Scholarly article on topic ' Transcriptional profile of S almonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization '

Transcriptional profile of S almonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization Academic research paper on "Biological sciences"

0
0
Share paper
Academic journal
Microbial Biotechnology
OECD Field of science
Keywords
{""}

Academic research paper on topic " Transcriptional profile of S almonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization "

Transcriptional profile of Salmonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization

Kerstin Brankatschk, Tim Kamber,* Joël F. Pothier,* Brion Duffy* and Theo H. M. Smits**

Plant Protection Division, Agroscope Changins-Wadenswil ACW, Schloss 1, Wadenswil CH-8820, Switzerland.

Summary

Sprouted seeds represent a great risk for infection by human enteric pathogens because of favourable growth conditions for pathogens during their germination. The aim of this study was to identify mechanisms of interactions of Salmonella enterica subsp. enterica Weltevreden with alfalfa sprouts. RNA-seq analysis of S. Weltevreden grown with sprouts in comparison with M9-glucose medium showed that among a total of 4158 annotated coding sequences, 177 genes (4.3%) and 345 genes (8.3%) were transcribed at higher levels with sprouts and in minimal medium respectively. Genes that were higher transcribed with sprouts are coding for proteins involved in mechanisms known to be important for attachment, motility and biofilm formation. Besides gene expression required for phenotypic adaption, genes involved in sulphate acquisition were higher transcribed, suggesting that the surface on alfalfa sprouts may be poor in sulphate. Genes encoding structural and effector proteins of Salmonella patho-genicity island 2, involved in survival within macrophages during infection of animal tissue, were higher transcribed with sprouts possibly as a

Received 26 September, 2013; revised 30 October, 2013; accepted 30 October, 2013. *For correspondence. E-mail theo.smits@zhaw.ch; Tel. +41 58 934 5293; Fax +41 58 935 5293. Present addresses: Department of Plant Biology and Forest Genetics, Uppsala BioCenter, Swedish University of Agricultural Sciences and Linnean Center for Plant Biology, Uppsala, Sweden; ^Research Group for Environmental Genomics and Systems Biology, Institute for Natural Resource Sciences, Zurich University of Applied Sciences ZHAW, Gruental, CH-8820 Wadenswil, Switzerland. doi:10.1111/1751-7915.12104

Funding Information Funding was provided by the European FP7 CORE-Organic ERA-Net Pilot Project 'PathOrganic' and the Swiss Federal Office of Agriculture (BLW, P01.18.01.06).

response to environmental conditions. This study provides insight on additional mechanisms that may be important for pathogen interactions with sprouts.

Introduction

Outbreaks of zoonotic pathogens like Salmonella serovars or Escherichia coli O157:H7 are commonly known to be linked to meat products from bovine, pork or poultry (Chiu etal., 2005). Increasingly, outbreaks associated with contaminated sprouts and fresh vegetable produce (e.g. lettuce, spinach, tomato) are becoming a public health concern (Taormina etal., 1999; Sivapalasingam etal., 2004; Berger etal., 2010). A possible explanation is increased consumption caused by enhanced recognition by the broader public of sprouts as nutritious food. However, during mass production thereof, favourable conditions are generated during germination for bacteria such as Salmonella spp., especially when hygienic standards are not followed (Studer etal., 2013). In Europe, outbreaks linked to contaminated sprouts were caused by S. enterica subsp. enterica serovars Stanley, Bovismorbificans and Bareilly (Cleary etal., 2010). Another Salmonella serovar, S. enterica subsp. enterica serovar Weltevreden, that is commonly known to be a problem associated with meat products in Southeast Asia (Sood and Basu, 1979; Bangtrakulnonth etal., 2004; Learn-Han etal., 2008) recently emerged in Western countries, linked not only to meat but also to vegetable products. This serovar was recognized for the first time on plant products as the cause of an outbreak of gastroenteritis in Scandinavia (Norway, Denmark and Finland) resulting from consumption of contaminated alfalfa sprouts (Emberland etal., 2007). This outbreak was caused by seeds contaminated with S. Weltevreden that regrew during germination (Taormina etal., 1999; Emberland etal., 2007).

During epidemiological investigations, seeds were found to be the source of several outbreaks. Isolation of Salmonella spp. from sprouts and their seeds suggests that enteric pathogens can colonize, multiply and persist for prolonged periods of time during production of sprouts. For contamination, only minimal levels of Salmonella spp. are necessary, as the pathogens can multiply fast during

© 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and

reproduction in any medium, provided the original work is properly cited.

the manufacturing processes with sprouts. Despite optimal growth conditions for enteric pathogens with sprouts, only Salmonella spp. and E. coli O157:H7 have been isolated so far. Therefore, colonization mechanisms that are active during interactions with sprouts are of great interest to explain enhanced detection of these pathogens. In a comparative experiment, it was shown that Salmonella spp. can attach significantly better to sprouts than E. coliO157:H7 (Barak etal., 2002). In another study of the same group, it was found that certain virulence genes are necessary for attachment of plant tissue (Barak etal., 2005). Mutants of agfB (also named csgD), a surface-exposed aggregative fimbria nucleator (Nuccio and Baumler, 2007) that regulates curli and cellulose production, and of rpoS, regulating the same and other adhesins such as pili, showed reduced adherence to alfalfa sprouts. Upregulation of flagellar regulons and fimbrial genes were also found for E. coli O157:H7 during growth on lettuce lysate (Kyle etal., 2010). Besides genes responsible for motility and attachment, genes involved in carbohydrate metabolism and stress responses, genes encoding pathogenicity islands (LEE operons) and putative effector proteins were also upregulated in lettuce lysate (Kyle etal, 2010).

In the genome of S. Weltevreden 2007-60-3289-1, a strain isolated after an outbreak in Scandinavia in association with alfalfa sprouts, we found three serovar-specific genomic islands (GIs), encoding carbohydrate metabolism genes (Brankatschk etal., 2012). Analysis by reverse transcription-polymerase chain reaction (RT-PCR) showed that only genes of GI_VI encoding proteins putatively involved in mannitol degradation were transcribed with sprouts. Additionally, we found that S. Weltevreden 2007-60-3289-1 was able to grow on additional stereoisomers of myo-inositol, a carbohydrate ubiquitous distributed in the environment such as on plants. The additional carbohydrate clusters and possibility to utilize more than one stereoisomer of myo-inositol might enhance survival of this serovars on plants.

By analysing the complete transcriptome of Salmonella spp. on vegetables, our study aimed to identify genes that are differentially regulated during growth with sprouts in comparison to growth in a minimal medium without bacterial competition. To cover the complete transcriptome, enriched mRNA from both growth conditions was analysed by RNA-seq, the analysis of steady state RNA using next generation sequencing techniques (Wilhelm etal., 2008; Passalacqua etal., 2009; Wang etal., 2009; Raabe etal., 2011). To verify results of RNA-seq analysis, a number of genes that had a higher transcription level in presence of sprouts were chosen to be analysed using quantitative RT-PCR (qRT-PCR). Analysis was done with sprout samples as well as with leafy salad, spinach and lamb's lettuce.

Results

Salmonella Weltevreden 2007-60-3289-1 was grown with sprouts and in M9-glucose medium and harvested in the mid-exponential growth phase. RNA-seq analysis of these samples resulted in expression signals for 4158 genes. About 522 genes (12.55%) were significantly differential transcribed between both growth conditions, of which 177 (4.267%) were more transcribed in presence of sprouts and 345 (8.30%) were more transcribed in M9-glucose medium (Fig. 1; Table 1). Altogether, 14 genes were not transcribed in presence of sprouts but were transcribed in M9-glucose medium, whereas no genes were only transcribed in presence of sprouts.

Genes more transcribed in presence of sprouts

According to Kyoto Encyclopedia of Genes and Genomes (KEGG) categorization, genes significantly more transcribed in presence of sprouts include genes involved in amino acid metabolism, carbohydrate metabolism, genetic information processing and Salmonella infection [Salmonella pathogenicity island (SPI)-2; Fig. 2]. Various genes remained unclassified as they encode hypothetical proteins or proteins with an unknown function. A major difference is that around 30 ribosomal proteins are significantly higher transcribed in presence of sprouts than in M9-glucose medium (Table 1). This difference might be caused by a different growth rate in the two conditions. As the growth with sprouts could not be quantified because of biofilm formation, quantitative differences are not given.

Sulphate/cysteine biosynthesis and acquisition with sprouts

Altogether, 21 genes were more transcribed in presence of sprouts encoding proteins involved in amino acid metabolism which represented the cluster with most genes significantly more transcribed in presence of sprouts in one category. Of these 21 genes, 12 genes encode part of cysteine biosynthesis and acquisition (Fig. 3, Table 1). Two uptake and reduction systems for sulphate were upregulated in presence of sprouts. Almost all genes encoding genes necessary for reduction of sulphate (cysD and cysN; SENTW_3022 and 3021) over sulphite (cysHC; SENTW_3041, 3020) to sulphide (cysIJ; SENTW_3043-42) were more transcribed in presence of sprouts after extracellular sulphate entered the cell via a sulphate-binding protein encoded by spb (SENTW_4153) and a sulphate permease (cysAW; SENTW_2620-21). The genes encoding proteins involved in sulphate uptake (cysAW) can also transport external thiosulphate into the cell and attach O-acetylserine (thiol)-lyase to S-sulphocysteine (cysM; SENTW_2618), which is later

Fig. 1. Fold change of genes higher transcribed during growth with sprouts in comparison with growth in M9-glucose medium. A negative fold change shows higher expression of genes in M9-glucose medium whereas a positive fold change shows higher expression in presence of sprouts. Altogether, 4158 genes were compared using Cufflinks whereas expression of 522 genes was significantly different (P< 0.05) with a fold change higher than 2.0 or lower than -2.0 (white line). Genes indicated as triangle and labelled with a gene name were used for qRT-PCR. As the fold change for glnK is out of scale while it is only transcribed in M9-glucose medium, it is indicated with an arrow.

transformed to cysteine (Sekowska etal., 2000). The gene encoding MetB, the cystathionine gamma-synthase (Sekowska etal., 2000), which plays a role in methionine synthesis, was transcribed higher in presence of sprouts than in M9-glucose medium. Other single genes involved amino acid utilization pathways like degradation of histi-dine [hutH, hutU (SENTW_0769-0770)], arginine and orthinine (argI, speB, speD), arginine and proline (putA, putP), valine, leucine and isoleucine (ilvB, ilvN, phnA, avtA) were more transcribed in presence of sprouts. Most of these proteins are involved in multiple pathways or catalyse more than one step in the amino acid metabolic pathway.

