Scholarly article on topic 'Biocontrol and plant growth-promoting activity of rhizobacteria from Chinese fields with contaminated soils'

Biocontrol and plant growth-promoting activity of rhizobacteria from Chinese fields with contaminated soils Academic research paper on "Biological sciences"

0
0
Share paper
Academic journal
Microbial Biotechnology
OECD Field of science
Keywords
{""}

Academic research paper on topic "Biocontrol and plant growth-promoting activity of rhizobacteria from Chinese fields with contaminated soils"

Biocontrol and plant growth-promoting activity of rhizobacteria from Chinese fields with contaminated soils

Xuefei Wang,1,2 Dmitri V. Mavrodi,3 Linfeng Ke,1 Olga V. Mavrodi,2 Mingming Yang,2 Linda S. Thomashow,4 Na Zheng,1 David M. Weller4** and Jibin Zhang1*

1 State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, Hubei 430070, China. 2Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430, USA. 3Department of Biological Sciences, The University of Southern Mississippi, Hattiesburg, MS 39406, USA. 4Agricultural Research Service, Root Disease and Biological Control Research Unit, United States Department of Agriculture, Pullman, WA 99164-6430, USA.

Summary

The aim of this study was to inventory the types of plant growth-promoting rhizobacteria (PGPR) present in the rhizosphere of plants grown in soils contaminated with heavy metals, recalcitrant organ-ics, petroleum sewage or salinity in China. We screened 1223 isolates for antifungal activity and about 24% inhibited Rhizoctonia solani or Sclerotinia sclerotiorum. Twenty-four strains inhibitory to R. solani, Gaeumannomyces graminis var. tritici and/or S. sclerotiorum and representing the dominant morphotypes were assayed for PGPR activity. Seven strains contained phlD, prnD, pltC or phzFgenes and produced the antibiotics 2,4-diacetylphloroglucinol, pyrrolnitrin, pyoluteorin and phenazines respectively. Six strains contained acdS, which encodes 1-aminocyclopropane-1-carboxylic acid deaminase. Phylogenetic analysis of 16S rDNA and phlD, phzF and acdS genes demonstrated that some strains

Received 20 March, 2014; revised 19 July, 2014; accepted 24 July, 2014. For correspondence. *E-mail zhangjb05@163.com; Tel. (+86) 27 872 87701 8206; Fax: (+86) 27 872 87254. **E-mail david.weller@ars.usda.gov; Tel: (+1)509 335 6210; Fax: (+1)509 335 7674. doi:10.1111/1751-7915.12158

Funding Information This work was supported by the National Basic Research Program of China (973 Program, 2013CB127504) and an International Cooperation Project, the Fundamental Research Funds for the Central Universities, China (Grant No. 2011PY122) (20112012).

identified as Pseudomonas were similar to model PGPR strains Pseudomonas protegens Pf-5, Pseudomonas chlororaphis subsp. aureofaciens 30-84 and P. brassicacearum Q8r1-96. Pseudomonas protegens- and P. chlororaphis-like strains had the greatest biocontrol activity against Rhizoctonia root rot and take-all of wheat. Pseudomonas protegens and P. brassicacearum-like strains showed the greatest promotion of canola growth. Our results indicate that strains from contaminated soils are similar to well-described PGPR found in agricultural soils worldwide.

Introduction

Soil salinization and contamination by organic compounds (i.e. petroleum products and solvents) and heavy metals (i.e. Cd, Cr, Cu, Hg, Pb) are important environmental problems worldwide and have negative impacts on both human health and agricultural productivity (Jing etal., 2007). Soil pollution is of particular concern in developing countries where rapid industrialization has led to contamination of agricultural lands, especially in small farms that are sources of food for consumption by local populations. In a survey of contamination levels of heavy metals in agricultural soils in China, metal concentrations of Cd were significantly higher than in non-contaminated soils (Wei and Yang, 2010). Similarly, because of the accumulation of mine tailing outfalls, the content of Cu in the wetlands of Daye County, Hubei province, was 18 times higherthan the background value (Guo etal., 2011). The build-up of pollutants in soils and their subsequent leaching into the ecosystem has cascading effects, adversely impacting plant growth and yield (Cheng, 2003b; Huang etal., 2005; Parida and Das, 2005). The uptake of soil pollutants by crop plants and the resultant entry of carcinogens, endocrine disruptors and neurotoxins into the food chain are major concerns for human and animal health (Cheng, 2003a; Cai etal., 2009). In addition, soil pollutants can positively or negatively influence crop susceptibility to pathogens and insects (Elmer, 2002; Poschenrieder etal., 2006). For example, salinity can predispose plants to infection by soilborne pathogens or increase the incidence and severity of disease (Triky-Dotan etal., 2005; Roubtsova and Bostock, 2009).

© 2014 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and

reproduction in any medium, provided the original work is properly cited.

In contrast, exposure of wheat to a mild dose of cadmium induced resistance against Fusarium infection (Mittra et al., 2004).

Rhizobacteria are able to colonize and persist on roots and some, known as plant growth-promoting rhizobacteria (PGPR), are able to promote plant growth (Weller, 2007). PGPR improve plant growth directly by supplying nutrients (e.g. phosphorous, nitrogen), producing phytohormones [e.g. indoleacetic acid (IAA)], and/or decreasing the level of ethylene that is produced when the plant is stressed (Li etal., 2007; Lugtenberg and Kamilova, 2009). PGPR also antagonize plant pathogens and/or induce systemic resistance in the plant to disease (Weller etal., 2007; Lugtenberg and Kamilova, 2009). Because plants lack effector-triggered immunity to many soilborne pathogens, they rely on PGPR for defence against pathogen attack (Weller etal., 2007).

Soil pollution, especially by heavy metals, can also decrease the metabolic activity, biomass and diversity of microorganisms in the bulk soil and the rhizosphere (Sandaa etal., 1999; Gremion etal., 2004; Jing etal., 2007) and limit the effectiveness of PGPR to protect roots against disease. However, PGPR with metal resistance and the ability to mitigate the toxic effects of soil pollutants are present in polluted soils (Huang etal., 2005; Reed and Glick, 2005; Jing etal., 2007). For example, Pseudomonas asplenii AC isolated from polycyclic aromatic hydrocarbon-contaminated soils significantly increased the root and shoot growth of canola in copper and creosote-contaminated soils (Reed and Glick, 2005). Salt-tolerant Pseudomonas chlororaphis TSAU13, isolated from the rhizosphere of wheat grown in a salinated soil (Egamberdieva and Kucharova, 2009), improved the shoot and root growth of common bean grown in soil amended with NaCl and protected cucumber and tomato against Fusarium solani (Egamberdieva, 2011).

Despite progress in understanding the crucial role of PGPR in helping plants adapt to environmental stress, major gaps remain in our knowledge of how soil pollution affects the population levels, diversity and activity of PGPR. Our study is part of an ongoing cooperative project in China and the United States with the goal of identifying new PGPR and characterizing their role in the promotion of soil and plant health. Our study focused on rhizobacteria isolated from Chinese soils polluted with heavy metals, recalcitrant organic compounds, petroleum sewage or excessive salinization. We have hypothesized that certain groups of PGPR and strains harbouring bio-control and growth-promoting genes are cosmopolitan and conserved in soil microbiomes in agroecosystems worldwide regardless of the condition of the soil, and that plants enrich and support those PGPR best adapted to help them grow and resist diseases and other pests. Nothing is known about the composition of PGPR in soils

from these polluted sites, thus making them ideal to test our hypothesis.

Our specific objectives were to: (i) isolate and identify PGPR, (ii) determine their biocontrol activity against takeall disease and Rhizoctonia root rot on wheat, (iii) determine their growth-promoting activity on rapeseed/canola, and (iv) characterize their growth-promoting traits and genes. Wheat and rapeseed/canola were selected for our study because China is the world's largest producer of both of these crops and they are often grown in rotation. Rhizoctonia root rot caused by Rhizoctonia solani AG-8 and take-all caused by Gaeumannomyces graminis var. tritici are two important soilborne diseases worldwide, against which wheat has no resistance (Cook etal., 2002; Paulitz etal., 2002; Yang etal., 2011); however, biocontrol with PGPR is a viable approach to controlling them. Poor emergence is a chronic problem in rapeseed/canola production in both China and the United States and application of PGPR as seed treatments can greatly enhance shoot and root growth.

Here we report that strains of well-described PGPR species were among the common morphotypes from the rhizosphere of wheat and rapeseed grown in highly polluted soils in China. Strains of Lysobacter capsici, P. chlororaphis, Pseudomonas protegens and those related to P. brassicacearum had some of the greatest biocontrol and/or growth promoting activity. PGPR genes in these morphotypes included phlD, phzF, prnD, pltC and acdS, and traits included the ability to produce 2,4-diacetylphloroglucinol (2,4-DAPG), phena-zines, pyrrolnitrin, pyoluteorin, cellulase, siderophores, protease and IAA.

Results

Population densities and antagonistic activity of rhizobacteria from contaminated soils

The population sizes of total culturable aerobic, heterotrophic bacteria in the rhizosphere of wheat after three growth cycles in the greenhouse in the contaminated soils from five fields located in Hubei, Jiangxi and Jiangsu provinces of China ranged from 4.2 x 106 to 3.4 x 108 colony-forming units (cfu) g-1 fresh weight of root (Table 1). Populations recovered from rapeseed grown in the same soils ranged from 3.6 x 105 to 1.3 x 106 cfu g-1 fresh weight of root (Table 1). From the wheat and rapeseed rhizospheres, 1223 bacterial isolates (605 from wheat and 618 from rapeseed) were randomly selected from dilution plates of V3 x King's medium B (KMB) and V10 x tryptic soy agar (TSA). The percentage of isolates from wheat inhibitory to R. solani and from rape-seed inhibitory to Sclerotinia sclerotiorum varied among soils but averaged 24% and 23% respectively (Table 1). Isolates from the field contaminated with recalcitrant

Table 1. Population densities of total culturable aerobic, heterotrophic bacteria in the rhizosphere of wheat and rapeseed and ability of the bacteria to inhibit soilborne pathogens in vitro.

Wheat rhizosphere

Location®

Soil contaminant

cfu g-1 fresh weight root

Canola rhizosphere

Inhibitory to Rhizoctonia AG-8 (%)

cfu g-1 fresh weight root

Inhibitory to

Sclerotinia sclerotiorum (%)

Daye County Hukou County

Jinmen City

Qidong City (Dongyuan) Qidong City (Yinyang)

Heavy metals Recalcitrant organic

compounds Petroleum products Salt Salt

5.48 ± 2.85 x 107 4.18 ± 3.0 x 106

5.54 ± 2.3 x 107 2.69 ± 1.4 x 108 3.39 ± 3.37 x 108

27.2 6.7

28.0 19.6 37.2

1.34 ± 0.44 x 106 4.02 ± 1.41 x 105

8.4 ± 0.35 x 105 7.06 ± 0.13 x 105 3.56 ± 0.66 x 105

36.2 27.5 21.8

a. Soil samples were collected in Daye County and Jinmen City in Hubei province, Hukou county in Jiangxi province, and Qidong City near Dongyuan and Yinyang in Jiangsu province; GPS coordinates of these sites are 30°10'N, 114°56'E; 29°46'N, 116°15'E; 31°01'N, 112°13'E; 31°58'N, 121°46'E; and31°44'N, 121°54'E respectively.

