0International Journal of Infectious Diseases (2008) 12, 30—36
CI CC\/ICD
http://intl.elsevierhealth.com/journals/ijid
Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients
Chariya Chomvarina *, Wises Namwata, Kunyaluk Chaicumpara, Pisaln Mairiangb, Apichat Sangchanb, Banchob Sripac, Siripen Tor-Udomd, Ratha-Khon Vilaichonee
a Department of Microbiology, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand b Department of Medicine, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand c Department of Pathology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand d Department of Microbiology and Immunology, Faculty of Medicine, Thammasat University, Pathumthani, Thailand e Gastroenterology Unit, Department of Medicine, Thammasat University Hospital, Pathumthani, Thailand
Received 24 August 2006; received in revised form 28 February 2007; accepted 5 March 2007 Corresponding Editor: Timothy Barkham, Singapore
KEYWORDS Summary
Helicobacter pylori; Objectives: To investigate the prevalence of the vacA, cagA, cagE, iceA, and babA2 genotypes in
prevalence; Helicobacter pylori strains isolated from Thai dyspeptic patients, and to determine whether any
vacA; correlation exists between these genotypes and clinical manifestations.
cagA; Methods: Helicobacter pylori was examined in 112 patients (62 with non-ulcer dyspepsia
cagE; (gastritis), 34 with peptic ulcer disease, and 16 with gastric cancer (GCA)), detected by culture
iceA; or direct detection from gastric biopsies. Allelic variants of the vacA, cagA, cagE, iceA, and babA2
babA2; genotypes were identified by using the polymerase chain reaction.
Thai dyspeptic patients Results: The positive rates for the vacAsl, vacAs2, cagA, cagE, iceAl, iceA2, and babA2 genes in
H. pylori of dyspeptic patients were 100%, 0%, 98.2%, 88.4%, 45.5%, 33.1%, and 92%, respectively. The allelic variant vacAslml was more prevalent (58%) than vacAs1m2 (42%). The cagA and cagE genes were commonly found together (87.5%). The most predominant genotypes were vacAslml, cagA, cagE, iceAl, and babA2. The various genes alone or in combination had no statistically significant association with the clinical outcomes (p > 0.05).
Conclusion: Neither single gene nor combination of vacA, cagA, cagE, iceA, and babA2 genes was significantly helpful in predicting the clinical outcome of H. pylori infection in Thai patients. The high prevalence of these genes in H. pylori isolated from Thai patient groups suggests that H. pylori strains are geographically dependent.
© 2007 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
* Corresponding author. Tel.: +66 43 363808; fax: +66 43 348385. E-mail address: chariya@kku.ac.th (C. Chomvarin).
1201-9712/$32.00 © 2007 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijid.2007.03.012
Introduction
Helicobacter pylori is considered an important etiological agent in the development of gastritis, peptic ulcers and gastric carcinoma.1,2 The occurrence of such diverse diseases with H. pylori may depend on specific properties of the organism, host genetic factors, and environmental factors.3 Although more than 50% of the world's population is infected with H. pylori, a minority of carriers develop serious gastrointestinal diseases;3"5 however, increasing evidence suggests that the genetic variability of H. pylori may itself be of clinical importance.3"7 Several putative genes, such as vacA, cagA, cagE, iceA and babA, have been identified and may play important roles in the pathogenesis of H. pylori infection.8"10
The vacuolating cytotoxin gene (vacA) is present in all H. pylori strains.4 The vacA genotype comprises a hypervariable signal sequence and a middle region allele. The vacA subtypes are determined by the combination of s1a, sib, sic and s2, and mi, m2a and m2b.4,11 Although all strains of H. pylori contain the vacA gene, they vary in terms of their ability to produce cytotoxin. Type m1 strains demonstrate more toxic activity than m2, type s1a is more active than s1b, and type s2 is less active than s1.6'12
The cytotoxin associated gene A (cagA) has been proposed as a marker for a genomic pathogenicity island (cag-PAl) of approximately 40 kbp whose presence is associated with more severe clinical outcomes.13'14 The cagA-positive H. pylori strains are known to induce interleukin-8 (IL-8) production and mucosal inflammation.13,14 Other members of cag-PAl have also been evaluated for their involvement in virulence, and cagE is one of the marker genes in cagl of the cag-PAl. It is essential for cagA translocation and phosphorylation.15,16 The presence of the cagE gene has also been associated with a more severe clinical outcome.17
The induced by contact with epithelium (iceA) gene has recently been discovered. The two main allelic variants of the gene are iceA1 and iceA2. The expression of iceA1 is up-regulated on contact between H. pylori and human epithelial cells, and may be associated with peptic ulcer disease.7,18,19 The blood group antigen-binding adhesin gene (babA) is involved in the binding activity between bacterial adhesin and human Lewis-b blood group antigens on gastric epithelial cells.20 Although three bab alleles have been identified (babA1, babA2, babB), only the babA2 gene product is necessary for Lewis-b binding activity. Several researchers suggest that the presence of babA2 is related to the occurrence of peptic ulcers and gastric cancer.20,21
In Thailand, an average 48% of dyspeptic patients are infected with H. pylori, but a higher prevalence has been found in gastric ulcer patients and peptic ulcer patients than in gastritis patients.22"24 Some virulence-related gene products such as VacA and CagA in the isolated strains have been studied;25,26 however, the involvement of H. pylori genotypes in specific diseases remains controversial.8,9,21,27 A mainstream challenge for researchers to identify the particular H. pylori genes, including vacA, cagA, cagE, iceA, and babA2, has been elucidated;9 however, no study in Thailand has simultaneously investigated the prevalence and relationship to clinical outcomes of these putative genes. To understand the clinical relevance of H. pylori genotyping in predicting infection outcomes, and H. pylori genes in differ-
ent geographical regions for the basic knowledge of Thai dyspeptic patients, we investigated the prevalence of vacA, cagA, cagE, iceA, and babA2 genes of H. pylori obtained from 112 Thai patients with gastritis, peptic ulcers, and gastric cancer. The correlation between the genetic status of the isolates and the occurrence of gastrointestinal diseases was assessed.