Fimbrial genes

In response to sprouts, genes encoding curli involved in adhesion to surfaces, cell aggregation and biofilm formation were more transcribed. The gene encoding CsgA, the major curli subunit, was transcribed, but not significantly higher in presence of sprouts, whereas csgB (SENTW_ 2110), encoding the anchor for curli fibre which is composed of polymerized monomers (Loferer etal., 1997), was more transcribed in presence of sprouts (Table 1, Fig. 3). Similarly, csgG and csgD (SENTW_2114, 2111)

which are part of the csgDEFG operon encoding accessory proteins that facilitate the secretion and assembly of CsgA into a fibre were higher transcribed. Another gene encoding a fimbrin-like protein, bcfE (SENTW_4730), which was found in E. coli to play a role in pilus biosynthesis (Valenski etal., 2003), was more transcribed in presence of sprouts.

Type III secretion systems

One of the major virulence factors of Salmonella is the type III secretion system (T3SS) located on SPI-2, involved in survival in macrophages during animal infection (Cirillo etal., 1998). Genes encoding structural and effector proteins thereof were more transcribed in presence of sprouts, including those encoding part of the secretion apparatus SsaGHIJ (SENTW_1805-08), SsaM, SsaR and SsaTUV (SENTW_1794,1795, 1796, 1800 and 1801) as well as a chaperone (sscB; SENTW_1811). Additionally, five genes encoding effector proteins [SifA, SseE, SopD, PipB and SseL (SENTW_2029,1812, 3040, 1007 and 2415)] were more transcribed in presence of sprouts that play a role in pathogen-host interaction by formation of lysosomal glycoprotein-containing structures in epithelial cells (SifA, SENTW_2029), regulation of

Table 1. Genes higher transcribed in presence of sprouts in comparison to M9-glucose medium determined by RNA-seq analysis.

Category Gene Locus tag Fold change Function

Amino acid argI SENTW_ _4577 11.84 Ornithine carbamoyltransferase 1

metabolism speB SENTW _3201 5.79 Agmatinase

speD SENTW_ _0130 8.12 S-adenosylmethionine decarboxylase

putA SENTW _1034 5.07 Transcriptional repressor, proline oxidase

putP SENTW_ _1045 5.01 Sodium/proline symporter

ilvB SENTW_ _3900 5.34 Acetolactate synthase

ilvN SENTW_ _3899 8.33 Acetolactate synthase small subunit

avtA SENTW_ _3763 4.67 Valine pyruvate aminotransferase

phnA SENTW_ _4376 9.47 Alkylphosphonate utilization operon protein

hutH SENTW_ 0770 8.68 Histidine ammonia-lyase

hutU SENTW_ 0769 3.93 Urocanate hydratase

carA SENTW_ _1700 9.47 Carbamoyl-phosphate synthase small chain

sbp SENTW_ _4153 9.94 Sulphate-binding protein

cysM SENTW_ _2618 4.46 Cysteine synthase B

cysl, cysJ SENTW_ _3043-42 8.26 Sulphite reductase

cysH SENTW_ _3041 8.47 Sulphate reductase

cysD SENTW_ 3022 16.05 Sulphate adenylsltransferase subunit

cysC SENTW_ 3020 15.37 Adenosine 5'-phosphosulphate kinase

cysN SENTW_ _3021 15.37 Sulphate adenylsltransferase subunit

cysA, cysW, cysT, cysP SENTW_ 2620-23 5.56 Sulphate transporter

metB SENTW_ _4189 5.63 Cystathionine gamma-synthase

ST2 SENTW_ _4354 5.43 Sulphate transporter

pphA SENTW_ _1338 311.10 Serine/threonine-protein phosphatase

Pathogenicity island sifA SENTW_ 2029 8.68 Secreted protein

(SPI-2) ssaG, ssaH, ssal

ssaJ, ssaK, ssaL SENTW_ _1805-011 4.29 Secretion apparatus

ssaT, ssaU SENTW_ _1794-95 7.22 Secretion apparatus

ssaM, ssaV SENTW_ 1800-01 6.91 Secretion apparatus

sseE SENTW_ _1812 5.93 Effector protein

sscB SENTW_ _1811 23.57 Chaperone

ssaR SENTW_ _1796 12.86 Export apparatus

sopD2 SENTW_ _3040 5.99 Effector protein

pipB SENTW_ _1007 4.01 Effector protein

sseL SENTW_ _2415 5.46 Deubiquitinase

Motility csgB SENTW_ _2110 16.75 Minor curli subunit

csgG SENTW_ _2114 5.49 Curli production assembly/transport component

csgD SENTW_ _2111 5.21 Transcriptional regulator

bcfE SENTW_ _4730 4.81 Fimbrin-like protein FimI

spy SENTW_ _1904 6.15 Spheroplast protein

Cofactors and energy thiC, thiE, thiF, thiS SENTW_ 4269-72 12.48 Thiamin phosphate pyrophosphorylase, Thiamine

production biosynthesis proteins

nuoI SENTW_ 2443 6.82 NADH dehydrogenase I (chain I)

nuoE, nueF SENTW_ 2449-50 3.30 NADH dehydrogenase I (chains E and F)

metF SENTW_ _4195 6.17 Methylenetrahydrofolate reductase

atpG SENTW_ _3971 4.42 Membrane-bound ATP synthase

Regulators fis SENTW_ _3516 37.55 DNA binding protein

yiaG SENTW_ 3750 13.86 Transcriptional regulator

metR SENTW_ 4054 13.81 Transcriptional regulator

rcsA SENTW_ _1101 9.30 Regulator of capsular polysaccharide synthesis

ydcl SENTW_ _1576 6.26 Probable RuBisCO transcriptional regulator

ydhM SENTW_ _1780 5.67 HTH-type transcriptional repressor

ydcN SENTW_ _1600 4.29 Uncharacterized HTH-type transcriptional regulator

mntR SENTW_ _0817 3.92 Manganese transport regulator

Stress response pspA SENTW_ _1509 15.49 Phage shock protein

pspB, pspC SENTW_ _1510-11 5.75 Phage shock protein

ibpA SENTW_ _3916 5.86 Heat shock protein

osmY SENTW_ 4668 9.81 Osmotically-inducible protein

Transporters yehW SENTW_ _1718 8.27 Bicarbonate transport system permease

fliY SENTW_ _1129 5.49 Cysteine-binding periplasmic protein

yliA SENTW_ 0829 2.92 Glutathione transporter

corA SENTW_ 4042 4.96 Magnesium transporter protein

dctA SENTW_ _3716 4.87 C4-dicarboxylate transport protein

ybiR SENTW_ _0818 2.58 Inner membrane protein

ydjN3 SENTW_ _1892 12.28 L-cystine uptake protein tcyP

Protein export; Bacterial yajC SENTW_ 0393 4.06 Preprotein translocase subunit YajC

secretion system uraA SENTW_ 2680 14.89 Uracil permease

Table 1. cont.

Category Gene Locus tag Fold change Function

Lipid metabolism glpK SENTW_4175 12.90 Glycerol kinase

glpT SENTW 2411 12.82 Glycerol-3-phosphate transporter

glpF SENTW_4176 7.58 Glycerol uptake facilitator protein

glpQ SENTW 2410 6.15 Glycerophosphodiester phosphodiesterase

cdh1 SENTW 4154 4.81 CDP-diacylglycerol pyrophosphatase

yjfO SENTW_4482 13.03 Lipoprotein

ybaY SENTW_0451 6.20 Uncharacterized lipoprotein

Fatty acid metabolism fadB SENTW_4073 6.14 Enoyl-CoA hydratase

fadA SENTW_4072 4.47 Small (beta) subunit of the fatty acid-oxidizing

multienzyme complex

Post-transcriptional queA SENTW_0390 11.26 Synthesis of queuine in tRNA

modification trmD SENTW_2838 9.46 tRNA methyltransferase

yhdG SENTW_3515 7.78 tRNA-dihydrourindine synthase B

rpoA SENTW_3542 7.24 DNA-dependent RNA polymerase

Carbohydrate aceB SENTW_4287 10.86 Malate synthase A

metabolism acs SENTW 4361 8.99 Acetyl-coenzyme A synthetase

sdhC, sdhD, sdhA SENTW 0709-11 5.39 Succinate dehydrogenase

sdhB SENTW_0712 4.82 Succinate dehydrogenase iron-sulphur protein

sucC,sucD SENTW 0716-17 2.63 Succinyl-CoA synthetase

prsA SENTW_1416 5.20 Ribose-Phosphate pyrophosphokinase

cpsB, rfbK SENTW_2210-11 3.06 Mannose-1-phosphate guanylyltransferase;

phosphomannomutase

Nucleotide metabolism upp SENTW_2681 8.83 Uracil phosporibosyltransferase

nrdA SENTW_2405 4.66 Ribonucleoside-diphosphate reductase alpha

Genetic information

processing -

Replication and repair priB SENTW_4495 4.54 Primosomal replication protein N

ruvC SENTW 1185 4.31 Cross-over junction endodeoxyribonuclease

rplB SENTW_3564 6.05 50S ribosomal protein L2

rplD, rplW SENTW_3565-66 6.59 50S ribosomal protein L4; 50S ribosomal protein 1 OQ L23

rplF SENTW_3552 7.62 50S ribosomal protein L6

rplI SENTW_4497 5.45 50S ribosomal protein L9

rplJ SENTW_4260 7.77 50S ribosomal protein L10

rplK SENTW_4258 6.87 50S ribosomal protein L11

rplL SENTW 4261 14.24 50S ribosomal protein L7/L12

rplO SENTW_3548 4.54 50S ribosomal protein L15

rplP, rpmC, rpsQ SENTW_3558-60 5.73 50S ribosomal protein L16; 50S ribosomal protein