Crop and native plants and weeds were dug from the contaminated soil at each site, soil attached to the roots was removed, transported to Wuhan, and wheat or rapeseed was grown in the soil for three cycles. Population densities of total culturable, aerobic rhizosphere bacteria were determined by the end-point dilution assay and single colonies of bacteria were selected from plates of 1/3 x KMB or V™ x TSA at the end of the third growth cycle of wheat or rapeseed.

organic compounds in Hukou County, Jiangxi province were the least inhibitory to R. solani and S. sclerotiorum (6.7% and 15.1% respectively) as compared with isolates from the other soils.

Identity of the PGPR and their biocontrol and growth-promoting traits and genes

Twenty-four strains representative of the dominant morphotypes (Table 2) were screened for growth-promoting and biocontrol-related traits and genes. Of these 24 strains, 15,11 and 20, respectively, inhibited the growth of G. graminis var. tritici ARS-A1, R. solani AG-8 C-1 and S. sclerotiorum MGSCF180002 (Table 3).

Results of traditional microbiological tests and analysis of partial 16S rDNA gene sequences (Table 2) revealed that five of the 24 strains were Gram-positive and closely related to Bacillus, Paenibacillus polymyxa and Micro-bacterium hydrocarbonoxydans. The rest of the strains represented two different clades of Gram-negative bacteria and were closely related to several species within the Pseudomonas fluorescens and Pseudomonas putida groups, and to Lysobacter capsici, Lysobacter enzymo-genes, Serratia plymuthica and Delftia tsuruhatensis. We subjected strains of the P. fluorescens group to the multilocus typing scheme of Mulet and colleagues (2009; 2010), which has proven to be useful for establishing phylogenetic relationships among pseudomonads and is based on sequences of 16S rDNA, gyrB and rpoD (Mulet etal., 2009; 2010). The results of molecular typing identified strains TY1502, TY1508, KY4410 and TM1109 as P. protegens and strain KY5406 as P. chlororaphis (Fig. S1). Strains TY1205, TY1210, KM3113 and KY5404 were identified as members of the P. corrugata subgroup and were closely related but not identical to the well-studied biocontrol species P. brassicacearum (Fig. S1).

All 24 strains produced one or more of the extracellular metabolites cellulase, protease and siderophores. Genes for the biosynthesis of the antibiotics 2,4-DAPG (phlD), phenazines (phzF), pyrrolnitrin (prnD) and/or pyoluteorin (pltC) were detected in strains of P. protegens, P. chlororaphis and/or S. plymuthica (Table 3) and the antibiotics themselves were detected in culture extracts analysed by thin-layer chromatography. These antibiotics are well known to function as major mechanisms of biocontrol of soilborne pathogens.

The amplified fragments of phlD, phzF, prnD and pltC from these strains were sequenced and used in phylo-genetic analyses together with corresponding alleles previously deposited in GenBank. Phylograms inferred from phlD and pltC sequences revealed that both of these genes from strains TM1109, TY1502, TY1508 and KY4410 were closely related to their homologues from P. protegens (Figs S2 and S3). Strains TM1109, TY1502, TY1508 and KY4410 also carried a P. protegens-like prnD allele and therefore had a combination of antibiotic biosynthesis pathways similar to those of the model biocontrol agents P. protegens strains Pf-5 and CHA0 (Fig. S4). The second prnD-positive Pseudomonas strain, KY5406, also carried phzF (Table 3), a gene required for the production of phenazine antibiotics and highly conserved in all known phenazine producers. The prnD and phzF genes of KY5406 clustered with homologues from P. chlororaphis (Figs S4 and S5). Strain KY5406 also contained phzO (data not shown), a gene required for the biosynthesis of 2-hydroxylated phenazine compounds, indicating this strain is subsp. aureofaciens. Finally, two more prnD-positive strains, KM3407 and TM4307-1 (Table 3), carried prnD alleles similar to those present in pyrrolnitrin-producing strains of Serratia spp. (Fig. S4) and produced Prn in vitro (data not shown). In total, correlation of the antibiotic gene profiling with the taxonomic

Table 2. Bacteria used in this study.

Straina

Source and type of contamination

References

Bacillus sp. TY5107 Delftia tsuruhatensis TM3205 Lysobacter capsici TM5405 Lysobacter enzymogenes TM2502 Microbacterium hydrocarbonoxydans TY3211y

Microbacterium hydrocarbonoxydans TY3517

Paenibacillus polymyxa KM2501 Paenibacillus polymyxa KM4410 Pseudomonas sp. TY1205 Pseudomonas sp. TY1210 Pseudomonas sp. KM3113 Pseudomonas sp. KY5404 Pseudomonas chlororaphis KY5406 Pseudomonas sp. TY3101 Pseudomonas sp. TY3116w Pseudomonas sp. KY3201 Pseudomonas sp. TY5511 Pseudomonas sp. KM2404 Pseudomonas protegens TM1109 Pseudomonas protegens TY1502 Pseudomonas protegens TY1508 Pseudomonas protegens KY4410 Serratia plymuthica KM3407 Serratia plymuthica TM4307-1 P. brassicacearum Q8r1-96

P. chlororaphis 30-84

P. protegens Pf-5 P. chlororaphis TX-1

Qidong City (near Yinyang), Jiangsu Province, China (excessive salinization) Jinmen City, Hubei Province, China (petroleum products) Qidong City (near Yinyang), Jiangsu Province, China (excessive salinization) Hukou County, Jiangxi Province, China (recalcitrant organic compounds) Jinmen City, Hubei Province, China (petroleum products)

Jinmen City, Hubei Province, China (petroleum products)

Hukou County, Jiangxi Province, China (recalcitrant organic compounds) Qidong City (near Dongyuan), Jiangsu Province, China (excessive salinization) Daye County, Hubei Province, China (heavy metals) Daye County, Hubei Province, China (heavy metals) Jinmen City, Hubei Province, China (petroleum products) Qidong City (near Yinyang), Jiangsu Province, China (excessive salinization) Qidong City (near Yinyang), Jiangsu Province, China (excessive salinization) Jinmen City, Hubei Province, China (petroleum products) Jinmen City, Hubei Province, China (petroleum products) Jinmen City, Hubei Province, China (petroleum products) Qidong City (near Yinyang), Jiangsu Province, China (excessive salinization) Hukou County, Jiangxi Province, China (recalcitrant organic compounds) Daye County, Hubei Province, China (heavy metals) China (heavy metals) China (heavy metals)

Jiangsu Province, China (excessive salinization) Jinmen City, Hubei Province, China (petroleum products) Qidong City (near Dongyuan), Jiangsu Province, China (excessive salinization) Quincy, WA, USA (wheat rhizosphere)

Glen Elder, KS, USA (wheat rhizosphere)

Texas (cotton rhizosphere)

East Lansing, MI (thatch and soil of Kentucky bluegrass)

Daye County, Hubei Province, Daye County, Hubei Province, Qidong City (near Dongyuan),

This study This study This study This study This study

This study

This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study Weller etal., 2007;

Loper etal., 2012 Pierson and

Thomashow, 1992 Paulsen et al., 2005 Powell etal., 2000

a. Strains number prefixes: KM, isolated from the wheat rhizosphere on 1/3 x KMB agar; TM, isolated from the wheat rhizosphere on V10 x TSA; KY, isolated from the rapeseed rhizosphere on 1/3 x KMB agar; TY, isolated from the rapeseed rhizosphere on V10 x TSA.

placement of the strains by partial 16S rRNA gene sequence analysis identified the antibiotic-producing strains as members of P. protegens, P. chlororaphis subsp. aureofaciens and S. plymuthica.

1-aminocyclopropane-1-carboxylic acid (ACC) deami-nase and IAA production by PGPR are important determinants in plant-bacterial interactions, and secretion of these compounds can induce plants to produce longer and more vigorous roots (Penrose and Glick, 2003). Delftia tsuruhatensis TM3205 and Pseudomonas strains KM3113, KY5404, TY1210, TY1205, KY3201 andTY3101 produced IAA in culture. PCR analysis demonstrated that the aforementioned Pseudomonas strains were positive for acdS, a gene required for the production of ACC deaminase (Table 4), and the sequences of those strains closely resembled those from other fluorescent pseudomonads (Fig. S6). All acdS sequences from the Chinese strains formed a distinct clade within the Pseudomonas group and clustered tightly with acdS from Pseudomonas sp. 2-3 (GenBank Accession No. EU520401). All acdS-positive strains grew in defined medium supplemented with ACC as a sole nitrogen source.

Biocontrol and growth-promoting activity of the rhizobacterial strains

A subset of strains with the highest antagonistic activity and representative of the dominant morphotypes was selected to determine their biocontrol activity against take-all and Rhizoctonia root rot of wheat under greenhouse conditions in sterile, pasteurized and raw soils from Wuhan, China and Quincy, Washington. Most of the isolates provided some levels of reduction in root disease as compared with the pathogen-inoculated controls (Tables 5-7). However, strains identified as L. capsici, L. enzymogenes, P. protegens and P. chlororaphis provided the best and most consistent disease suppression across experiments and pathogens. Pseudomonas protegens TM1109 was especially effective in biocontrol of both take-all and Rhizoctonia root rot. These results indicate that indigenous rhizobacteria from the contaminated soil have the capacity to provide protection of plants against soilborne fungal pathogens. Surprisingly, application of S. plymuthica TM4307-1, which highly antagonized the pathogens in vitro (Table 3), resulted in significantly higher levels of Rhizoctonia root rot (Table 6).

Table 3. Biocontrol related genes and traits of Chinese strains and in vitro inhibition of soilborne pathogensa.

