In conclusion, the prevalence of W402X in the Andean population included in our study was similar to the prevalence of this mutation reported in the rest of the world [8]. However, other common mutations (Q70X, P533R, and L490P) were not found and novel mutations were noted with an incidence rate of 42.8%. Finally, the pathogenic potential of these novel mutations will need to be characterized with more robust bioinformatic approaches (docking) and in-vitro methodologies (functional studies).

Acknowledgments

We would like to thank Genzyme, a Sanofi company, for supporting this study, and Iva Ivanovska Holder, PhD, Genzyme Global Medical Affairs, Andrea Gwosdow, PhD, and Cherie Dewar, Gwosdow Associates Science Consultants, LLC for editing and formatting the manuscript. We would also like to thank the National University of Colombia for the project's financial support (QUIPU.DIB.U.N. 10583) and finally, we would like to specially acknowledge the patients and their families.

References

[1 ] The mucopolysaccharidoses, in: A.B. CR Scriver, D. Valle, et al., (Eds.), The Metabolic and Molecular Bases of Inherited Disease, McGraw-Hill Book Company, New York 2001.

[2] OMIM, Entry - * 252800 - ALPHA-L-IDURONIDASE; IDUAAvailable from: http:// omim.org/entry/252800?search=252800&highlight=2528002011.

[3] J. Muenzer, J.E. Wraith, L.A. Clarke, Mucopolysaccharidosis I: management and treatment guidelines, Pediatrics 123 (1) (2009) 19-29.

[4] G.M. Pastores, P. Arn, M. Beck, J.T. Clarke, N. Guffon, P. Kaplan, et al., The MPS I registry: design, methodology, and early findings of a global disease registry for monitoring patients with mucopolysaccharidosis type I, Mol. Genet. Metab. 91 (1) (2007) 37-47.

[5] C.A. Pennodc, A review and selection of simple laboratory methods used for the study of glycosaminoglycan excretion and the diagnosis of the mucopolysaccharidoses, J. Clin. Pathol. 29 (2) (1976) 111-123.

[6] NA Chamoles, M.B. Blanco, D. Gaggioli, C. Casenttni, Hurler-like phenotype: enzymatic diagnosis in dried blood spots on filter paper, Clin. Chem. 47 (12) (2001) 2098-2102.

[7] C.W. Hall, I. Liebaers, P. Di Natale, E.F. Neufeld, Enzymic diagnosis of the genetic mucopolysaccharide storage disorders, Methods Enzymol. 50 (1978) 439-456.

[8] N.J. Terlato, G.F. Cox, Can mucopolysaccharidosis type I disease severity be predicted based on a patient's genotype? A comprehensive review of the literature, Genet. Med. 5 (4) (2003) 286-294.

[9] S. Bunge, W.J. Kleijer, C. Steglich, M. Beck C. Zuther, C.P. Morris, et al., Mucopoly-saccharidosis type I: identification of 8 novel mutations and determination of the frequency of the two common alpha-L-iduronidase mutations (W402X and Q70X) among European patients, Hum. Mol. Genet. 3 (6) (1994) 861 -866.

D. Tomi, A Schultze-Mosgau, J. Eckhold, B. Schopper, S. Al-Hasani, C. Steglich, et al., First pregnancy and life after preimplantation genetic diagnosis by polar body analysis for mucopolysaccharidosis type I, Reprod. BioMed. Online 12 (2) (2006) 215-220.

S.D. Kingma, E.J. Langereis, C.M. de Klerk L. Zoetekouw, T. Wagemans, L. ]Jlst, et al., An algorithm to predict phenotypic severity in mucopolysaccharidosis type I in the first month of life, Orphanet J. Rare Dis. 8 (2013) 99.

J. Mandelli, A. Wajner, R Pires, R Giugliani, J.C. Coelho, Effect of CuCl2, NaCl and

EDTA on the enzyme alpha-L-iduronidase in the plasma of normal individuals and

heterozygotes for MPS I, Clin. Chim. Acta 318 (1-2) (2002) 83-89.

C.E. Beesley, C.A. Meaney, G. Greenland, V. Adams, A. Vellodi, E.P. Young, et al.,

Mutational analysis of 85 mucopolysaccharidosis type I families: frequency of

known mutations, identification of 17 novel mutations and in vitro expression of

missense mutations, Hum. Genet. 109 (5) (2001) 503-511.