L29; 30S ribosomal protein S17

rplQ SENTW 3541 5.94 50S ribosomal protein L17

rplS SENTW_2837 12.01 50S ribosomal protein L19

rplU SENTW_3432 4.42 50S ribosomal protein L21

rplV SENTW_3562 6.73 50S ribosomal protein L22

rpmA SENTW_3431 6.60 50S ribosomal protein L27

rpmB SENTW_3829 5.06 50S ribosomal protein L28

rpmD SENTW_3549 3.82 50S ribosomal protein L30

rpmF SENTW_2062 6.82 50S ribosomal protein L32

rpmG SENTW_3828 8.15 50S ribosomal protein L33

rpmJ SENTW_3546 5.27 50S ribosomal subunit protein L36

rpsH SENTW_3553 10.11 30S ribosomal protein S8

rpsI SENTW_3473 6.06 30S ribosomal protein S9

rpsK SENTW_3544 5.67 30S ribosomal protein S11

rpsR SENTW_4496 12.63 30S ribosomal protein S18

rpsS SENTW_3563 7.07 30S ribosomal protein S19

rpsT SENTW_4750 6.53 30S ribosomal protein S20

rpsU SENTW_3346 9.92 30S ribosomal protein S21

yfjA SENTW_2839 5.16 Ribosome maturation factor RimM

Unclassified yaiB SENTW_0366 5.03 Anti-adapter protein IraP

nusG SENTW_4257 5.15 Elongation factor

rnt SENTW 1783 4.24 Ribonuclease T

cesT SENTW_2267 4.16 Putative cytoplasmic protein

sixA SENTW_2511 4.02 Phosphohistidine phosphatase

rnpA, yidD SENTW_3942-43 3.26 RNase P, protein component

era, rnc SENTW_2769-70 2.63 GTP-binding protein era homolog

ntpA SENTW 1183 6.70 dATP pyrophosphohydrolase

ydcF SENTW 1578 8.27 Putative esterase

6 K. Brankatschk et al. Table 1. cont.

Category

Gene Locus tag Fold change Function

SENTW_0391 32.88 Hypothetical protein

ycdZ SENTW 2115 5.11 Hypothetical protein

SENTW_1535 21.31 Hypothetical protein

SENTW 1536 18.25 Hypothetical protein

SENTW 1962 11.16 Hypothetical protein

SENTW_1381 6.75 Hypothetical protein

yeel SENTW 2127 4.43 Hypothetical protein

yibP SENTW_3805 4.27 Hypothetical protein

yigM SENTW 4053 4.01 Hypothetical protein

SENTW 0384 3.95 Hypothetical protein

sopD SENTW_0915 13.24 Homologous to secreted protein SopD (T3SS)

yahO SENTW_0348 4.40 Protein of unknown function

yebV SENTW_1340 15.38 Uncharacterized protein

yiaK SENTW_3767 9.61 Putative protein

yciF SENTW_1469 11.99 Unknown function

ygaT (csiD) SENTW_2877 19.85 Hypothetical protein

tctA SENTW_2876 10.62 Unknown function

yqeF SENTW_3132 4.61 Putative acyltransferase

TPX SENTW 1534 6.12 Putative thiol peroxidase

ybdL SENTW_0580 4.55 Putative aminotransferase

yjgF SENTW_4564 7.03 Protein TdcF

yiaL SENTW_3768 7.86 Protein YiaL

ytfK SENTW_4510 8.24 Uncharacterized protein YtfK

yhcN3 SENTW_3490 5.82 Protein YdgH

ygaU SENTW_2883 5.51 Uncharacterized protein YgaU

yggE SENTW 3181 6.70 Uncharacterized protein YggE

yfeK SENTW_2617 5.38 Uncharacterized protein YfeK

yjfN SENTW_4481 6.70 UPF0379 protein YjfN

Hypothetical proteins

aggregative fimbriae synthesis and biofilm formation (SopD, SENTW_3040) (Römling etal., 1998; Prigent-Combaret etal., 2001), localization of Salmonella-induced filaments (PipB, SENTW_1007) (Knodler etal., 2002), regulation of protein secretion (SseE, SENTW_ 1812) (Cirillo etal., 1998) or fitness enhancement of S. Typhimurium during colonization of infected host (SseL; SENTW_2415) (Coombes etal, 2006).

Lipid, fatty acid metabolism and thiamine biosynthesis

Salmonella spp. as well as E. coli are able to use glycerol as a carbon source (Gutnick etal., 1969). The glycerol facilitator gene glpF (SENTW_4176) was more transcribed in presence of sprouts as well as the glycerol kinase encoded by glpK (SENTW_4175), which pho-sphorylates glycerol to glycerol-3-phosphate (luchi etal., 1990). Another way to obtain glycerol-3-phosphate for biosynthesis is to hydrolyse glycerophosphodiester in the periplasm, which is encoded by glpQ (SENTW_2410) and following transport into the cell by a permease encoded by glpT (SENTW_2411). Both genes were more transcribed in presence of sprouts.

For fatty acid utilization as a carbon source, at least five separate operons are involved (Bachmann and Low, 1980). The genes fadA (SENTW_4072) and fadB (SENTW_4073) of the fadABC operon encoding the ß-oxidation multi-enzyme complex were transcribed 2.8-and 3.5-fold higher than in M9-glucose medium.

The thiamine biosynthetic pathway is complex and is encoded on three operons and four single gene loci (Begley etal., 1999). Four genes that encode part of the thiamine pathway were more transcribed during growth with sprouts. These include thiF, which encodes an adenyltransferase (SENTW_4270) and thiS encoding a sulphur carrier protein (SENTW_4269). Gene thiC (SENTW_4272) encodes a hydroxymethyl pyrimidine synthase involved in pyrimidine biosynthesis and thiE (SENTW_4271) is required for linking thiazole and pyrimidine. Presence of intermediate products at different levels might lead to differences in expression ratios for each gene involved in the formation of thiazole.

Regulators

Altogether, eight regulatory genes were more transcribed in presence of sprouts, with fis (SENTW_3516) being the regulatory gene with highest fold expression ratio (38-fold). In S. Typhimurium, this DNA-binding protein is involved in coordinating the expression of metabolic, flagella and type III secretion factors especially encoded on SPI-2 (Kelly etal., 2004). Full expression of fis is required for upregulation of genes encoding secretion apparatus of T3SS and effectors required for invasion of host epithelial cells, for survival in macrophages and synthesis of flagella for motility (Kelly etal., 2004). Genes encoding the secretion apparatus of SPI-2 and motility genes were found to be more transcribed in presence of sprouts. The gene

Fig. 2. Relative percentage of genes significantly more transcribed during growth in presence of sprouts (white bars) compared with M9-glucose medium (black bars). Functions of genes of interest were classified according to the Kyoto Encyclopedia of Genes and Genomes pathway database.

ydcI (SENTW_1576) encoding a conserved DNA-binding protein is related to stress resistance, and possibly, virulence (Jennings etal., 2011) was more transcribed in presence of sprouts. Additional higher transcribed genes in presence of sprouts encode the regulator RcsA (SENTW_1101), which is besides RcsB one of the positive regulators for transcription of capsular polysaccharide synthesis in E. coli (Sledjeski and Gottesman, 1995) and YdhM (SENTW_1780), which is a putative TetR-family regulator that mainly regulates biosynthesis of antibiotics, efflux pumps and osmotic stress (Ramos etal., 2005).

Stress

Analysis of the transcriptional profile of S. Weltevreden grown with sprouts revealed that genes responding to stress were more transcribed than in M9-glucose medium. The genes pspA, pspB and pspC (SENTW_1509-1511) encoding the phage-shock-protein operon (psp) which is responsible for damage repair and maintenance of the proton-motive force of the inner membrane (Darwin, 2005; Kobayashi etal., 2007) were more transcribed in presence of sprouts. As transcription of pspA is prevented under non-induced conditions and transcription pspA

increases because of the release of PspA from PspF (Dworkin etal., 2000; Darwin, 2005), it can be concluded that S. Weltevreden is stressed in presence of sprouts. Indeed, of the psp operon, pspA was transcribed with highest fold change between the two samples.

Other stress response genes more transcribed in presence of sprouts were ibpA (SENTW_3916), encoding a heat shock protein that stabilizes thermally aggregated proteins, in combination with IbpB (Kitagawa etal., 2000) and the gene osmY (SENTW_4668) encoding an osmoti-cally inducible periplasmic protein (Yim and Villarejo, 1992).