Strain Antibiotic biosynthesis genes Extracellular metabolites Inhibition of pathogen

phlD phzF prnD pltC Cel Sid Pro Ggt ARS-A1 Rs AG-8 Ss

Bacillus sp. TY5107 - - - - - + - - - ++

D. tsuruhatensis TM3205 - - - - + + - ++ - -

L. capsici TM5405 - - - - - + + +++ ++ -

L. enzymogenes TM2502 - - - - - + + ++ ++ -

M. hydrocarbonoxydans TY3211y - - - - + - + - - +

M. hydrocarbonoxydans TY3517 - - - - - + + - - +

Pa. polymyxa KM2501 - - - - + + + ++ ++ ++

Pa. polymyxa KM4410 - - - - + + + ++ ++ ++

Pseudomonas sp. TY1205 - - - - + + - ++ + +

Pseudomonas sp. TY1210 - - - - + + - ++ - ++

Pseudomonas sp. KM3113 - - - - + + + ++ - +

Pseudomonas sp. KY5404 - - - - + + - - - +

P. chlororaphis KY5406 - + + - + + - + + +

Pseudomonas sp. TY3101 - - - - + + - - ++ +

Pseudomonas sp. TY3116w - - - - + + + - ++ -

Pseudomonas sp. KY3201 - - - - + + - - - ++

Pseudomonas sp. TY5511 - - - - + ++ + - - +

Pseudomonas sp. KM2404 - - - - + + - - + ++

P. protegens TM1109 + - + + + + - ++ - +

P. protegens TY1502 + - + + + + - ++ - +

P. protegens TY1508 + - + + + + - ++ - ++

P. protegens KY4410 + - + + + + - ++ - ++

S. plymuthica KM3407 - - + - + + - +++ +++ ++

S. plymuthica TM4307-1 - - + - + + + +++ +++ ++

a. Presence (+) or absence (-) of genes required for the biosynthesis of 2,4- DAPG (phlD), phenazine (phzF), pyrrolnitrin (prnD) and pyoluteorin (pltC). Extracellular metabolites produced: cellulase (Cel), protease (Pro) and siderophores (Sid).

Isolates were tested in vitro for ability to inhibit the growth of R. solani AG-8 (Rs AG-8); G. graminis var. tritici ARS-A1 (Ggt ARS-A1); and S. sclerotiorum (Ss). Inhibition was scored as follows: -, no inhibition; + , inhibition zone of < 5 mm; ++, inhibition zone of 5 to 10 mm; +++; and inhibition zone of > 10 mm.

We speculate that TM4307-1 produces yet unidentified phytotoxic metabolite(s) since treatment of both wheat and canola with this bacterium resulted in significant stunting and bleaching of the seedlings and root damage.

Twenty-two of the 24 isolates were tested for the ability to promote canola root growth in growth pouch assays. The two S. plymuthica strains were eliminated from this assay because they enhanced disease when applied to wheat and caused stunting. Thirteen strains increased root growth significantly (P = 0.05) in at least one of the three experiments (Table 4). Pseudomonas protegens and P. brassicacearum-like strains demonstrated the most consistent capacity to promote root growth and, on average, increased root length in canola by 41% to 42%, respectively, as compared with the non-treated controls. All P. brassicacearum-like isolates produced IAA and carried acdS. In contrast, strains of P. protegens had neither trait. Other tested Pseudomonas strains (i.e. KY3201, TY3101, Ty3116w, Ty5511 and KM2402) increased root length consistently but not always significantly, whereas strains of Bacillus, Paenibacillus and Lysobacter had no growth promotion activity. These results indicate that rhizobacteria from the contaminated soil have the capacity to directly enhance plant growth.

Tolerance to abiotic stressors

Based on the results from the biocontrol and growth promotion assays, 10 of the 24 strains were selected and tested for tolerance to two heavy metals and high levels of salt by growing them in LB broth supplemented with CdCl2, CuCl2 and NaCl. All 10 strains tolerated high levels of salt and grew well in up to 5-7% NaCl. Similarly, these 10 strains grew in the presence of heavy metals and demonstrated minimal inhibitory concentrations (MICs) to Cu2+ of > 4 mM and Cd2+ of > 1 mM. Overall, P. protegens TM1109 was the most tolerant to these stressors (Table 8).

Discussion

Plants have evolved along with a rhizosphere microbiome that contributes to the growth and health of the plant (Pieterse etal., 2014). Beneficial microbes that directly promote growth or defend roots are recruited by the roots from the bulk soil, making soil type an important determinant of the composition of the rhizosphere microbiome. However, the plant also strongly modulates the shape of the microbial community because both the quality and quantity of root exudates are regulated by the plant genotype (Bais etal., 2006; Hartmann etal., 2009). Our

Table 4. Growth promotion of canola roots by rhizobacteria applied as seed treatments in growth pouch experiments".

Exp 1 Root Increase Increase Exp 3 Root Increa

Treatment acdS IAA length (%) Exp 2 Root length (%) length (%)

Bacillus sp. TY5107 - - 6.8 ± 0.5 BE 20.2 4.2 ± 0.4 GH -18.5 4.8 ± 0.3 I -29.4

D. tsuruhatensis TM3205 - + 8.1 ± 0.4 AD 43.3 5.7 ± 0.4 DE 10.8 9.7 ± 0.3 A 42.7

L. capsici TM5405 - - 7.0 ± 0.3 BE 22.5 NT 5.8 ± 0.4 H -13.6

L. enzymogenes TM2502 - - NT 4.9 ± 0.4 EG -4.5 5.9 ± 0.3 H -13.5

M. hydrocarbonoxydans TY3211y - - 7.9 ± 0.3 AD 38.8 5.5 ± 0.4 DF 7.1 7.7 ± 0.4 FG 13.9

M. hydrocarbonoxydans TY3517 - - 5.8 ± 0.2 DE 2 5.4 ± 0.3 DF 5.2 6.5 ± 0.3 H -3.5

Pa. polymyxa KM2501 - - 7.4 ± 0.3 AE 30.9 4.6 ± 0.4 FG -11.7 NT

Pa. polymyxa KM4410 - - 3.1 ± 0.3 E -45.8 4.9 ± 0.4 EG -5.2 NT

Pseudomonas sp. KM3113 + + 8.1 ± 0.4 AD 42.7 7.0 ± 0.4 AB 35.6 9.4 ± 0.4 AB 38.4

Pseudomonas sp. KY5404 + + 8.5 ± 0.5 AC 50 7.9 ± 0.4 A 53.4 8.2 ± 0.3 DF 21.6

Pseudomonas sp. TY1210 + + 9.6 ± 0.4 A 68.3 7.0 ± 0.3 AB 35.7 8.4 ± 0.4 CDF 23.5

Pseudomonas sp. TY1205 + + 9.4 ± 0.5 A 64.8 7.0 ± 0.3 AB 35.4 9.3 ± 0.4 AC 37.8

P. chlororaphis KY5406 - - 6.0 ± 0.4 CE 5.9 4.4 ± 0.4 GH -15.6 5.9 ± 0.4 H -13

Pseudomonas sp. KY3201 + + 9.7 ± 0.3 A 71.4 5.9 ± 0.3 CD 14.8 7.9 ± 0.4 EF 17.5

Pseudomonas sp. TY3101 + + 8.4 ± 0.5 AB 48.8 5.5 ± 0.4 DF 6.9 9.7 ± 0.4 A 43

Pseudomonas sp. TY3116w - - 8.1 ± 0.2 AD 42.9 5.8 ± 0.3 DE 12.2 7.6 ± 0.4 FG 12.7

Pseudomonas sp. TY5511 - - 8.3 ± 0.3 AD 45.9 5.7 ± 0.3 DE 10.6 8.8 ± 0.3 AE 29.9

Pseudomonas sp. KM2404 - - 8.4 ± 0.3 AC 47.9 7.0 ± 0.4 AB 36 9.7 ± 0.4 DF 42.7

P. protegens KY4410 - - 7.9 ± 0.3 AD 39.9 7.6 ± 0.3 AB 47.2 8.8 ± 0.4 AE 29.8

P.protegens TM1109 - - 9.1 ± 0.4 AB 60.6 7.6 ± 0.3 AB 47.5 8.5 ± 0.3 BF 25.7

P.protegens TY1502 - - 9.1 ± 0.4 AB 60.6 6.8 ± 0.3 BC 31.7 8.6 ± 0.4 BF 27.2

P.protegens TY1508 - - 8.7 ± 0.5 AB 53.6 7.4 ± 0.3 AB 42.2 9.0 ± 0.4 AD 33.2

Ck - - 5.7 ± 0.5 CE 5.2 ± 0.4 DG 6.8 ± 0.3 GH

a. Surface-sterilized canola seeds were soaked for 1 h in each bacterial suspension. Control (CK), non-treated seeds were soaked in sterile water.

Presence (+) or absence (-) of the acdS gene. Bacterial cultures were positive (+) or negative (-) for the presence of IAA.

% increase = [(root length of a treatment- root length of the control)/ root length of the control] x 100%. Means in the same column followed by the

same letter are not significantly different at P = 0.05 according to Fisher's protected least significant difference test (LSD) or Kruskal-Wallis all

pairwise comparison test.

Exp, experiment; NT, not tested.

results support the hypothesis that certain groups of PGPR and biocontrol and growth-promoting genes are cosmopolitan and conserved in soil microbiomes worldwide. Driven by rhizodeposition, the plant enriches and supports PGPR best adapted to colonize the roots, antagonize pathogens, stimulate growth and/or initiate pattern-triggered immunity.

We tested our hypothesis by characterizing culturable PGPR in the rhizospheres of wheat and rapeseed grown in soils from polluted fields, and assessed their growth-

promoting and biocontrol abilities. After the most abundant bacterial morphotypes were isolated, the only other criterion we used for selecting the rhizobacteria was the ability to inhibit G. graminis var. tritici, R. solani or S. sclerotiorum. This was done because in vitro inhibition of plant pathogens is a characteristic commonly found in many PGPR strains (Haas and Defago, 2005) even though antibiosis does not predict biocontrol or growth-promoting activity. The 24 strains described here were shown to be most closely related to species known to

Table 5. Suppression of Rhizoctonia solani AG-8 in sterile soil in greenhouse pot experiments®.

Disease rating Shoot length (cm)

Treatment Exp 1 Exp 2 Exp 1 Exp 2

CK1 0.4 ± 0.1 0.3 ± 0.5 25.3 ± 4.9 36.4 ± 2.7

CK2 5.0 ± 1.6 A 4.6 ± 1.3 AB 20.5 ± 5.3 D 33.3 ± 3.6 BC

L.capsici TM5405 3.3 ± 1.6D 3.1 ± 1.7C 23.6 ± 4.6 ABC 37.1 ± 3.9 A

L. enzymogenes TM2502 3.7 ± 1.7 CD 3.7 ± 1.7 BC 23.1 ± 5.0 ABC 31.7 ± 4.3 C

Pa. polymyxa KM2501 4.1 ± 1.8 ABC 3.6 ± 1.5 BC 22.6 ± 4.4 BC 33.9 ± 4.1 B

Pa. polymyxa KM4410 3.1 ± 1.7 D 4.6 ± 1.3 AB 24.4 ± 4.7 A 34.8 ± 5.3 B

P.protegens TM1109 3.8 ± 1.6 BCD 3.8 ± 1.7 BC 23.7 ± 4.7 AB 31.7 ± 3.4 C

a. CK1, control consisting of sterile soil from Wuhan, China not amended with inoculum of R. solani and sown to non-treated seeds; CK2, control consisting of soil amended with R. solani inoculum and sown to methyl cellulose coated seeds.

Severity of Rhizoctonia root rot was evaluated on a scale of 0-8. Means in the same column followed by the same letter are not significantly different at P = 0.05 according to Fisher's protected least significant difference test (LSD) or Kruskal-Wallis all pairwise comparison test. Exp, experiment.