H.S. Scott, X.H. Guo, J.J. Hopwood, C.P. Morris, Structure and sequence of the human

alpha-L-iduronidase gene, Genomics 13 (4) (1992) 1311-1313.

BDGP, Splice Site Prediction by Neural NetworkAvailable from: http://www.fruitfly.

org/seq_tools/splice.html2013.

C. Ferrer-Costa, J.L. Gelpi, L. Zamakola, I. Parraga, X. de la Cruz, M. Orozco, PMUT: a web-based tool for the annotation of pathological mutations on proteins, Bioinformat-ics 21 (14) (2005)3176-3178.

UB - Molecular Recognition Group - PMut, Available from: http://mmb2.pcb.ub.es: 8080/PMut/2011.

PolyPhen-2: Prediction of Functional Effects of Human nsSNPsAvailable from: http://genetics.bwh.harvard.edu/pph2/index.shtml2011.

U. Matte, G. Yogalingam, D. Brooks, S. Leistner, I. Schwartz, L. Lima, et al., Identification and characterization of 13 new mutations in mucopolysaccharidosis type I patients, Mol. Genet. Metab. 78 (1) (2003) 37-43.

P. Li, T. Wood, J.N. Thompson, Diversity of mutations and distribution of single nucleotide polymorphic alleles in the human alpha-L-iduronidase (IDUA) gene, Genet. Med. 4 (6) (2002) 420-426.

L. Gort, A. Chabas, M.J. Coll, Analysis of five mutations in 20 mucopolysaccharidosis type 1 patients: high prevalence of the W402X mutation. Mutations in brief no. 121. Online, Hum. Mutat 11 (4) (1998) 332-333.

L. Chkioua, S. Khedhiri, H. Ben Turkia, H. Chahed, S. Ferchichi, M.F. Ben Dridi, et al., Hurler disease (mucopolysaccharidosis type IH): clinical features and consanguinity in Tunisian population, Diagn. Pathol. 6 (2011)113.

S. Wang, N. Ray, W. Rojas, M.V. Parra, G. Bedoya, C. Gallo, et al., Geographic patterns of genome admixture in Latin American Mestizos, PLoS Genet. 4 (3) (2008) e1000037.

S. Bunge, W.J. Kleijer, C. Steglich, M. Beck, E. Schwinger, A. Gal, Mucopolysaccharidosis type I: identification of 13 novel mutations of the alpha-L-iduronidase gene, Hum. Mutat. 6(1) (1995) 91-94.

K.W. Zhao, K.F. Faull, E.D. Kakkis, E.F. Neufeld, Carbohydrate structures of recombinant human alpha-L-iduronidase secreted by Chinese hamster ovary cells, J. Biol. Chem. 272 (36) (1997) 22758-22765.

L.K. Hein, J.J. Hopwood, P.R. Clements, D.A. Brooks, The alpha-L-iduronidase mutations R89Qand R89W result in an attenuated mucopolysaccharidosis type I clinical presentation, Biochim. Biophys. Acta 1639 (2) (2003) 95-103. F. Bertola, M. Filocamo, G. Casati, M. Mort, C. Rosano, A. Tylki-Szymanska, et al., IDUA mutational profiling of a cohort of 102 European patients with mucopolysaccharidosis type I: identification and characterization of 35 novel alpha-L-iduronidase (IDUA) alleles, Hum. Mutat. 32 (6) (2011) E2189-E2210.

L.E. Maquat, Defects in RNA splicing and the consequence of shortened translational reading frames, Am. J. Hum. Genet. 59 (2) (1996) 279-286. P. Jin, J.W. Hao, K. Chen, C.S. Dong, Y.B. Yang, Z.H. Mo, A 3' splice site mutation of IDS gene in a Chinese family with mucopolysaccharidosis type II, Gene 528 (2) (2013) 236-240.

C.E. Lawson3, MES, M. Willing4, L. Manwaring4, T.C. Wood, Three Apparent Pseudo-deficiency Alleles in the IDUA Gene Identified by Newborn Screening, 2013.