Genes more transcribed in M9-glucose medium

Genes more transcribed during growth in M9-glucose medium (Table S1) encode proteins encoding phage proteins (SENTW_2536, 2552-2553, 2822-2823), an L-fucose-1-phosphate aldolase (SENTW_3083), a PTS system specific for galactitol (SENTW_3389) that is part of the galactose metabolism and a hypothetical protein (SENTW_1049). Additionally, genes ccmE-H (SENTW_ 2375-2380) encoding a heme chaperone [ccmE, (Schulz etal., 1998)], a small membrane protein [ccmD, (Schulz

Fig. 3. Representative gene clusters of genes with higher transcription in presence of sprouts compared with M9-glucose medium. Genes with increased expression in presence of sprouts are presented as black arrows. Numbers inside arrows indicate the fold change between growth in M9-glucose medium and with sprouts as determined by RNA-seq. Genes having no significant difference in transcription level are indicated in white.

etal., 2000)] and heme lyase [ccmF, ccmH (Ren etal., 2000)] involved in heme uptake during synthesis of c-type cytochromes which are synthesized under anaerobic conditions (lobbi-Nivol etal., 1994). Other genes involved in

iron uptake such as iroC encoding an ABC transporter that exports the siderophore enterobactin (Crouch etal., 2008), febA (SENTW_ 2865) encoding an TonB-dependent outer membrane ferric enterobactin receptor

Table 2. Transcription ratios of target genes, chosen for confirmation of RNA-seq analysis during growth with vegetables and in M9-glucose medium obtained. Transcription of mRNA was determined by quantitative reverse transcription-PCR. Fold change was determined using software REST which calculates whether genes are significantly (P < 0.05) upregulated (Up) or downregulated (Down). Fold changes without Up or Down behind numbers show no significant differences in expression between vegetables and M9-glucose medium.

Target gene Sprouts 24 h Sprouts 48 h Sprouts 48 h RNA-seq Lamb's lettuce 24 h Spinach 24 h Lettuce 24 h

csgB 232.18 Up 873.47 Up 1520.48 Up 2750.99 Up 3154.95 Up 5289.82 Up

glnK 0.07 Down 0.54 0.38 Down 0.69 0.14 Down 1.62

glpT 3.30 Up 3.52 1.13 2.04 Up 16.24 Up 24.36 Up

hutH 1.64 6.02 Up 5.06 Up 9.15 Up 23.35 Up 11.40 Up

nuol 0.45 Down 2.06 1.09 1.97 Up 4.66 Up 15.50 Up

rcsA 0.80 3.84 Up 1.26 2.28 Up 1.87 Up 33.09 Up

sbp 41.62 30.27 16.12 Up 29.17 Up 0.59 118.95 Up

and fes (SENTW_0562) encoding a Fes esterase that degrades siderophores to obtain free iron were transcribed in both samples but were significantly more transcribed in M9-glucose medium indicating an iron limitation or a high iron demand (Crouch etal., 2008).

Several genes involved in nitrogen uptake were upregulated in M9-glucose medium such as glnK (SENTW_0448) and glnL (SENTW_4090), which is a two-component system linked to glutamine utilization (Satomura etal., 2005) as well as nirC (SENTW_4222) encoding a probable nitrite transporter, and nirB and nirD (SENTW_4223-4224) encoding a nitrite reductase.

Besides higher expression of genes regulating uptake of nutrients such as iron, nitrogen and others, also genes for carbohydrate metabolism, biosynthesis of amino acids were more transcribed in M9-glucose medium (Table S1). Within this group, the majority of the higher transcribed genes represent the histidine biosynthesis operon hisA-I (SENTW_2197-2203). Several genes encoding hydrogenases were also more transcribed in M9-glucose medium such as hypB-hypE and hybA-F encoding hydrogenases. The Hyb proteins represent one of the three H2-consuming hydrogenases in S. Typhimurium (Zbell etal., 2007) containing NiFe centres (Lamichhane-Khadka etal., 2010). Genes of the hyp gene cluster encode a hydrogenase (hypA-F; SENTW_3276-81) that is, under fermentative growth conditions, regulated by a promoter localized within the hypA (SENTW_2942) gene. Both genes, as well as other single genes (Table S1) were significantly more transcribed in M9-glucose medium, indicating a potential anaerobic growth (Lutz etal, 2006).

Influence of vegetable type on gene expression

Seven target genes (cgsB, hutH, glpT, rcsA, sbp, nuol and glnK), identified by RNA-seq analyses as being significantly differentially transcribed and representing different functional categories, were selected for confirmation and further analysis by qRT-PCR. These selected genes had a high fold change in RNA-seq and might there-

fore play a significant role during the interaction of S. Weltevreden with plant material. In general, genes more transcribed in presence of sprouts analysed by RNA-seq were also more transcribed in presence of sprouts as determined by qRT-PCR, but the differences to M9-glucose medium were not always significant (Table 2). Comparison of expression ratios of qRT-PCR and fold change of RNA-seq analysis between the two sprouts samples ('sprouts 48 h' vs. 'sprouts 48 h RNA-seq') taken after 48 h showed similar results with fold changes in the same order of magnitude (Table 2).

Besides confirmation of RNA-seq results, influence of vegetable type was determined. Gene expression with sprouts was compared with S. Weltevreden grown on leafy salads such as lamb's lettuce, spinach and salad. Here, cells were harvested after 24 h because of decay of plant material afterwards, which caused the sample to contain too much plant material. Gene expression on leafy vegetables showed a significant upregulation of all target genes with one exception. The sulphate binding protein encoded by sbp (SENTW_4153) was not significantly more transcribed during growth with spinach. Comparing gene expression of S. Weltevreden in presence of sprouts after 24 and 48 h showed similar fold changes in the same order of magnitude with the exception of hutH and rcsA, both being significantly more transcribed after 48 h but not after 24 h.

One target gene (glnK) was chosen for analysis by qRT-PCR as RNA-seq analysis revealed it was solely transcribed in M9-glucose medium. Nevertheless, this gene was transcribed at low levels in presence of sprouts. Analysis by qRT-PCR showed no significant higher expression on vegetables but less significant expression with sprouts and spinach.

Discussion

Interactions of human pathogens such as Salmonella spp. and E. coli O157:H7 with vegetables such as lettuce or alfalfa sprouts were analysed before. This study reports the complete transcriptome of a Salmonella spp.

grown with alfalfa sprouts by RNA-seq analysis. So far, one microarray study analysed the transcriptome of S. Typhimurium SL1344 grown on cilantro leaves which was co-inoculated with Dickeya dadantii, a plant macerating pathogen (Goudeau etal., 2012) that showed a shift towards anaerobic metabolism. In two other microarray studies, transcriptome analyses of E. coli O157:H7 on vegetables have been reported (Kyle etal., 2010; Fink etal., 2012). The first studied the response of E. coli O157:H7 to lettuce lysate, resulting in strong oxidative stress of the bacterium. In the second recently published study, gene expression of E. coliO157:H7 on lettuce leafs was determined representing the first transcriptomic analysis of this pathogen on intact cell material (Fink etal., 2012). Both studies show similarities to our work, but gene expression patterns varied. This is most probably due to different plant material and to the use of Salmonella spp. as a pathogen in this study.

The initial step for establishment on plant tissue is attachment of bacteria to plant tissue (Brandl, 2006). In former studies, it was shown that curli and long aggregative fimbriae, which also were found to mediate binding to epithelial cells, were transcribed during attachment of E. coli O157:H7 to salad and of Salmonella spp. to alfalfa sprouts (Barak etal., 2005; Fink etal., 2012). In our study, the csgDEFG operon and csgCAB (agfDEFG and agfCAB equivalent) were transcribed in both media with csgB, csgG and csgD being more transcribed in presence of sprouts. The csgDEFG operon encodes for accessory proteins which are necessary for curli assembly while csgD encodes a positive transcriptional regulator for the csgBA operon [major curli subunit (Barnhart and Chapman, 2006)]. It was shown that csgD plays an important role in attachment of S. Newport to alfalfa shoots (Barak etal., 2005). Deletion of csgB reduced binding to alfalfa shoots during the first 24 h, whereas deletion of csgA had no effect (Barak etal., 2005). It was assumed that curli formation plays an important role at the first stage of plant colonization, which was also found for E. coliO157:H7 grown on lettuce (Fink etal., 2012). In our study, fold change for csgB was high, although samples were taken after 48 h, which represents a long inoculation period. A possible explanation might be that attachment to alfalfa sprouts was only starting at a later point during cultivation as the sample was slightly shaken during complete inoculation period. The sample contained both planktonic and attached cells. It might well be that cells, which lived planktonic during the first hours, started to attach to alfalfa sprouts later. Therefore, the csg operon was more transcribed in presence of sprouts only after 48 h. Besides the csg operon, the genes encoding BcfE, a fimbrin-like protein, and RcsA, a regulator for capsular polysaccharides, were more transcribed in presence of sprouts. Additional fimbriae and capsule production may

indicate the importance of attachment of S. Weltevreden to sprouts after 48 h as both proteins enhance ability to attach to plant tissue (Hassan and Frank, 2004; Jeter and Matthysse, 2005).