Growth-promoting rhizobacteria in polluted soils 7 Table 6. Suppression of Rhizoctonia solani AG-8 in Quincy virgin soil in a growth chamber tube assays".

Disease rating

Treatment Pasteurized soil Raw soil

Exp 1 Exp 2 Exp 3 Exp 4

CK1 0.5 ± 1.5 0.1 ± 0.5 0.3 ± 0.8 0.1 ± 0.3

CK2 4.8 ± 0.8 B 4.9 ± 0.8 B 4.4 ± 0.6 A 4.5 ± 0.7 AB

CK3 4.7 ± 0.9 BC 5.2 ± 0.8 B 4.3 ± 0.6 AB 4.6 ± 0.6 A

D. tsuruhatensis TM3205 NE NE 3.9 ± 0.4 ABC 4.1 ± 0.4 BC

L. capsici TM5405 4.3 ± 1.1 BCD 4.8 ± 0.8 B 3.8 ± 0.5 BC 4.1 ± 0.7 C

L. enzymogenes TM2502 NE NE 3.9 ± 0.9 ABC 4.0 ± 0.5 C

Pa. polymyxa KM4410 4.4 ± 1.7 BCD 4.9 ± 0.9 B 3.9 ± 0.5 BC 4.0 ± 0.4 C

Pseudomonas sp. KM3113 NE NE 4.2 ± 0.7 AB 4.1 ± 0.6 BC

P. chlororaphis KY5406 4.3 ± 0.8 CD 3.9 ± 1.0 C 3.4 ± 1.6 C 3.7 ± 1.8 CD

Pseudomonas sp. KM2404 4.4 ± 0.9 BCD 4.8 ± 0.8 B NE NE

P. protegens KY4410 NE NE 2.4 ± 1.2 D 3.2 ± 1.1 D

P. protegens TM1109 4.2 ± 0.8 D 4.2 ± 0.8 C 2.0 ± 1.2 D 3.1 ± 1.2 D

S. plymuthica TM4307-1 6.6 ± 0.9 A 6.3 ± 1.0 A NE NE

a. CK1, soil not amended with R. solani inoculum and sown to non-treated seed; CK2, soil amended with R. solani inoculum and sown to methyl cellulose coated seed; and CK3, soil amended with oat-kernel inoculum and sown to non-treated seed.

Severity of Rhizoctonia root rot was evaluated on a scale of 0-8. Experiments 1 and 2 were conducted in Quincy virgin soil that had been pasteurized (60°C, 30 min); experiments 3 and 4 were conducted in raw Quincy virgin soil. Means in the same column followed by the same letter are not significantly different at P = 0.05 according to Fisher's protected least significant difference test (LSD) or Kruskal-Wallis all pairwise comparison test.

Exp, experiment; NE, not evaluated.

have members with PGPR activity. Common among these strains were genes and traits that are well known to contribute to biocontrol and growth-promoting activity (Haas and Défago, 2005; Glick etal., 2007; Loper etal., 2007; Lugtenberg and Kamilova, 2009). For example, phzF, detected in P. chlororaphis subsp. aureofaciens KY5406, is a key gene in the biosynthesis of phenazine-1-carboxylic acid (PCA) and serves as a marker for the capacity of PGPR to produce one or more phenazines, a large class of broad-spectrum antibiotics produced by a variety of bacteria (Mavrodi etal., 2006; 2010). Yang and

colleagues (2011) showed that phzF-containing and PCA-producing Pseudomonas spp. colonized wheat grown in Hebei and Jiangsu provinces, China, and that these strains suppressed take-all. In the Pacific Northwest of the United States, PCA-producing pseudomonads are abundant on the roots of dryland wheat and suppress take-all and Rhizoctonia root rot (Thomashow and Weller, 1988; Mavrodi etal., 2012). Phenazine-producing PGPR also contributed to the natural suppressiveness of soils in the Chäteaurenard region of France to Fusarium wilt (Mazurier etal., 2009). phlD is a key gene in the

Table 7. Suppression of G. graminis var. tritici ARS-A1 in Quincy virgin soil in a growth chamber tube assays".

Treatment Disease rating

Pasteurized soil Raw soil

Exp 1 Exp 2 Exp 3 Exp 4

CK1 0.5 ± 1.4 0.0 ± 0.3 0.5 ± 1.4 0.0 ± 0.2

CK2 5.2 ± 1.2 AB 6.7 ± 0.8 A 4.5 ± 0.9 ABC 6.1 ± 1.0 AB

CK3 5.3 ± 1.0 AB 6.6 ± 0.8 A 4.7 ± 1.0 AB 6.1 ± 1.0 A

L. capsici TM5405 3.8 ± 0.8 D 5.9 ± 1.0 BC 3.3 ± 0.7 E 5.3 ± 1.4 BCD

Pa. polymyxa KM4410 5.0 ± 1.3 AB 6.6 ± 0.9 A 4.2 ± 0.9 BC 5.9 ± 1.2 ABC

P. chlororaphis KY5406 4.0 ± 1.2 CD 4.8 ± 1.2 D 3.7 ± 1.2 DE 4.4 ± 1.0 E

Pseudomonas sp. KM2404 5.2 ± 1.2 AB 6.6 ± 1.0 A 4.0 ± 1.0 CD 5.9 ± 1.0 ABC

P. protegens TM1109 3.9 ± 1.1 D 5.4 ± 0.9 CD 3.2 ± 0.8 E 4.6 ± 1.3 DE

S. plymuthica TM4307-1 5.8 ± 1.3 A 6.6 ± 0.9 A 5.3 ± 1.6 A 6.1 ± 1.4 AB

a. CK1, Quincy virgin soil not amended with inoculum and sown to non-treated seed; CK2, soil amended with G. graminis var tritici inoculum and

sown to methyl cellulose coated seed; and CK3, soil amended with G. graminis var tritici inoculum and sown to non-treated seed.

Severity of take-all was evaluated on a scale of 0-8. Experiments 1 and 2 were conducted in pasteurized Quincy virgin soil (60°C, 30 min);

experiments 3-4 were conducted in raw Quincy virgin soil. Means in the same column followed by the same letter are not significantly different

at P = 0.05 according to Fisher's protected least significant difference test (LSD) or Kruskal-Wallis all pairwise comparison test.

Exp, experiment.

Table 8. Minimum inhibitory concentrations (MICs) of heavy metals and salt for selected strains®.

Isolate Type of soil contamination strain from Cd2+ (mM) Cu2+ (mM) NaCl (%)

D. tsuruhatensis TM3205 Petroleum products 1.3 4.4 7

Pseudomonas sp. KM3113 Petroleum products 1 4.4 6

Pseudomonas sp. TY1205 Heavy metals 1 4.8 5.5

Pseudomonas sp. KY5404 Excessive salinization 1 5 5.5

Pseudomonas sp. TY1210 Heavy metals 1 4 6

P. chlororaphis KY5406 Excessive salinization 1.5 5 5.5

Pseudomonas sp. TY3101 Petroleum products 1 4 5.5

Pseudomonas sp. KY3201 Petroleum products 1 4 7.5

P.protegens TM1109 Heavy metals 1.5 5 7

P. protegens KY4410 Excessive salinization 1.5 4.8 7

a. MICs were determined in Luria-Bertani (LB) broth amended with CuCl2 to give a range of concentrations from 3 to 6 mM; CdCl2 to give a range of concentrations from 0.4 to 2.0 mM; and NaCl to give concentrations ranging from 0% to 8%.

biosynthesis of the broad-spectrum antibiotic 2,4-DAPG in Pseudomonas spp. and 2,4-DAPG producers are responsible for the natural suppression of take-all of wheat in the United States and black root rot of tobacco in soils of the Morens region of Switzerland (Weller etal., 2007). 2,4-DAPG also induces systemic resistance in plants to pathogens (Weller etal., 2012). prnD and pltC are genes that encode for the biosynthesis of pyrrolnitrin and pyoluteorin, antibiotics that are highly active against Rhizoctonia and Pythium species respectively (Loper etal., 2007). The gene acdS encodes ACC deaminase, which promotes plant growth and development by decreasing ethylene levels in the plant. ACC deaminase-producing PGPR convert the ethylene precursor ACC to a-ketobutyrate and ammonia and can relieve stress resulting from pathogens, polyaromatic hydrocarbons, heavy metals, salt and drought (Glick etal., 2007).

To validate the biocontrol activity of our strains, we used the Rhizoctonia root rot- and take-all-wheat pathosystems. Strains of P. protegens, P. chlororaphis subsp. aureofaciens and L. capsici provided the most consistent disease suppression and members of all three species are biocontrol agents of a broad range of diseases. For example, P. protegens Pf-5 produces a wide arsenal of antibiotics and toxins and approximately 6% of its genome is devoted to the production of secondary metabolites (Paulsen etal., 2005; Loper etal., 2007). Strain CHA0, isolated from a tobacco black root rot suppressive soil, is another notable P.protegens with exceptional biocontrol activity (Ramette etal., 2011). Our four P. protegens strains, TM1109, TY1502, TY1508 and KY4410, contained the three antibiotic biosynthesis genes, phlD, prnD and pltC, and produced the antibiotics that are characteristic of Pf-5 and CHA0.

Pseudomonas chlororaphis subsp. aureofaciens contains phzO (Mavrodi etal., 2010), and besides PCA, it also produces hydroxyphenazines, which have characteristic orange and red colours and differ from PCA in antibiotic activity (Mavrodi etal., 2010). Notable examples

of P. chlororaphis subsp. aureofaciens with biocontrol activity include strains 30-84 (Pierson and Thomashow, 1992) and TX-1 (Powell etal, 2000). In P. chlororaphis, phenazine production also contributes to rhizosphere competence (Mavrodi etal., 2006). Lysobactersp. strains also have broad antifungal and antibacterial activities. For example, Park and colleagues (2008) reported that L. capsici YC5194T inhibited Pythium ultimum, Colletotrichum gloeosporioides, Fusarium oxysporum, Botrytis cinerea, R. solani, Botryosphaeria dothidea and Bacillus subtilis. Lysobacter sp. SB-K88 (formerly Stenotrophomonas) (Nakayama etal., 1999) produced the antibiotics xanthobaccins A, B and C, and xanthobaccin A was involved in the suppression of Pythium damping-off of sugar beet (Islam etal., 2005).

To test our strains for the ability to directly promote plant growth, we used the canola root elongation assay, a model system commonly employed to demonstrate direct growth-promoting activity by PGPR (Patten and Glick, 2002). The most consistent and effective growth promoters were strains of Delftia and Pseudomonas that produced IAA and, in the case of P. fluorescens- and P. brassicacearum-like strains, harboured acdS. Of these species, only P. fluorescens and P. brassicacearum have been reported to have direct growth-promoting ability (Belimov etal., 2007; Glick etal., 2007). Members of these two species also are biocontrol agents (Loper etal., 2012). Pseudomonas brassicacearum has commonly been isolated from Arabidopsis thaliana, Brassica napus (Achouak etal., 2000) and wheat (Ross etal., 2000). Pseudomonas brassicacearum strain Am3, with ACC deaminase activity, promoted root elongation of Indian mustard and increased root and shoot biomass of rape-seed and pea (Belimov etal., 2001; Safronova etal.,

2006). A mutation in acdS resulted in a loss of growth-promoting activity in P. brassicacearum (Belimov etal.,

2007).