Additionally, higher expression of the fe-encoded regulator was found in presence of sprouts. Fis regulates genes encoding the T3SS and its cognate effectors as well as synthesis of flagella for motility. Genes encoding flagella [fli and fig genes, (Barak etal., 2005; Jeter and Matthysse, 2005; Torres etal., 2005)] were not found to be more transcribed in presence of sprouts suggesting a more important role for Fis in regulation of the T3SS in our experiment. Indeed, genes of the T3SS encoded on SPI-2 were more transcribed in presence of sprouts, in contrast to growth in M9-glucose medium. Upregulation of several genes encoding proteins of the T3SS was found for E. coli O157:H7 grown in lysate of lettuce (Kyle etal., 2010) but not on lettuce leaves (Fink etal., 2012). SPI-2 plays the principal role during replication of intracellular bacteria within membrane-bound Salmonella-containing vacuoles (SCVs) in animal hosts (Cirillo etal., 1998). There are two possibilities for higher expression of genes encoding structural components of secretion machinery. First, they might be important for attachment to sprouts. Second, conditions in presence of sprouts might be similar to conditions as in SCVs inducing expression of SPI-2. As the sprout sample contained planktonic and attached cells, it remains unclear whether the cells induced these virulence genes as a stress response or for attachment on sprouts. Altogether, genes encoding only five of approximately 30 known effector proteins were found to be more transcribed in presence of sprouts. In the intestine of an infected host, the T3SS of SPI-1 is induced when cells come into contact with epithelial cells, seven effectors are translocated across host cell plasma membrane and membrane ruffling leads to invasion into the host (Galán, 2001; Patel and Galán, 2005). Several hours after uptake by host cells, an assembly of F-actin in close proximity to the SVC membrane and Salmonella-induced filaments (Sifs), which are induced by SPI-2 T3SS (Brumell etal., 2002), are released. At least 10 type III effectors are known to be associated with SCV encoded on SPI-2 (Heffron etal., 2011). As SPI-2 is only active after the bacteria reaches the intracellular vacuole, it might be more likely that the sprout environment mimics conditions found in the SCVs (Portillo etal., 1992; Rathman etal, 1996; 1997; Vescovi etal., 1996). The SCVs are characterized by an acidic pH and low nutrient concentrations such as Mg2+ (Cirillo etal., 1998; Beuzón etal., 1999; Lober etal., 2006): conditions that may also be found in the cultures with sprouts. Low expression of SPI-2 was also found for S. Typhimurium within a biofilm compared with planktonic cells because of environmental conditions (Hamilton etal., 2009). This might support the theory that

part of SPI-2 was induced in presence of sprouts because of the environmental conditions. Alternatively, it might trigger the plant immune system (Schikora etal., 2011). In a recent study comparing plant and animal infection mechanisms, it was suggested that Salmonella spp. use translocation of effectors to remodel the host cells physiology to enhance entry to plant cell walls similar to animal tissue (Schikora etal., 2011). However, mechanisms of effectors delivery and the role of both SPI-1 and SPI-2 during plant infection remain unknown.

Besides attachment of single bacteria cells to plant cells, pathogens were found to attach at certain locations of the plant surfaces such as leaf veins and glandular trichomes (Monier and Lindow, 2005) and might build biofilms. Biofilm formation is a surface-associated growth (Hamilton etal., 2009), which might occur during growth of S. Weltevreden with sprouts. Hamilton and colleagues (2009) found that tryptophan and the trp operon are necessary for biofilm formation. This was also found for E. coli O157:H7 in the early stage of biofilm formation (Domka etal., 2007). However, in presence of sprouts, genes encoding the trp operon were transcribed, but expression was not significantly higher than in M9-glucose medium. It was found that ssrA, a regulatory gene encoded on SPI-2, plays a role in biofilm formation. Although this gene was transcribed under both conditions, it was not transcribed significantly higher in presence of sprouts. However, whether the SPI-2 T3SS plays an important role in biofilm formation remains unknown (Hamilton etal., 2009).

To establish on plant surface, pathogens have to adapt to an unfavourable habitat that is characterized by aerobic conditions, osmotic pressure, water stress and irregular distribution of nutrients on leave surfaces (Monier and Lindow, 2005). In contrast to leafy vegetables, sprouts might not represent those conditions. In our study, we rather found that S. Weltevreden cells showed a more transcribed set of genes required for sulphur metabolism as a possible reaction on low sulphur concentrations. These genes are mainly required for sulphate transport into cells and following reduction to sulphide. As plants are generally poor in sulphate, it was not surprising that cys regulon was more expressed in presence of sprouts. This was also found for E. coli O157:H7 grown on lettuce as well as on lettuce lysate (Kyle etal., 2010; Fink etal., 2012). Although growth conditions with sprouts differ from conditions found on leaves and lysate, demand for sulphur is given under all three conditions. For E. coli O157:H7, it was also found that phosphate starvation regulators psiF and phoB were more transcribed as well (Fink etal., 2012). This was not found in our study, and it allows the conclusion that the surface and exudates of alfalfa sprouts might not be poor in phosphate.

It was found that S. enterica preferentially colonize alfalfa roots (Anonymous, 2005), root hairs (Chapman

etal., 1993) and in the mucilage close to the root tip (Veling etal., 2002). Root exudates consist mainly of mucilage (polysaccharides) and proteins (Evans etal., 1998). Several genes involved in carbohydrate metabolism were found to be more transcribed with only cspB and rfbK specific for mannose found on plants. We also found expression of three previously identified GIs specific for single Salmonella serovars encoding carbohydrate metabolism genes (Brankatschk etal., 2012). Here, it was shown that GI_IV was not transcribed in presence of sprouts and in M9-glucose medium whereas a low expression for GI_V was found and high expression for GI_VI (Brankatschk etal., 2012). It was assumed that GI_VI encoding a mannitol-specific PTS system might be specific for mannitol degradation. However, transcription of this GI is not significantly different between S. Weltevreden grown with sprouts and in M9-glucose medium. This GI might thus be specific to another carbon source other than mannitol. As an alternative carbon source to sugars, S. Weltevreden might use glycerol as well as fatty acids, as both systems were more transcribed in presence of sprouts. Another explanation might be that higher expression of genes for the glycerol uptake system and fatty acid metabolism is required for membrane generation.

Genes encoding stress response were found to be more transcribed in presence of sprouts. Highest expression has been found for single genes of the psp operon which usually is found during filamentous phage infection, mislocation of envelope proteins, extremes in temperature, osmolarity or ethanol concentrations and presence of proton ionophores (Darwin, 2005). Additionally, PspA might be an effector that plays a role in maintaining cytoplasmic membrane integrity (Darwin, 2005). As this operon is induced under several circumstances, it remains unclear why it is transcribed in presence of sprouts. It was also found to be transcribed on lettuce, and Fink and colleagues (2012) concluded that it was induced as a response to osmotic stress. Alternatively, it might play a role in biofilm formation as found for E. coli (Beloin etal., 2004) or that it is a response to surrounding environment as it was found to be transcribed during macrophage infection (Eriksson etal., 2003). A possible explanation might be osmotic stress because of the use of deionized water as inoculation matrix.

In our study, an additional gene ipbA, encoding a heat shock protein, and osmY, encoding a periplasmic protein, were more transcribed with sprouts, and both were found to be induced in E. coli during superoxide stress (Yim and Villarejo, 1992; Kitagawa etal., 2000). Injury of plant material is known to induce biochemical and signalling pathways in wound response such as production of an oxidative burst generating reactive oxygen. This might be a possible explanation for higher expression of ipbA.

However, as sprouts were not cut or disrupted, it might not be a result of plant defence mechanism rather than using deionized water as an inoculation matrix that might also have led to induction of the psp operon.

For evaluation of RNA-seq analysis, seven genes were chosen for analysis of their transcription by qRT-PCR on alfalfa sprouts and additional vegetables. Results between a new sprouts sample taken after 48 h and the frozen RNA-seq sample were very similar with differences in the significance of expression ratios. Comparing gene expression analysed by qRT-PCR during growth on leafy vegetables to sprouts, it was shown that with leafy vegetables, expression ratios were higher than with sprouts. This might be explained by the fact that samples from leafy vegetables had to be taken already after 24 h because of leaf decay at 48 h. In a microarray study, it was found that fold change significantly varied over time and that it is dependent on the gene analysed (Kyle etal., 2010). Comparison of gene expression in presence of sprouts harvested after 24 h to leafy vegetables showed general lower expression ratios.

Comparing gene expression of sprouts sample taken after 24 and 48 h shows a shift in gene expression, which was also found by Kyle and colleagues (2010) and Fink and colleagues (2012). Because of adaption to the environment over time, there is a shift in the expression pattern of various metabolic pathways. Comparison of genes more transcribed with leafy vegetables showed similar results for significance of expression ratios except on spinach for the gene sbp, encoding the sulphate binding protein. A possible explanation might be that surface of spinach contains more sulphate than other vegetables, and therefore, genes encoding sulphate uptake might be less transcribed as found on other plants.

Growth of S. Weltevreden in M9-glucose medium showed genes more transcribed involved in nutrient uptake. In contrast to M9-glucose medium, genes involved in structuring siderophores, which have the capacity to chelate iron from the environment (Schaible and Kaufmann, 2004) and genes involved in heme storage were less transcribed in presence of sprouts. Heme-containing proteins are ubiquitous in nature (Daltrop etal., 2002). That and less expression of nitrogen regulatory proteins indicates that sprouts are rich in nutrients such as nitrate as well as iron in contrast to M9-glucose medium. Besides nutrient acquisition, higher transcription of genes encoding the synthesis of cytochromes and several genes encoding hydrogenases during growth in M9-glucose medium indicated anaerobic growth conditions. In a recent study, where the transcriptome of S. Typhimurium grown on cilantro was analysed (Goudeau etal., 2012), anaerobic growth conditions were also found on the plant. In their study, the cilantro was co-inoculated with D. dadantii, a pathogen

macerating plant tissue, which could lead to more anaerobic conditions than on alfalfa sprouts as performed in this study.

With our study, we have shown that S. Weltevreden strain 2007-60-3289-1 adapts to the plant surface environment, which is characterized by extreme conditions but may be rich in root exudates including carbohydrates and proteins. For establishment, pathogens have to attach to plant tissue, which might be supported by generation of extracellular filaments known as curli. We confirmed expression of the csg operon encoding formation of curli known to be involved in the attachment on animal tissues. Here, S. Weltevreden strain 2007-60-3289-1 showed a similar colonization mechanism for the different plant tissues, as the csg operon was higher transcribed on both alfalfa sprouts and leafy vegetables. Higher transcription of five genes, encoding effector proteins and located on SPI-2, indicated that the sprout environment might be similar to conditions found in SCV during infection of animal tissue. Besides attachment mechanisms, S. Weltevreden strain 2007-60-3289-1 responded to sulphur stress with increased transcription of cys pathway for uptake of sulphur and following reduction. Less stress response-related genes compared with other studies were transcribed which might allow the conclusion that establishment on surface of sprouts is less characterized by stress factors regarding oxygen status, irregular distributed nutrients and osmotic stress, which is found in leafs. As we observed that S. Weltevreden strain 200760-3289-1 yielded larger cell pellets with sprouts than with fresh cut lettuce, it might be that sprouts represent a higher risk potential for infection by Salmonella spp. because of higher availability of nutrients than leafy and cut vegetables.