We tested 10 strains for tolerance to heavy metals and high levels of salt by growing them in broth supplemented

with CdCl2, CuCl2 and NaCl. Unfortunately, there are no records of how long the sampled fields have been polluted but discussions with local inhabitants indicated that some fields may have been in that condition for decades. Not surprising, all of the PGPR strains tested tolerated high levels of salt and demonstrated MICs to Cu2+ and Cd2+ on par or higher than those previously reported for strains adapted to survival in the presence of acute levels of heavy metal contamination of soil (Thomas etal., 2008; Altimira etal., 2012). Thus, our results confirm that PGPR species have adapted not only to a wide variety of cropping systems and crops but also to adverse environmental conditions. Of particular note are our strains of P. protegens, which appeared to be especially well adapted to a wide variety of pollutants. Perhaps not surprisingly, analysis of the genome of P. protegens Pf-5 identified a considerable collection of efflux systems that provide protection against a range of toxic metabolites (Loper etal., 2007). Evidence is accumulating that strains of P. protegens form the cornerstones of communities of microbial defenders of roots in rhizosphere microbiomes globally.

In conclusion, Chinese farmers often must utilize all arable land, even polluted fields, because of the challenges of feeding a huge population. We inventoried PGPR in contaminated soils from sites representative of polluted fields supporting agricultural production. These sites were especially interesting because their microbiology previously had not been studied. Our findings demonstrate that well-described PGPR species and bio-control and growth-promoting genes are common in the rhizosphere microbiome of plants grown in polluted Chinese soils. PGPR from such soils may be the best source of strains for commercial development given that in China nearly 50 million acres of arable land suffer from some type of soil pollution (Zhou, 2013). With the world population expected to be 9-11 billion by 2050, the challenge is to identify crop cultivars and cropping systems that make fuller use of indigenous and introduced PGPR for pest protection and growth promotion since the amount of arable land and water available for food production will likely continue to decrease.

Experimental procedures

Bacterial strains, soilborne pathogens and growth media

Bacterial strains used in this study are listed in Table 2. Pseudomonas isolates were grown in KMB or one-third-strength KMB (1/3 x KMB) agar or broth at 28°C as described by Mavrodi and colleagues (2012). Other strains were grown in TSA or tryptic soy broth (TSB) or these media at one-tenth strength (V10 xTSB or TSA) (Mavrodi etal., 2012) at 28°C. When needed to inhibit fungi, these media were supplemented with cycloheximide (100 |g ml-1). All strains were stored in 60% glycerol at -80°C. The fungal wheat root patho-

gens Gaeumannomyces graminis (Sacc.) von Arx and Olivier var. tritici Walker isolate ARS-A1 (Yang etal., 2011) and R. solani Kühn [teleomorph Thanatephorus cucumeris (Frank) Donk] AG-8 isolate C-1 (Huang etal., 2004), and the rapeseed/canola pathogen S. sclerotiorum (Lib.) de Bary isolate MGSCF180002 (from rapeseed) were grown at room temperature on one-fifth-strength homemade potato dextrose agar (1/5 x PDA) (Yang etal., 2011). In vitro inhibition assays of pathogens by PGPR were conducted on full-strength PDA.

Sample collection

Soil was sampled from five polluted sites in China: farmland contaminated with heavy metals in Daye County, Hubei Province; a riverside field at a recalcitrant organic sewage outlet in Gold Sand Bay Industrial Park, Hukou County, Jiangxi Province; farmland beside a petroleum products sewage outlet in Jinmen City, Hubei Province; and saline-alkali fields on two separate seaside farms in Qidong City (near Dongyuan and Yinyang respectively), Jiangsu Province. At each site, plants were dug to a depth of 30 cm from five random locations. Two kilograms of soil surrounding the roots of plants from each location was placed in plastic bags, transported to the laboratory and stored at 4°C until processed as described below.

Wheat and rapeseed greenhouse cycling assays in contaminated soils

Soil from each location was sieved, put into three square pots (6.5 cm high x 7 cm wide) and 10 ml of a metalaxyl (Syngenta, Wilmington, DE, USA) solution (75 mg l-1) was added to prevent damping-off disease caused by indigenous Pythium spp. Each pot served as a replicate. Six surface-sterilized seeds of wheat (cv. Zhengmai 9023) or rapeseed (cv. Xiangyou 571) were pre-germinated for 48 h, sown in each pot and then covered with a 1.5 cm-thick layer of sterile vermiculite. Each pot was then given 30 ml of water. The pots were covered with a plastic bag for 4 days and incubated in a greenhouse (15-18°C; dark/light cycle, 12 h). Each pot received 30 ml of water two times weekly and diluted (1:3, vol/vol) Hoagland's solution once weekly. After 3 weeks, the seedlings were removed from the pots, roots were excised and soil and roots from all of the pots of the same treatment were mixed and added back to the pots and sown as before with wheat or rapeseed to begin a second growth cycle. At the end of the third growth cycle, roots from two randomly chosen plants from each pot were selected for enumeration of populations of total culturable aerobic, heterotrophic rhizobacteria (total bacteria) by the end-point dilution assay as described below.

Enumeration and isolation of rhizosphere bacteria

Roots with adhering rhizosphere soil of two plants from the same pot were excised and placed in a 50 ml screw-cap tube with 10 ml of sterile distilled water, vortexed (1 min) and sonicated in an ultrasonic cleaner (1 min) to dislodge rhizobacteria (Mavrodi etal., 2012). The dilution endpoint assay with 1/10 x TSB plus cycloheximide was used to determine the population density of total bacteria as described by

Mavrodi and colleagues (2012). The 96-well microplates were incubated at room temperature in the dark, and after 72 h, each well was scored for growth. At the end of the 3rd growth cycle, rhizobacteria were isolated by dilution plating of the root washings onto 1/3 x KMB agar and 1/10 x TSA, each with cycloheximide. Plates were incubated at room temperature for 2 to 3 days or until colonies were visible. Colonies of different morphotypes were re-streaked onto 1/3 x KMB and 1/10 x TSA plates and stored in 60% glycerol at -80°C.

Pathogen inhibition in vitro

Inhibition of soilborne pathogens by rhizobacteria was tested on PDA by two approaches. In the first, aliquots (20 |l) from overnight broth cultures were introduced into a hole in the agar cut with a 5 mm cork borer, 1 cm from the edge of the Petri dish. A 5 mm plug from a culture of R. solani AG-8 or S. sclerotiorum grown on 1/5 x PDA was placed in the centre of the plate. Plates were incubated at 28°C and scored after 4 days by measuring the distance between the edges of the bacteria and the fungal mycelium. Four isolates were tested on each plate and each isolate was tested three times. In a second approach, aliquots (2 |l) from overnight cultures were spotted twice, 1 cm from the edge of a plate of PDA, and a plug of R. solani AG-8 was placed in the centre. For tests against G. graminis var. tritici, the plug of the fungus was placed in the centre of the plate 24 h before the bacteria were spotted. The zone of inhibition was measured 5 days later. Each isolate was tested four times.

Morphological and physiological characteristics of isolates

Selected isolates were characterized based on morphological and biochemical tests as described by Zhao and He (2012). Morphological characteristics included colony morphology, pigmentation, cell shape and Gram stain reaction. Biochemical and physiological characterization included tests for starch hydrolysis, gelatin liquefaction, catalase production, pectin decomposition, indole production and production of phenazine-1-carboxylic acid, 2,4-DAPG, pyrrolnitrin and pyoluteorin. Cellulase activity was determined on carboxy-methylcellulose (CMC) medium (per 1 l: peptone, 10 g; yeast extract, 10 g; sodium CMC, 10 g; NaCl, 5 g; KH2PO4, 1 g; agar, 15 g; pH 7.0). A 10 |l aliquot of an overnight bacterial culture was spotted on sterile filter paper (5 mm diameter, 0.5 mm thick) on the surface of CMC agar. To visualize the zone of hydrolysis, plates were incubated at 28°C for 48 h, flooded with an aqueous solution of 0.1% Congo red for 1 h and washed with 1 M NaCl (Ghose, 1987). Protease activity, demonstrated by casein degradation, was indicated by the appearances of zones of clearing around colonies grown on milk agar (per 1 l: dry skim milk, 100 g; agar, 20 g) after incubation at 28°C for 3 days. Siderophores were detected on CAS (chrome azurols) agar plates (Shin etal., 2011). Antibiotics (phenazine-1-carboxylic acid, pyrrolnitrin, pyoluteorin and DAPG) were isolated from bacterial cultures grown for 5 days on KMB agar by a modification of procedures described by Kraus and Loper (1992). Briefly, cells and spent agar (c. 15 ml) were macerated with a mortar and pestle in an equal volume of acetone. The acetone was evaporated in a hood

overnight and the residual aqueous phase was extracted twice with equal volumes of ethyl acetate. The ethyl acetate was recovered, dried and the residue was dissolved in 50 |l of methanol. Samples (5 |l) of the extracts, standards of the four antibiotics, and positive control extracts from strains P.protegens Pf-5 and P. brassicacearum Q8r1-96 were spotted on silica gel (GHLF) thin layer chromatography plates (Analtech, Newark, DE, USA). The plates were developed with chloroform/acetone (9:1) and observed under UV light (254 nm).

Amplification and sequencing of 16S rDNA, antibiotic biosynthesis and ACC deaminase genes

Genomic DNA was extracted from strains using a QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA) and quantified by fluorometry using a DNA quantitation kit (Bio-Rad, Hercules, CA, USA). Genes encoding 16S rDNA, subunit B of DNA gyrase, sigma 70 factor of RNA polymerase and key antibiotic biosynthesis enzymes (i.e. phzF, phlD, prnD and pltC) were amplified by using published oligonucleotide primer sets (McSpadden Gardener etal., 2001; De Souza and Raaijmakers, 2003; Mulet etal., 2009; Mavrodi etal., 2010) and cycling conditions (Table 9). The ACC deaminase gene (acdS) was targeted with primers F1936f-tail and F1938r-tail. These primers were derived from primers F1936 and F1938 (Blaha etal., 2006) by adding to their 5'-ends sequences GCTCCTACTCTGTCACCTATC and CTGTCG CTCTGGCTGTC, respectively, for direct sequencing of acdS amplicons with primers Tail1 andTail2 (Table 9). Amplification conditions for acdS included initial denaturation at 94°C for 1 min, followed by 10 cycles of 94°C for 30 s, 53°C for 20 s and 72°C for 45 s, followed by 25 more cycles with primer annealing temperature of 60°C. All amplifications were performed with a PTC-200 gradient thermal cycler (Bio-Rad) using GoTaq DNA polymerase (Promega, Madison, WI, USA). The amplifications were carried out in 25 | l reactions that contained 100 ng of DNA; 1 x GoTaq Flexi buffer, 200 | M dNTPs, 1.5 mM MgCl2, 20 pmol of each primer pair and 1.2 U of GoTaq Flexi DNA polymerase (Promega). Positive controls included DNA from P. chlororaphis subsp. aureofaciensTX-1 (phzF), P. brassicacearum Q8r1-96 (phlD, acdS) and P. protegens Pf-5 (phlD, prnD, pltC). Amplification products were cleaned with QIAquick PCR purification spin columns (Qiagen) and sequenced directly with a BigDye Terminator v. 3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) at ELIM Biopharmaceuticals (Hayward, CA, USA).