Materials and methods

Strains, growth medium and conditions

For total RNA extraction, S. Weltevreden strain 2007-603289-1 (Arthurson etal., 2010) was grown in liquid cultures of M9 minimal medium (Sambrook etal., 1989) with 10 mM glucose (M9-glucose medium) as sole carbon source and also with alfalfa (Medicago sativa L.) sprouts. In M9-glucose medium, cells were harvested during exponential growth (OD600 = 0.4) and diluted to ODe00nm of 0.1 (approximately 0.7 x 108cfuml-1) for extraction. For sprouts cultures, strain S. Weltevreden 2007-60-3289-1 was pre-grown over night, washed and diluted to 106 cfu ml-1 in sterile de-ionized water. Five-day-old alfalfa sprouts (1.5 g) were inoculated with 10 ml of this suspension. After 48 h at 21°C shaking at 40 r.p.m., culture liquid and sprouts were collected, vortexed and sonicated for 30 s. The sprouts were removed, culture liquid was cen-trifuged and the pellet was used for total RNA extractions.

The sample contains therefore attached and planktonic cells that were collected during exponential phase. The pellet was shock-frozen in liquid nitrogen to ensure the status quo of cells at harvesting time until RNA extraction.

For verification of RNA-seq experiment, spinach (Spinacia oleracea L.), lamb's lettuce (Valerianella locusta L.) and leaf lettuce (Latuca sativa L., iceberg), alfalfa sprouts and M9-glucose medium were inoculated essentially identical as described above. For the experiment, 3 g of intact leaves were inoculated. Samples of spinach, lamb's lettuce and leaf lettuce as well as sprouts were taken after 24 h, since leaves were decayed after 48 h. Sprout samples were taken as well after 48 h as an independent sample for comparison with the samples used for RNA-seq analysis.

Extraction of total RNA

Before total RNA extraction, pellets were treated with 100 |l of TE buffer containing 50 |ig ml-1 lysozyme to enhance yield of total RNA. Extraction of total RNA from pellet of cultures grown in liquid medium was done using the NucleoSpin RNA II (Macherey-Nagel, Dueren, Germany). Extraction of total RNA from sprout supernatant was done using the innuPREP Plant RNA kit (Analytik Jena, Jena, Germany). After extraction, remaining DNA was removed using DNAse I (Fermentas, Thermo Scientific, Waltham, MA, USA) following the manufactures instructions. Presence of residual DNA was assayed by PCR using 16S rRNA gene-specific primers 63F and 1389R (Marchesi etal., 1998).

cDNA libraries

Libraries for Illumina sequencing of cDNA were constructed by vertis Biotechnology AG, Freising, Germany (http://www.vertis-biotech.com/). For the sprouts sample, plant mRNA was separated first from bacterial RNA by removing the poly(A)-tail carrying RNA by oligo(dT) chro-matography. Remaining RNAs were treated with Terminator exonuclease (TEX) to enrich bacterial primary transcripts carrying 5'-triphosphate. The transcripts resistant to TEX were fragmented by ultrasound treatment (four pulses of 30 s at 4°C), and with a poly(A) polymerase, poly(A) tails were added to the 3' ends of the RNA fragments. The polyadenylated RNA fragments were further treated with RNA-5' polyphosphatase to remove 5'-triphosphate groups from the 5' fragments. After ligation of a RNA oligonucleotide to the 5' monophosphate of the RNA fragments, first-strand cDNA was synthesized using an oligo(dT)-linker primer and M-MLV H-reverse transcriptase. Finally, the cDNA was PCR-amplified using a high-fidelity DNA polymerase. Bacterial RNA was treated directly with TEX and the same procedure fol-

lowed as for sprout sample. The purified cDNA samples were sequenced on an Illumina HiSeq 2000 machine to obtain 100 bp single end reads. For S. Weltevreden 200760-3289-1 grown in M9-glucose medium, 19 802 807 reads were generated by Illumina sequencing of the enriched cDNA library. For S. Weltevreden grown on alfalfa sprouts, 16 505 775 reads were sequenced.

Mapping and statistical analysis

Reads were mapped against the draft genome sequence of S. Weltevreden 2007-60-3289-1 (Brankatschk etal., 2011) using Bowtie 2 (2.0.0-beta2) (Langmead etal., 2009). Generated SAM-files were transcribed into BAM-files using SAMtools (Li etal., 2009). For comparison of gene expression between S. Weltevreden grown with sprouts and in M9-glucose medium, BAM-files were compared using Cufflinks (1.2.0) (Trapnell etal., 2010). For each annotated gene, a value for FPKM (Fragments Per Kilobase of exon model per Million mapped fragments) was determined. For comparison of the two sample conditions, FPKM values for each gene were used to calculate a fold change. Significance of differently transcribed genes was after Benjamini-Hochberg correction of multiple testing. P-values lower than 0.05 were considered as significant.

For the sample M9-glucose, 8 758 337 reads (44.23%) could be aligned against the reference sequence of S. Weltevreden 2007-60-3289-1, whereas 11 044 470 reads (55.77%) failed to align. For the sample grown with sprouts, 6 352 340 reads (38.49%) aligned while 10 153 435 reads (61.51%) failed to align. In both cases, ineffective mRNA enrichment during depletion of riboso-mal RNA before cDNA synthesis, the use of the incomplete genome sequence of S. Weltevreden 2007-603289-1 (Brankatschk etal., 2011) and the filtration of reads mapping on rRNA gene regions has influenced the mapping efficiency. Additionally, for the sprout sample, the lower number of mapping reads might be caused by the presence of RNA from the plant or from other bacteria that remained in the sample despite surface disinfection of seeds.

Sequence analysis

The genome sequence of S. Weltevreden strain 2007-603289-1 consists of 66 contigs that were deposited in the EMBL database under accession numbers FR775188 through FR775253, and the plasmid pSW82 sequence was deposited under accession number FR775255 (Brankatschk etal., 2011). Additional BLAST searches were done at NCBI. Functions of genes of interest were classified according to the KEGG pathway database.

Table 3. Primers designed for analysis of transcription ratios for target genes of S. Weltevreden 2007-60-3289-1 used for qRT-PCR.

Primera Locus tag Sequence (5'^3') Product size (bp)

csgB_F SENTW_2110 TAATCAGGCGGCCATTATTGG 206

csgB_R TATTACCGTAAGCGCTTTGCG

hutH F SENTW_0770 TTGAGGGCACAGGAGTTATTTGC 194

hutH R ACAGTGGTGATGTGATTCAGC

glpT_F SENTW_2411 TTAACGACTGGAAAGCGGCG 178

glpT_R TTCGCAGTCAGCTCTTCTTCC

rcsA_F SENTW_1101 AACCTGACTCGCTGGATACC 149

rcsA_R AATCTGAATGGTTCCCTGACC

sbp_F SENTW_4153 TTACGATGTGGACGCTATTGC 175

sbp_R GTAATCACCGACACACCGGG

nuoI F SENTW_2443 TTACCGTGGTCGTATCGTGC 219

nuoI R AACTGAATCGCCGTGGTCGG

glnK F SENTW_0448 GGGAGGCGCTTTCTTCCATT 172

glnK_R ATCACCTCTTCCAGTTGGTCG

rpoD_F* SENTW_3348 ACATGGGTATTCAGGTAATGGAAGA 61

rpoD_R* CGGTGCTGGTGGTATTTTCA

gmk F* SENTW_3842 TTGGCAGGGAGGCGTTT 62

gmk R* GCGCGAAGTGCCGTAGTAAT

a. Primers which were developed by (Botteldoorn etal., 2006) are indicated with an asterisk.

RT-PCR and real-time quantification

Seven genes that were significantly differential transcribed (P< 0.05) between the two samples were selected for qRT-PCR to validate RNA-seq data and to test transcription on other vegetables. Primers were designed using S. Weltevreden 2007-60-3289-1 as a reference sequence (Table 3) with an amplicon size between 150 and 200 bp for each gene. Total RNA was extracted as described above.

For RT-PCR, the RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas, Thermo Scientific, Waltham, MA, USA) and random hexamer reverse primers were used following the manufactures instructions. Amplification of gene transcript was performed on the ABI Prism 7500 Sequence detection system (Applied Biosystems Europe BV, Zug, Switzerland). All reactions were performed with the Kapa SYBR Fast qPCR Universal Kit (Kapa Biosystems, Cape Town, South Africa). For data normalization, two housekeeping genes rpoD and gmk (Botteldoorn etal., 2006) were used as an internal reference to obtain more reliable basis of normalization (Pfaffl etal., 2002). All experiments were done in three independent replicates and additionally three replications within each qRT-PCR run. Fold change between vegetable sample and M9-glucose medium was calculated using relative expression software REST (Pfaffl etal., 2002).

Acknowledgements

We thank Fabio Rezzonico for critically reading this manuscript before publication. The strain S. Weltevreden 200760-3289-1 was kindly provided by A. Nygaard Jensen (DTU-FOOD, Copenhagen, Denmark).

Conflict of interest

None declared.

References

Anonymous (2005) Update - Outbreak of Salmonella Newport infection in England, Scotland and Northern Ireland: association with the consumption of lettuce. CDR Weekly 15. [WWW document]. URL http://www.hpa.org.uk/ cdr/archives/2004/cdr4104.pdf.

Arthurson, V., Sessitsch, A., and Jäderlund, L. (2010) Persistence and spread of Salmonella enterica serovar Weltevreden in soil and on spinach plants. FEMS Microbiol Lett 314: 67-74.

Bachmann, B.J., and Low, K.B. (1980) Linkage map of Escherichia coli K-12, edition 6. Microbiol Rev 44: 1-56.

Bangtrakulnonth, A., Pornreongwong, S., Pulsrikarn, C., Sawanpanyalert, P., Hendriksen, R.S., Lo Fo Wong, D.M.A., and Aarestrup, F.M. (2004) Salmonella serovars from humans and other sources in Thailand, 1993-2002. Emerg Infect Dis 10: 131-136.

Barak, J.D., Whitehand, L.C., and Charkowski, A.O. (2002) Differences in attachment of Salmonella enterica serovars and Escherichia coli O157:H7 to alfalfa sprouts. Appl Environ Microbiol 68: 4758-4763.

Barak, J.D., Gorski, L., Naraghi-Arani, P., and Charkowski, A.O. (2005) Salmonella enterica virulence genes are required for bacterial attachment to plant tissue. Appl Environ Microbiol 71: 5685-5691.

Barnhart, M.M., and Chapman, M.R. (2006) Curli biogenesis and function. Annu Rev Microbiol 60: 131-147.

Begley, T.P., Downs, D.M., Ealick, S.E., McLafferty, F.W., Van Loon, A.P.G.M., Taylor, S., etal. (1999) Thiamin biosynthesis in prokaryotes. Arch Microbiol 171: 293-300.

Beloin, C., Valle, J., Latour-Lambert, P., Faure, P., Krzreminski, M., Balestrino, D., etal. (2004) Global impact of mature biofilm lifestyle on Escherichia coli K-12 gene experssion. Mol Microbiol 51: 659-674.

Berger, C.N., Sodha, S.V., Shaw, R.K., Griffin, P.M., Pink, D., Hand, P., and Frankel, G. (2010) Fresh fruit and vegetables as vehicles for the transmission of human pathogens. Environ Microbiol 12: 2385-2397.

Beuzon, C.R., Banks, G., Deiwick, J., Hensel, M., and Holden, D.W. (1999) pH-dependent secretion of SseB, a product of the SPI-2 type III secretion system of Salmonella typhimurium. Mol Microbiol 33: 806-816.

Botteldoorn, N., Van Coillie, E., Grijspeerdt, K., Werbrouck, H., Haesebrouck, F., Donné, E., etal. (2006) Real-time reverse transcription PCR for the quantification of the mntH expression of Salmonella enterica as a function of growth phase and phagosome-like conditions. J Microbiol Methods 66: 125-135.

Brandl, M.T. (2006) Fitness of human enteric pathogens on plants and implications for food safety. Annu Rev Phytopathol 44: 367-392.

Brankatschk, K., Blom, J., Goesmann, A., Smits, T.H.M., and Duffy, B. (2011) The genome of a European fresh vegetable food safety outbreak strain Salmonella enterica subsp. enterica serovar Weltevreden. J Bacteriol 193: 2066.

Brankatschk, K., Blom, J., Goesmann, A., Smits, T.H.M., and Duffy, B. (2012) Comparative genomic analysis of Salmonella enterica subsp. enterica serovar Weltevreden foodborne strains with other serovars. Int J Food Microbiol 155: 247-256.

Brumell, J.H., Goosney, D.L., and Finlay, B.B. (2002) SifA, a type III secreted effector of Salmonella typhimurium, directs Salmonella-induced filament (Sif) formation along microtubules. Traffic 6: 407-415.

Chapman, P.A., Siddons, C.A., Wright, D.J., Norman, P., Fox, J., and Crick, E. (1993) Cattle as a possible source of verotoxin-producing Escherichia coli O157 infection in a man. Epidemiol Infect 111: 439-448.

Chiu, C.H., Tang, P., Chu, C., Hu, S., Bao, Q., Yu, J., etal. (2005) The genome sequence of Salmonella enterica serovar Choleraesuis, a highly invasive and resistant zoonotic pathogen. Nucleic Acids Res 33: 1690-1698.

Cirillo, D.M., Valdivia, R.H., Monack, D.M., and Falkow, S. (1998) Macrophage-dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Mol Microbiol 30: 175-188.

Cleary, P., Browning, L., Coia, J., Cowden, J., Fox, A., Kearney, J., etal. (2010) A foodborne outbreak of Salmonella Bareilly in the United Kingdom, 2010. Euro Surveill 15: 19732.

Coombes, B.K., Lowden, M.J., Bishop, J.L., Wickham, M.E., Brown, N.F., Duong, N., etal. (2006) SseL is a Salmonella-specific translocated effector integrated into the SsrB-controlled Salmonella pathogenicity island 2 type III secretion system. Infect Immun 75: 574-580.

Crouch, M.-L.V., Castor, M., Karlinsey, J.E., Kalhorn, T., and Fang, F.C. (2008) Biosynthesis and IroC-dependent export of the siderophore salmochelin are essential for virulence of Salmonella enterica serovar Typhimurium. Mol Microbiol 67: 971-983.

Daltrop, O., Stevens, J.M., Higham, C.W., and Ferguson, S.J. (2002) The CcmE protein of the c-type cytochrome biogenesis system: unusual in vitro heme ioncorporation into apo-CcmE and transfer from holo-CcmE to apocytochrome. Proc Natl Acad Sci USA 99: 9703-9708.

Darwin, A.J. (2005) The phage-shock-protein response. Mol Microbiol 57: 621-628.

Domka, J., Lee, J., Bansal, T., and Wood, T.K. (2007) Temporal gene expression in Escherichia coli K-12 biofilms. Environ Microbiol 9: 332-346.

Dworkin, J., Jovanovic, G., and Model, P. (2000) The PspA protein of Escherichia coli is a negative regulator of o54-dependent transcription. J Bacteriol 182: 311-319.

Emberland, K.E., Ethelberg, S., Kuusi, M., Vold, L., Jensvoll, L., Lindstedt, B.-A., etal. (2007) Outbreak of Salmonella Weltevreden infections in Norway, Denmark and Finland associated with alfalfa sprouts, July-October 2007. Euro Surveill 12: 389-390.

Eriksson, S., Lucchini, S., Thompson, A., Rhen, M., and Hinton, J.C. (2003) Unravelling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol Microbiol 47: 103-118.

Evans, H.S., Madden, P., Douglas, C., Adak, G.K., O'Brien, S.J., Djuretic, T., etal. (1998) General outbreaks of infectious intestinal disease in England and Wales: 1995 and 1996. Commun Dis Public Health 1: 165-171.

Fink, R.C., Black, E.P., Hou, Z., Sugawara, M., Sadowsky, M.J., and Diez-Gonzalez, F. (2012) Transcriptional responses of Escherichia coli K-12 and O157H7 associated with lettuce leaves. Appl Environ Microbiol 78: 17521764.

Galán, J.E. (2001) Salmonella interactions with host cells: type III secretion at work. Annu Rev Cell Dev Biol 17: 53-86.

Goudeau, D.M., Parker, C.T., Zhou, Y., Sela, S., Kroupitski, Y., and Brandl, M.T. (2012) The Salmonella transcriptome in lettuce and cilantro soft rot reveals a niche overlap with the animal host intestine. Appl Environ Microbiol 79: 250262.

Gutnick, D., Calvo, J.M., Klopotowski, T., and Ames, B.N. (1969) Compounds which serve as the sole source of carbon or nitrogen for Salmonella typhimurium LT-2. J Bacteriol 100: 215-219.

Hamilton, S., Bongaerts, R.J.M., Mulholland, F., Cochrane, B., Porter, J., Lucchini, S., etal. (2009) The transcriptional programme of Salmonella enterica serovar Typhimurium reveals a key role for tryptophan metabolism in biofilms. BMC Genomics 10: 599-620.

Hassan, A.N., and Frank, J.F. (2004) Attachment of Escherichia coli O157:H7 grown in tryptic soy broth and nutrient broth to apple and lettuce surfaces as related to cell hydrophobicity, surface charge, and capsule production. Int J Food Microbiol 96: 103-109.

Heffron, F., Niemann, G., Yoon, H., Kidwai, A., Brown, R.N.E., McDermott, J.D., etal. (2011) Salmonella-secreted virulence factors. In Salmonella; From Genome to Function. Porwollik, S. (ed.). Norfolk UK: Caister Academic Press, pp. 187-223.

Iobbi-Nivol, C., Crooke, H., Griffiths, L., Grove, J., Hussain, H., Pommier, J., etal. (1994) A reassessment of the range of c type cytochromes synthesized by Escherichia coli K-12. FEMS Microbiol Lett 119: 89-94.

Iuchi, S., Cole, S.T., and Lin, E.C. (1990) Multiple regulatory elements for the glpA operon encoding anaerobic glycerol-3-phosphate dehydrogenase and the glpD operon encoding aerobic glycerol-3-phosphate dehydrogenase in

Escherichia coli: further characterization of respiratory control. J Bacteriol 172: 172-184.

Jennings, M.E., Quick, L.N., Soni, A., Davis, R.R., Crosby, K., Ott, C.M., etal. (2011) Characterization of the Salmonella enterica serovar Typhimurium ydcI gene, which encodes a conserved DNA binding protein required for full acid stress resistance. J Bacteriol 193: 2208-2217.

Jeter, C., and Matthysse, A.G. (2005) Characterization of the binding of diarrheagenic strains of E. coli to plant surfaces and the role of curli in the interaction of the bacteria with alfalfa sprouts. Mol Plant Microbe Interact 18: 1235-1242.

Kelly, A., Goldberg, M.D., Carroll, R.K., Danino, V., Hinton, J.C.D., and Dorman, C.J. (2004) A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella enterica serovar Typhimurium. Microbiology 150: 2037-2053.