Sequence and phylogenetic analysis

Sequence data were assembled and analysed using Geneious Pro v. 7.1.5 (Biomatters, Auckland, New Zealand). The 16S rDNA similarity searches and taxa assignments were carried out using the Classifier and SeqMatch tools available through the Ribosomal Database Project (http:// rdp.cme.msu.edu). For antibiotic, ACC deaminase, gyrB and rpoD gene sequences, database searches for similar DNA and protein sequences were carried out with NCBI's BLAST network service (http://www.ncbi.nlm.nih.gov/ BLAST). Sequences were aligned and neighbour-joining

Table 9. Target genes and PCR and primers used in this study.

Gene Primer Sequence (5'-3') Annealing temp (°C) Putative gene function Amplicon (bp) References

16S 8F AGAGTTTGATCCTGGCTCAG 55 Small-subunit rRNA 1500 Weisburg etal., 1991

1492R TACGGHTACCTTGTTACGACTT

gyrB Up-1G- YGCSGGCGGYAAGTTCGA 60 DNA gyrase subunit B 1208 Mavrodi etal., 2010

UP-2G- CCRTCGACGTCVGCRTCGGT

gyrBch1 CGCYGGCGGTAAGTTCGA 57 DNA gyrase subunit B 1208 This study

gyrBch2 CCGTCGACGTCRGCGTCGGT

rpoD PsEG30F ATYGAAATCGCCAARCG 60 Sigma 70 factor of RNA 760 Mulet etal., 2009

PsEG790R CGGTTGATKTCCTTGA polymerase

phD B2BF ACCCACCGCAGCATCGTTTATGAGC 66.5 2,4-DAPG-specific type III 629 McSpadden Gardener

BPR4 CCGCCGGTATGGAAGATGAAAAAGTC PKS et a ., 2001

phzF Ps_ up 1 ATCTTCACCCCGGTCAACG 57 Phenazine biosynthesis 427 Mavrodi etal., 2010

Ps low 1 CCRTAGGCCGGTGAGAAC enzyme

prnD PRND1 GGGCGGGCCGTGGTGATGGA 65 Pyrrolnitrin biosynthesis 786 De Souza and

PRND2 YCCCGCSGCCTGYCTGGTCTG enzyme Raaijmakers, 2003

pltC PLTC1 AACAGATCGCCCCGGTACAGAACG 58 Type I PKS 438 De Souza and

PLTC2 AGGCCCGGACACTCAAGAAACTCG Raaijmakers, 2003

acdS F1936f-tail GCTCCTACTCTGTCACCTATCGHGA 50 ACC deaminase- encoding 792 This study

MGACTGCAAYWSYGGC gene

F1938r-tail CTGTCGCTCTGGCTGTCATCATVCC

VTGCATBGAYTT

Tail1 GCTCCTACTCTGTCACCTATC 60 See footnote Nikolic etal., 2011

Tail2 CTGTCGCTCTGGCTGTC

The Tail1/Tail2 primer set was used for direct sequencing of acdS amplicons generated with primers F1936f-tail/F1938r-tail.

phylogenies were inferred using the Molecular Evolutionary Genetics Analysis software (MEGA) v. 5.2.2 (Tamura etal., 2007). DNA and protein distances were corrected by using the Kimura two-parameter (Kimura, 1980) and Jones-Taylor-Thornton (Jones etal., 1992) models of evolution, respectively, and bootstrap re-sampling with 1000 replicates was used to assess the reproducibility of clades in the inferred phylogenies.

Preparation of barley and oat grain inoculum

Inocula of G. graminis var. tritici and R. solani AG-8 were prepared as described by Yang and colleagues (2011). Briefly, oat or barley grains (250 g) and water (350 ml) were combined in a flask and autoclaved on each of two consecutive days. Sterilized grains were inoculated with pieces of agar cut from 1/5 x PDA plates of R. solani or G. graminis var. tritici. After 21 days at room temperature, the colonized grains were tested for contamination, dried under a stream of sterile air and stored at 4°C. Prior to use, inoculum was fragmented and sieved into sizes, with particles of 0.25-0.5 mm added to soil.

Bacterial treatment of wheat seed

For biocontrol studies, seeds were coated with bacteria by methods similar to those of Yang and colleagues (2011). Strains were inoculated onto plates of KMB or TSA and incubated at room temperature for 24-48 h. Bacteria were scraped into 1.0 ml H2O, washed by centrifugation (twice for 3 min at 14 000 r.p.m.) and then suspended in H2O. The concentration of the cell suspension was adjusted based on optical density (600 nm), and an aliquot was mixed with a 2% solution of methylcellulose (MC) and deionized H2O. Wheat

(130 seeds) was added into the mixture, shaken for 3 min and seeds were dried under a stream of sterile air. To determine the final cfus per seed, 10 seeds were placed in a tube with 10 ml of sterile water, vortexed (1 min) and sonicated (1 min). Population size as determined by the end-point dilution assay ranged from 104 to 107 cfu seed-1.

Biocontrol activity of rhizobacteria

The biocontrol activity of strains was determined by several approaches, and against both Rhizoctonia root rot and takeall, in autoclaved, pasteurized (60°C, 30 min) and raw soil. For pot experiments, soil from a farm at Huazhong Agricultural University, Wuhan, China, was sieved, autoclaved and amended with barley grain inoculum of R. solani (1%, w/w). Each plastic pot (10 cm deep x 6 cm wide) was filled with a 5 cm-thick layer of sterile vermiculite followed by 8 g of infested soil. Four treated wheat seeds (cv. Yangmai 158) were sown on the surface of the soil and covered with a 1.5 cm layer of sterile vermiculite. Controls included: control 1 (CK1), soil not amended with inoculum and sown to non-treated seeds; control 2 (CK2), soil amended with inoculum and sown to seed coated with MC; and control 3 (CK3), soil amended with inoculum and sown to non-treated seed. Each pot was given 10 ml of 2.5 mg ml-1 metalaxyl (Syngenta Wilmington, DE, USA) to prevent Pythium damping-off. Pots were covered with a plastic sheet to reduce evaporation, incubated at room temperature (22°C) overnight and then transferred to a greenhouse (17 ± 5°C). The plastic was removed when the tips of the shoots were visible. Each pot was watered twice weekly with water and once with 1/3 x Hoagland's solution (macro-elements only). Treatments were replicated five times and arranged in a randomized complete block design; each pot served as a replicate. After 3 to 4 weeks, the seedlings were removed from the pots,

washed free of soil, and the plants were evaluated for disease severity on a scale of 0 to 8, where 0 = no lesions evident and 8 = seedling dead or nearly so (Huang etal., 2004). The length of the seedling shoot also was measured.

Biocontrol studies of Rhizoctonia root rot and take-all were also conducted using the tube assay as described by Yang and colleagues (2011) with pasteurized or raw Shano sandy loam (Quincy virgin) from a non-cropped site near Quincy, WA, USA. Plastic tubes (2.5 cm diameter, 16.5 cm long) with a hole in the bottom were hung in plastic racks (200 per rack). Each tube had a cotton ball placed in the bottom, followed by a 6.5 cm-thick column of sterile vermiculite, and then soil (10 g), with or without inoculum of R. solani at 1.0 % (w/w) or G. graminis var. tritici at 0.7% (w/w). A 1.5 cm-thick layer of vermiculite was placed over the infested soil, followed by three bacteria-treated wheat seeds (cv. Louise) and finally another 1.5 cm-thick topping of vermiculite. Each tube then received 10 ml of water with metalaxyl. Racks of tubes were covered with plastic sheets until shoots emerged and were incubated in a growth chamber (15-18°C; dark/light cycle 12 h). Each cone was watered twice weekly with water and once weekly with 1/3 x Hoagland's solution. Seedlings were harvested after 3-4 weeks and washed under a stream of water. The severity of Rhizoctonia root rot and take-all was evaluated on a scale of 0-8 (Yang etal., 2011).

Detection of IAA

IAA production was determined colorimetrically (Patten and Glick, 2002; Egamberdieva etal., 2008). Strains were incubated with shaking for 48 h at 28°C in KMB broth alone or supplemented with 500 |g per millilitre of tryptophan. Cultures were centrifuged at 13 000 r.p.m. for 10 min and a 1 ml aliquot of the supernatant was mixed vigorously with 4 ml of Salkowski reagent. The mixture was incubated at room temperature for 25 min and the absorbance of the pink colour was measured spectrophotometrically at 540 nm. The concentration of IAA was determined by using a calibration curve of pure IAA (0, 20, 40, 60, 80 and 100 |g ml-1) as a standard. Readings of < 1 |g ml-1 per OD600 unit were considered as negative for IAA production.

Growth on ACC as a sole nitrogen source

Strains were tested for ability to grow in a defined medium supplemented with ACC as a sole nitrogen source as described by Penrose and Glick (2003). Strains were first cultured in 3 ml of sterile DF salts minimal medium (pH 7.2): per litre, KH2PO4, 4.0 g; Na2HPO4, 6.0 g; MgSO4 7H2O, 0.2 g; glucose, 2.0 g; gluconic acid, 2.0 g; citric acid, 2.0 g; trace elements (FeSO4 7H2O, 1 mg; H3BO3, 10 |g; MnSO4 H2O, 11.19 |g; ZnSO4 7H2O, 124.6 |g; CuSO4 5H2O, 78.22 |g; MoO3, 10 | g); and (NH4)2 SO4, 2.0 g as a nitrogen source. After 72 h of shaking at 28oC, a 5 | l aliquot was transferred to 3 ml sterile DF salts medium with 3.0 mM ACC instead of (NH4)2 SO4 as the source of nitrogen. Pseudomonas brassicacearum Q8r1-96 was used as a positive control.