Kitagawa, M., Matsumaru, Y., and Tsuchido, T. (2000) Small heat shock proteins, IbpAand IbpB, are involved in resistances to heat and superoxide stresses in Escherichia coli. FEMS Microbiol Lett 184: 165-171.

Knodler, L.A., Celli, J., Hardt, W.-D., Vallance, B.A., Yip, C., and Finlay, B.B. (2002) Salmonella effectors within a single pathogenicity island are differentially expressed and translocated by separate type III secretion systems. Mol Microbiol 43: 1089-1103.

Kobayashi, R., Suzuki, T., and Yoshida, M. (2007) Escherichia coli phage shock protein A (PspA) binds to membrane phospholipids and repairs proton leakage of the damaged membranes. Mol Microbiol 66: 100-109.

Kyle, J.L., Parker, C.T., Goudeau, D., and Brandl, M.T. (2010) Transcriptome analysis of Escherichia coli O157:H7 exposed to lysates of lettuce leaves. Appl Environ Microbiol 76: 1375-1387.

Lamichhane-Khadka, R., Kwaitkowski, A., and Maier, R.J. (2010) The Hyb hydrogenase permits hydrogen-dependent respiratory growth of Salmonella enterica serovar Typhimurium. mBio 1: e00284-10.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10: R25.

Learn-Han, L., Yoke-Kqueen, C., Salleh, N.A., Sukardi, S., Jiun-Horng, S., Chai-Hoon, K., and Radu, S. (2008) Analysis of Salmonella Agona and Salmonella Weltevreden in Malaysia by PCR fingerprinting and antibiotic resistance profiling. Antonie Van Leeuwenhoek 94: 377-387.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., etal. (2009) The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics 25: 20782079.

Loferer, H., Hammar, M., and Normark, S. (1997) Availability of the fibre subunit CsgA and the nucleator protein CsgB during assembly of fibronectin-binding curli is limited by the intracellular concentration of the novel lipoprotein CsgG. Mol Microbiol 26: 11-23.

Löber, S., Jäckel, D., Kaiser, N., and Hensel, M. (2006) Regulation of Salmonella pathogenicity island 2 genes by independent environmental signals. Int J Med Microbiol 296: 435-447.

Lutz, S., Jacobi, A., Schlensog, V., Böhm, R., Sawers, G., and Böck, A. (2006) Molecular characterization of an

operon (hyp) necessary for the activity of the three hydrogenase isoenzymes in Escherichia coli. Mol Microbiol 5: 123-135.

Marchesi, J.R., Sato, T., Weightman, A.J., Martin, T.A., Fry, J.C., Hiom, S.J., etal. (1998) Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA. Appl Environ Microbiol 64: 2333.

Monier, J.M., and Lindow, S.E. (2005) Aggregates of resident bacteria facilitate survival of immigrant bacteria on leaf surfaces. Microb Ecol 49: 343-352.

Nuccio, S.P., and Baumler, A.J. (2007) Evolution of the chaperone/usher assembly pathway: fimbrial classification goes Greek. Microbiol Mol Biol Rev 71: 551-575.

Passalacqua, K.D., Varadarajan, A., Ondov, B.D., Okou, D.T., Zwick, M.E., and Bergman, N.H. (2009) Structure and complexity of a bacterial transcriptome. J Bacteriol 191: 32033211.

Patel, J.C., and Galán, J. (2005) Manipulation of the host actin cytoskeleton by Salmonella-all in the name of entry. Curr Opin Biotechnol 8: 10-15.

Pfaffl, M.W., Horgan, G.W., and Dempfle, L. (2002) Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30: e36.

Portillo, G., Foster, J.W., Maguire, M.E., and Finlay, B.B. (1992) Characterization of the micro-environment of Salmonella typhimurium-containing vacuoles within MDCK epithelial cells. Mol Microbiol 6: 3289-3297.

Prigent-Combaret, C., Brombacher, E., Vidal, O., Ambert, A., Lejeune, P., Landini, P., and Dorel, C. (2001) Complex regulatory network initial adhesion and biofilm formation in Escherichia coli via regualtion of the csgD gene. J Bacteriol 183: 7213-7223.

Raabe, C.A., Hoe, C.H., Randau, G., Brosius, J., Tang, T.H., and Rozhdestvensky, T.S. (2011) The rock and shallows of deep RNA sequencing: examples in the Vibrio cholerae RNome. RNA 17: 1357-1366.

Ramos, J.L., Martínez-Bueno, M., Molina-Heranes, A.J., Terán, W., Watanabe, K., Zhang, X., etal. (2005) TheTetR family of transcriptional repressors. Microbiol Mol Biol Rev 69: 326-356.

Rathman, M., Sjaastad, M.D., and Falkow, S. (1996) Acidification of phagosomes containing Salmonella typhimurium in murine macrophages. Infect Immun 64: 2765-2773.

Rathman, M., Barker, L.P., and Falkow, S. (1997) The unique trafficking pattern of Salmonella typhimurium-containing phagosomes in murine acrophages is independent of the mechanism of bacterial entry. Infect Immun 65:1475-1485.

Ren, Q., Ahuja, U., and Thony-Meyer, L. (2000) A bacterial cytochrome c heme lyase CcmF forms a complex with the heme chaperone CcmE and CcmH but not with apocytochrome c. J Biol Chem 277: 7657-7663.

Romling, U., Bian, Z., Hammar, M., Sierralta, W.D., and Normark, S. (1998) Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J Bacteriol 180: 722-731.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press.

Satomura, T., Shimura, D., Asai, K., Sadaie, Y., Hirooka, K., and Fujita, Y. (2005) Enhancement of glutamine utilization in Bacillus subtilis through the GlnK-GlnL two-component regulatory system. J Bacteriol 187: 4813-4821.

Schaible, U.E., and Kaufmann, S.H.E. (2004) Iron and microbial infection. Nat Rev Microbiol 2: 946-953.

Schikora, A., Virlogeux-Payant, I., Bueso, E., Garcia, A.V., Nilau, T., Charrier, A., etal. (2011) Conservation of Salmonella infection mechanisms in plants and animals. PLoS ONE 6: e24112.

Schulz, H., Hennecke, H., and Thöny-Meyer, L. (1998) Prototype of a heme chaperone essential for cytochrome c maturation. Science 281: 1197-1200.

Schulz, H., Pellicioli, E.C., and Thöny-Meyer, L. (2000) New insights into the role of CcmC, CcmD and CcmE in the haem delivery pathway during cytochrome c maturation by a complete mutational analysis of the conserved tryptophan-rich motif of CcmC. Mol Microbiol 37: 13791388.

Sekowska, A., Kung, H.F., and Danchin, A. (2000) Sulfur metabolism in Escherichia coli and related bacteria: facts and fiction. J Mol Microbiol Biotechnol 2: 145-177.

Sivapalasingam, S., Friedman, C.R., Cohen, L., and Tauxe, R.V. (2004) Fresh produce: a growing cause of outbreaks of foodborne illness in the United States, 1973 through 1997. J Food Prot 67: 2342-2353.

Sledjeski, D., and Gottesman, S. (1995) A small RNA acts as an antisilencer of the H-NS-silences rcsA gene of Escherichia coli. Proc Natl Acad Sci USA 92: 2003-2007.

Sood, L., and Basu, S. (1979) Bacteriophage typing of Salmonella Weltevreden. Ant Leeuwenhoek 45: 595-604.

Studer, P., Heller, W.E., Hummerjohann, J., and Drissner, D. (2013) Evaluation of aerated steam treatment of alfalfa and mung bean seeds to eli and Salmonella induced filaments minate high levels of Escherichia coliO157:H7, O178:H12, Salmonella enterica, and Listeria monocytogenes. Appl Environ Microbiol 79: 4613-4619.

Taormina, P.J., Beuchat, L.R., and Slutsker, L. (1999) Infections associated with eating seed sprouts: an international concern. Emerg Infect Dis 5: 626-634.

Torres, A.G., Jeter, C., Langley, W., and Matthysse, A.G. (2005) Differential binding of Escherichia coli O157:H7 to

alfalfa, human epithelial cells, and plastic is mediated by a variety of surface structures. Appl Environ Microbiol 71: 8008-8015.

Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., etal. (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28: 511-515.

Valenski, M.L., Harris, S.L., Spears, P.A., Horton, J.R., and Orndorff, P.E. (2003) The product of the fimI gene is necessary fo Escherichia coli type 1 pilus biosynthesis. J Bacteriol 185: 5007-5011.

Veling, J., Wilpshaar, H., Frankena, K., Bartels, C., and Barkema, H.W. (2002) Risk factors for clinical Salmonella enterica subsp. enterica serovar Typhimurium infection on Dutch diary farms. Prev Vet Med 54: 157-168.

Vescovi, G., Soncini, F.C., and Groisman, E.A. (1996) Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell 84: 165-174.

Wang, Z., Gerstein, M., and Snyder, M. (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10: 57-63.

Wilhelm, B.T., Marguerat, S., Watt, S., Schubert, F., Wood, V., Goodhead, I., etal. (2008) Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution. Nature 453: 1239-1243.

Yim, H.H., and Villarejo, M. (1992) osmY, a new hyperosmotically inducible gene, encodes a periplasmic protein in Escherichia coli. J Bacteriol 174: 3637-3644.

Zbell, A.L., Maier, S.E., and Maier, R.J. (2007) Salmonella enterica serovar Typhimurium NiFe uptake-type hydro-genases are differentially expressed in vivo. Infect Immun 76: 4445-4454.

Supporting information

Additional Supporting Information may be found in the online version of this article at the publisher's web-site:

Table S1. Genes higher transcribed in M9-glucose medium in comparison to sprouts determined by RNA-seq analysis.