Canola root elongation assay

A gnotobiotic canola root elongation assay was used to determine the ability of strains to promote growth (Egamberdieva

etal., 2008). An aliquot of an overnight culture was centri-fuged, the cell pellet was washed twice and suspended in 1 ml of sterile 0.03 M MgSO4. The suspension was adjusted to an OD600 of 0.15. Surface-sterilized spring canola seeds (cv. InVigor 8440) were soaked for 1 h in 700 |l of a bacterial suspension. Depending on the isolate, the concentration ranged from 104 to 106cfu seed-1. Growth pouches were made using 1-gallon Ziploc plastic bags and sterile germination paper soaked with 50 ml of 1/5 x Hoagland's solution. Twenty-five seeds of a single bacterial treatment were distributed along the germination paper and the paper was placed inside of the bag. Individual bags were then hung vertically, covered with aluminium foil for 1-2 days and incubated at 20°C in a dark/light cycle of 12 h. The length of the primary roots was measured 5 days after sowing. Roots of seeds that failed to germinate 2 days after sowing were not measured. This study was conducted five times with three representative experiments shown.

Tolerance of bacteria to abiotic stress

The tolerance of selected strains to copper, cadmium and NaCl was determined in Luria-Bertani (LB) broth amended with CuCl2 to give concentrations from 3 to 6 mM; CdCl2 to give concentrations from 0.4 to 2.0 mM; and NaCl to give concentrations from 0% to 8%. Each well of a 96-well microplate was filled with 200 |l of LB supplemented with the heavy metal or salt solutions and inoculated with 2 |l of an overnight culture of each isolate (OD600 = 0.1). Each isolate at each concentration of heavy metal or salt was replicated eight times. The microplates were incubated at room temperature in the dark for 72 h and assayed spectrophotometrically at 600 nm using a model 680 microplate reader (Bio-Rad). An OD600 > 0.1 was scored as positive for growth. The MIC was defined as the lowest concentration that completely inhibited the growth of the isolate.

Statistical analysis

Comparisons of means of root disease ratings were performed using standard analysis of variance (ANOVA) followed by Kruskal-Wallis all pairwise comparisons (P< 0.05) (Statistix 8.1, Analytical Software, Tallahassee, FL, USA). Mean comparisons of plant height and root length among treatments were determined by ANOVA followed by using either the Fisher's protected least significant difference test (P = 0.05) or the Kruskal-Wallis all pairwise test (P = 0.05). Bacterial population sizes were log transformed before analysis.

Accession numbers

Nucleotide sequences were deposited in GeneBank under the following accession numbers: pltC, KC357589 through KC357592; prnD, KC693004 through KC693007; phlD, KC693000 through KC693003; acdS, KC430107 through KC430112; gyrB, KM030038 through KM030046; rpoD, KM030047 through KM030055; 16S rDNA, KM030056 through KM030064. The phzF sequence of strain KY5406 was deposited under accession number KC572125.

Acknowledgements

Mention of trade names or commercial products in this

publication is solely for the purpose of providing specific

information and does not imply recommendation or

endorsement by the U.S. Department of Agriculture.

USDA is an equal opportunity provider and employer.

Conflict of interest

None declared.

References

Achouak, W., Sutra, L., Heulin, T., Meyer, J.M., Fromin, N., Degraeve, S., et al. (2000) Pseudomonas brassicacearum sp. nov., and Pseudomonas thivervalensis sp. nov., two root-associated bacteria isolated from Brassica napus and Arabidopsis thaliana. Int J Syst Evol Micr 50: 9-18.

Altimira, F., Yanez, C., Bravo, G., Gonzalez, M., Rojas, L.A., and Seeger, M. (2012) Characterization of copper-resistant bacteria and bacterial communities from copper-polluted agricultural soils of central Chile. BMC Microbiol 12: 193.

Bais, H.P., Weir, T.L., Perry, L.G., Gilroy, S., and Vivanco, J.M. (2006) The role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Biol 57: 233-266.

Belimov, A.A., Safronova, V.I., Sergeyeva, T.A., Egorova, T.N., Matveyeva, V.A., Tsyganov, V.E., etal. (2001) Characterization of plant growth-promoting rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-1-carboxylate deaminase. Can Microbiol47: 642-652.

Belimov, A.A., Dodd, I.C., Safronova, V.I., Hontzeas, N., and Davies, W.J. (2007) Pseudomonas brassicacearum strain Am3 containing 1-aminocyclopropane-1-carboxylate deaminase can show both pathogenic and growth-promoting properties in its interaction with tomato. J Exp Bot 58: 1485-1495.

Blaha, D., Prigent-Combaret, C., Mirza, M.S., and Moenne-Loccoz, Y. (2006) Phylogeny of the 1-aminocyclopropane-1-carboxylic acid deaminase-encoding gene acdS in phyto-beneficial and pathogenic Proteobacteria and relation with strain biogeography. FEMS Microbiol Ecol56: 455-470.

Cai, Q., Long, M., Zhu, M., Zhou, Q., Zhang, L., and Liu, J. (2009) Food chain transfer of cadmium and lead to cattle in a lead-zinc smelter in Guizhou, China. Environ Pollut 157: 3078-3082.

Cheng, S. (2003a) Effect of heavy metal on plants and resistance mechanisms. Environ Sci Pollut R 10: 256-264.

Cheng, S. (2003b) Heavy metal pollution in China: origin, pattern and control. Environ Sci Pollut R 10: 192-198.

Cook, R.J., Schillinger, W.F., and Christensen, N.W. (2002) Rhizoctonia root rot and take-all of wheat in diverse direct-seed spring cropping systems. Can J Plant Pathol 24: 349-358.

De Souza, J.T., and Raaijmakers, J.M. (2003) Polymorphisms within the prnD and pltC genes from pyrrolnitrin and pyoluteorin-producing Pseudomonas and Burkholderia spp. FEMS Microbiol Ecol 43: 21-34.

Egamberdieva, D. (2011) Pseudomonas chlororaphis: a salt-tolerant bacterial inoculant for plant growth stimulation under saline soil condition. Acta Physiol Plant 34: 751-756.

Egamberdieva, D., and Kucharova, Z. (2009) Selection for root colonizing bacteria stimulating wheat growth in saline soils. Biol Fert Soils 45: 563-571.

Egamberdieva, D., Kamilova, F., Validov, S., Gafurova, L., Kucharova, Z., and Lugtenberg, B. (2008) High incidence of plant growth-stimulating bacteria associated with the rhizosphere of wheat grown on salinated soil in Uzbekistan. Environ Microbiol 10: 1-9.

Elmer, W.H. (2002) Influence of formononetin and NaCl on mycorrhizal colonization and fusarium crown and root rot of asparagus. Plant Dis 86: 1318-1324.

Ghose, T.K. (1987) Measurement of cellulase activities. Pure Appl Chem 59: 257-268.

Glick, B.R., Cheng, Z., Czarny, J., and Duan, J. (2007) Promotion of plant growth by ACC deaminase-producing soil bacteria. Eur J Plant Pathol 119: 329-339.

Gremion, F., Chatzinotas, A., Kaufmann, K., von Sigler, W., and Harms, H. (2004) Impacts of heavy metal contamination and phytoremediation on a microbial community during a twelve-month microcosm experiment. FEMS Microbiol Ecol 48: 273-283.

Guo, Y., Gao, Z.Y., Deng, Y.M., Ma, Z.Z., and Yan, S. (2011) Environmental geochemistry of abandoned flotation tailing reservoir from the Tonglvshan Fe-Cu sulfide mine in Daye, Central China. B Environ Contam Tox87: 91-95.

Haas, D., and Defago, G. (2005) Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol 3: 307-319.

Hartmann, A., Schmid, M., Tuinen, D., and Berg, G. (2009) Plant-driven selection of microbes. Plant Soil 321: 235257.

Huang, X.D., El-Alawai, Y., Gurska, J., Glick, B.R., and Greenberg, B.M. (2005) A multi-process phytoremediation system for decontamination of persistent total petroleum hydro-carbons (TPHs) from soils. Microchem J 81: 139147.

Huang, Z., Bonsall, R.F., Mavrodi, D.V., Weller, D.M., and Thomashow, L.S. (2004) Transformation of Pseudomonas fluorescens with genes for biosynthesis of phenazine-1-carboxylic acid improves biocontrol of Rhizoctonia root rot and in situ antibiotic production. FEMS Microbiol Ecol 49: 243-251.

Islam, M.T., Hashidoko, Y., Deora, A., Ito, T., and Tahara, S. (2005) Suppression of damping-off disease in host plants by the rhizoplane bacterium Lysobacter sp. strain SB-K88 is linked to plant colonization and antibiosis against soilborne Peronosporomycetes. Appl Environ Microbiol71: 3786-3796.

Jing, Y., He, Z., and Yang, X. (2007) Role of soil rhizobacteria in phytoremediation of heavy metal contaminated soils. J Zhejiang Univ Sci B 8: 192-207.

Jones, D.T., Taylor, W.R., and Thornton, J.M. (1992) The rapid generation of mutation data matrices from protein sequences. Computer Appl Biosci 8: 275-282.

Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111-120.

Kraus, J., and Loper, J.E. (1992) Lack of evidence for a role of antifungal metabolite production by Pseudomonas fluorescens Pf-5 in biological control of Pythium damping-off of cucumber. Phytopathology 82: 264-271.

Li, W.C., Ye, Z.H., and Wong, M.H. (2007) Effects of bacteria on enhanced metal uptake of the Cd/Zn-hyperaccumulating plant Sedum alfredii. J Exp Bot 58: 4173-4182.

Loper, J.E., Kobayashi, D.Y., and Paulsen, I.T. (2007) The genomic sequence of Pseudomonas fluorescens Pf-5: insights into biological control. Phytopathology 97: 233238.

Loper, J.E., Hassan, K.A., Mavrodi, D.V., Davis, E.W., Lim, C.K., Shaffer, B.T., etal. (2012) Comparative genomics of plant-associated Pseudomonas spp: insights into diversity and inheritance of traits involved in multitrophic interactions. PLoS Genet 8: e1002784.

Lugtenberg, B., and Kamilova, F. (2009) Plant-growth-promoting rhizobacteria. Annu Rev Microbiol 63: 541-556.

McSpadden Gardener, B.B.M., Mavrodi, D.V., Thomashow, L.S., and Weller, D.M. (2001) A rapid polymerase chain reaction-based assay characterizing rhizosphere population of 2,4-diacetylphloroglucinol-producing bacteria. Phytopathology 91: 44-54.

Mavrodi, D.V., Blankenfeldt, W., and Thomashow, L.S. (2006) Phenazine compounds in fluorescent Pseudomonas spp.: biosynthesis and regulation. Annu Rev Phytopathol 44: 417-445.

Mavrodi, D.V., Peever, T.L., Mavrodi, O.V., Parejko, J.A., Raaijmakers, J.M., Lemanceau, P., etal. (2010) Diversity and evolution of the phenazine biosynthesis pathway. Appl Environ Microbiol 76: 866-879.

Mavrodi, D.V., Mavrodi, O.V., Parejko, J.A., Bonsall, R.F., Kwak, Y.S., Paulitz, T.C., etal. (2012) Accumulation of the antibiotic phenazine-1-carboxylic acid in the rhizosphere of dryland cereals. Appl Environ Microbiol 78: 804-812.

Mazurier, S., Corberand, T., Lemanceau, P., and Raaijmakers, J.M. (2009) Phenazine antibiotics produced by fluorescent pseudomonads contribute to natural soil suppressiveness to Fusarium wilt. ISME J 3: 977-991.

Mittra, B., Ghosh, P., Henry, S.L., Mishra, J., Das, T.K., Ghosh, S., etal. (2004) Novel mode of resistance to Fusarium infection by a mild dose pre-exposure of cadmium in wheat. Plant Physiol Bioch 42: 781-787.

Mulet, M., Bennasar, A., Lalucat, J., and Garcia-Valdes, E. (2009) An rpoD-based PCR procedure for the identification of Pseudomonas species and for their detection in environmental samples. Mol Cell Probes 23: 140-147.

Mulet, M., Lalucat, J., and Garcia-Valdes, E. (2010) DNA sequence-based analysis of the Pseudomonas species. Environ Microbiol 12: 1513-1530.

Nakayama, T., Homma, Y., Hashidoko, Y., Mizutani, J., and Tahara, S. (1999) Possible role of xanthobaccins produced by Stenotrophomonas sp. strain SB-K88 in suppression of sugar beet damping-off disease. Appl Environ Microbiol 65: 4334-4339.

Nikolic, B., Schwab, H., and Sessitsch, A. (2011) Metagenomic analysis of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) operon of an uncultured bacterial endophyte colonizing Solanum tuberosum L. Arch Mirobiol 193: 665-676.

Parida, A.K., and Das, A.B. (2005) Salt tolerance and salinity effects on plants: a review. Ecotox Environ Safe 60: 324— 349.

Park, J.H., Kim, K., Aslam, Z., Jeon, C.O., and Chung, Y.R. (2008) Lysobacter capsicisp. nov., with antimicrobial activity, isolated from the rhizosphere of pepper, and emended description of the genus Lysobacter. Int J Syst Evol Microb 58: 387-392.

Patten, C.L., and Glick, B.R. (2002) Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Appl Environ Microbiol 68: 3795-3801.

Paulitz, T.C., Smiley, R.W., and Cook R.J. (2002) Insights into the prevalence and management of soilborne cereal pathogens under direct seeding in the Pacific Northwest, U.S.A. Can J Plant Path 24: 416-428.

Paulsen, I.T., Press, C., Ravel, J., Kobayashi, D.Y., Myers, G.S.A., Mavrodi, D.V., etal. (2005) Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5: insights into the biological control of plant disease. Nat Biotechnol 23: 873-878.

Penrose, D.M., and Glick, B.R. (2003) Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizobacteria. Physiol Plantarum 118: 10-15.

Pierson, L.S., and Thomashow, L.S. (1992) Cloning and heterologous expression of the phenazine biosynthetic locus form Pseudomonas aureofaciens 30-84. Mol Plant-Microbe In 5: 330-339.

Pieterse, C.M.J., Zamioudis, C., Berendsen, R.L., Weller, D.M., Van Wees, S.C.M., and Bakker, P.A.H.M. (2014) Induced systemic resistance by beneficial microbes. Annu Rev Microbiol 52: 347-375.

Poschenrieder, C., Tolra, R., and Barceló, J. (2006) Can metals defend plants against biotic stress? Trends Plant Sei 11: 288-295.

Powell, J.F., Vargas, J.M., Nair, M.G., Detweiler, A.R., and Chandra, A. (2000) Management of dollar spot on creeping bentgrass with metabolites of Pseudomonas aureofaciens (TX-1). Plant Dis 84: 19-24.

Ramette, A., Frapolli, M., Fischer-Le Saux, M., Gruffaz, C., Meyer, J.-M., Défago, G., etal. (2011) Pseudomonas protegens sp. nov., widespread plant-protecting bacteria producing the biocontrol compounds 2,4-diacetyl-phloroglucinol and pyoluteorin. Syst Appl Microbiol 34: 180-188.

Reed, M.L.E., and Glick, B.R. (2005) Growth of canola (Brassica napus) in the presence of plant growth-promoting bacteria and either copper or polycyclic aromatic hydrocarbons. Can J Microbiol 51: 1061-1069.

Ross, I.L., Alami, Y., Harvey, P.R., Achouak, W., and Ryder, M.H. (2000) Genetic diversity and biological control activity of novel species of closely related pseudomonads isolated from wheat field soils in South Australia. Appl Environ Microbiol 66: 1609-1616.

Roubtsova, T.V., and Bostock, R.M. (2009) Episodic abiotic stress as a potential contributing factor to onset and severity of disease caused by Phytophthora ramorum in Rhododendron and Viburnum. Plant Dis 93: 912-918.

Safronova, V.I., Stepanok, V.V., Engqvist, G.L., Alekseyev, Y.V., and Belimov, A.A. (2006) Root-associated bacteria containing 1-aminocyclopropane-1-carboxylate deaminase

improve growth and nutrient uptake by pea genotypes cultivated in cadmium supplemented soil. Biol Fert Soils 42: 267-272.

Sandaa, R.A., Torvik, V., Enger, 0., Daae, F.L., Castberg, T., and Hahn, D. (1999) Analysis of bacterial communities in heavy metal-contaminated soils at different levels of resolution. FEMS Microbiol Ecol 30: 237-251.

Shin, S.H., Lim, Y., Lee, S.E., Yang, N.W., and Rhee, J.H. (2011) CAS agar diffusion assay for the measurement of siderophores in biological fluids. Microbiol Meth 44: 89-95.

Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599.

Thomas, R., Mohamed, L., and Merroun, S.S. (2008) Interactions of Paenibacillus sp. and Sulfolobus acidocaldarius strains with U(VI). In Uranium, Mining and Hydrogeology. Merkel, B.J., and Haschne-Berger, A. (eds). Berlin, Germany: Springer, pp. 703-710.

Thomashow, L.S., and Weller, D.M. (1988) Role of a phenazine antibiotic from Pseudomonas fluorescens in biological control of Gaeumannomyces graminis var. tritici. J Bacteriol 170: 3499-3508.

Triky-Dotan, S., Yermiyahu, U., Katan, J., and Gamliel, A. (2005) Development of crown and root rot disease of tomato under irrigation with saline water. Phytopathology 95: 1438-1444.

Wei, B., and Yang, L. (2010) A review of heavy metal contaminations in urban soils, urban road dusts and agricultural soils from China. Microchem J 94: 99-107.

Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane, D.J. (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bact 173: 697-703.

Weller, D.M. (2007) Pseudomonas biocontrol agents of soilborne pathogens: Looking back over 30 years. Phytopathology 97: 250-256.

Weller, D.M., Landa, B.B., Mavrodi, O.V., Schroeder, K.L., De La Fuente, L., Blouin Bankhead, S., etal. (2007) Role of 2,4-diacetylphloroglucinol-producing fluorescent Pseudomonas spp. in the defense of plant roots. Plant Biol 9: 4-20.

Weller, D.M., Mavrodi, D.V., van Pelt, J.A., Pieterse, C.M., van Loon, L.C., and Bakker, P.A. (2012) Induced systemic resistance in Arabidopsis thaliana against Pseudomonas syringae pv. tomato by 2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens. Phytopathology 102: 403-412.

Yang, M., Mavrodi, D.V., Mavrodi, O.V., Bonsall, R.F., Parejko, J.A., Paulitz, T.C., etal. (2011) Biological control of take-all by fluorescent Pseudomonas spp. from Chinese wheat fields. Phytopathology 101: 1481-1491.

Zhao, B., and He, S. (2012) Microbiological Experiment. Beijing, China: Beijing Science Press.

Zhou, Y. (2013) Soil heavy metals and fluorine pollution and health. In Soil Pollution and Physical Health. Zhou, Y. (ed.). Beijing, China: China Environmental Science Press, pp. 132-194.

Supporting information

Additional Supporting Information may be found in the

online version of this article at the publisher's web-site:

Fig. S1. Neighbour-joining phylogeny inferred from concatenated housekeeping genes 16S, gyrB and rpoD. The concatenated housekeeping gene data set contained 2911 characters. Evolutionary distances were estimated using the Kimura two-parameter model of nucleotide substitution. Indels were ignored in the analysis and reproducibility of clades was assessed by bootstrap resampling with 1000 pseudoreplicates. The branch lengths are proportional to the amount of evolutionary change. The scale bars indicate substitution per site. Subgroups within the P. fluorescens lineage are defined according to Mulet and colleagues (2010). Fig. S2. Neighbour-joining phylogeny inferred from data for aligned 578-bp fragments of phlD sequences of fluorescent Pseudomonas spp. Indels were ignored in the analysis, and evolutionary distances were estimated using the Kimura two-parameter model of nucleotide substitution. Bootstrap values greater than 60% are indicated at the nodes, and the branch lengths are proportional to the amount of evolutionary change. Clades indicated by capital letters correspond to BOX-PCR genotypes of 2,4-diacetylphloroglucinol-producing Pseudomonas spp. as defined by De La Fuente and colleagues (2006).

Fig. S3. Neighbour-joining phylogeny inferred from data for aligned 390-bp fragments of pltC sequences of fluorescent Pseudomonas spp. Indels were ignored in the analysis, and evolutionary distances were estimated using the Kimura two-parameter model of nucleotide substitution. Bootstrap values greater than 60% are indicated at the nodes, and the branch lengths are proportional to the amount of evolutionary change.

Fig. S4. Neighbour-joining phylogeny inferred from data for aligned 745-bp fragments of prnD sequences of pyrrolnitrin-producing species. Indels were ignored in the analysis, and evolutionary distances were estimated using the Kimura two-parameter model of nucleotide substitution. Bootstrap values greater than 60% are indicated at the nodes, and the branch lengths are proportional to the amount of evolutionary change. Clades C1 through C2.4 correspond to distinct groups of pyrrolnitrin-producing bacteria as defined by Costa and colleagues (2009).

Fig. S5. Neighbour-joining phylogeny inferred from data for aligned 391-bp fragments of phzF sequences of fluorescent Pseudomonas spp. Indels were ignored in the analysis, and evolutionary distances were estimated using the Kimura two-parameter model of nucleotide substitution. Bootstrap values greater than 60% are indicated at the nodes, and the branch lengths are proportional to the amount of evolutionary change. Clades A1 through A5 correspond to distinct groups of phenazine-producing bacteria as defined by Mavrodi and colleagues (2010).

Fig. S6. Neighbour-joining phylogeny inferred from data for aligned 714-bp fragments of acdS sequences of ACC-deaminase-producing bacteria. Indels were ignored in the analysis, and evolutionary distances were estimated using the Kimura two-parameter model of nucleotide substitution. Bootstrap values greater than 60% are indicated at the nodes, and the branch lengths are proportional to the amount of evolutionary change. Clades A through C correspond to distinct groups of ACC-deaminase-producing bacteria as defined by Blaha and colleagues (2006).