Materials and methods Patients
Gastric biopsies and H. pylori isolates were obtained from 112 patients who had undergone routine endoscopy for symptoms of dyspepsia at the hospitals in central and northeast Thailand. We included 34 patients with peptic ulcer disease (PUD; 20 with gastric ulcers (GU), 14 with duodenal ulcers (DU)), 62 with non-ulcer dyspepsia or gastritis (GT), and 16 with gastric cancer (GCA). The patients were 55 males and 57 females with an age range of 18 to 88 years (mean 49.5 years).
The study was approved by the ethics committee of Khon Kaen University and performed in accordance with the Declaration of Helsinki. Informed consent was obtained from each patient prior to entering the study.
Clinical samples and culture
Three gastric mucosal biopsy specimens from the antrum and corpus were obtained from each patient and divided into three parts. Both antral and corpus specimens were used for culture, the rapid urease test (RUT), and histological examination.
Culture was performed according to the method of Hazell,28 with modifications. Briefly, each antral and corpus specimen was immediately placed into Stuart's transport medium and brought to the laboratory within 2 h at 4 °C. Each of the biopsy specimens was homogenized separately in 200 ml of normal saline and cultured on 7% human blood agar (Difco, Detroit, MI, USA) and brain heart infusion agar (Difco) containing the supplement SR147 (5 mg/l trimethoprim, 10mg/l vancomycin, 5 mg/l amphotericin B, 5 mg/l cefsu-lodin (SR147, OXOID, Unipath Ltd, Basingstoke, UK)). The plates were incubated at 37 °C under microaerophilic conditions (5% O2, 10% CO2, 85% N2) and were examined after 4 and 7 days of incubation. Characteristic colonies of H. pylori were confirmed by Gram staining, oxidase, catalase and urease tests. The H. pylori colonies were further used for DNA extraction.
Commercial rapid urease test (RUT, Pronto Dry test)
The RUT was performed according to the manufacturer's instructions (Medical Instruments Corp., Solothurn, Switzerland). Briefly, one antral and one corpus specimen together were directly inoculated onto the commercial RUT agar gel. The results were observed and recorded within 24 hours. A positive RUT was indicated when the color changed from yellow to pink. The positive RUTs were used for chromosomal DNA extraction if the culture was negative.
Genomic DNA extraction
DNA from 30 H. pylori isolates and 82 of each antrum and corpus gastric biopsy positive by the RUT, were extracted using the genomic DNA purification kit (Puregene, Gentra Systems, USA), according to the manufacturer's instructions. Briefly, a loop full of cell culture or the gastric biopsy samples (obtained from the urease test agar assay homogenized with 200 ml of normal saline) were incubated with 450 ml cell lysis solution and 2.5 ml proteinase K solution for 3 h at 55 °C. The lysate was incubated at 98 °C for 10 min and then 2.5 ml RNase A solution was added to the cell lysate and incubated at 37 °C for 60 min. Then, 200 ml protein precipitation solution was added and centrifuged at 13 000 g for 3 min. The supernatant was collected and 400 ml of 100% isopropanol was added and centrifuged at 13 000 g for 5 min. The supernatant was carefully discarded. Then, 300 ml of 70% ethanol was added to the pellet and centrifuged. The ethanol was poured off and left to dry for 3 h. Then, 50 ml DNA hydration solution was added and incubated for 1 h at 65 °C. DNA was stored at -20 °C until used.
PCR assays for glmM gene and virulence genes (vacA, cagA, cagE, iceA, babA2)
Each PCRof glmM, vacA, cagA, cagE, iceA, and babA2 was performed in a total volume of 50 ml containing 100 ng genomic DNA from H. pylori culture or 400 ng genomic DNA from gastric biopsies in which the RUT was positive, 200 mM each of dNTP (Gibco BRL, USA), 1 x PCR buffer (20 mM Tris-HCl, pH 8.4), 50 mM KCl, 1.5 mM MgCl2 (2 mM MgCl2 for cagA), 0.5 mM of each primer (0.2 mMfor babA2and 0.3 mMfor cagA), and 1.5 units of Taq polymerase (Gibco BRL, USA). For each batch of PCR assay, distilled water instead of the genomic DNA templates was used as a negative control.
The reaction mixtures were cycled in an automated thermal cycler (GeneAmp, PCR 2400, Perkin-Elmer, USA) under the conditions shown in Table 1. After amplification, 10 ml of PCR product was electrophoresed on 1.5—2% agarose gel, stained with ethidium bromide, and examined under UV illuminator.
Data analysis
Fisher's exact test or the Chi-square test was used for analysis of categorical data. A p-value of <0.05 was considered statistically significant.
Results
Primer sequences, sizes, and conditions of PCR amplifications of the glmM gene29 — for detection and confirmation of H. pylori — and the virulence genes (i.e., vacA,30,31 cagA,32 cagE,16 iceA7 and babA233), were designed based on published papers with a modification of PCR mixtures and PCR conditions (Table 1).
Helicobacter pylori-infected patients were evaluated for the relation of age, gender, and ethnic group with the severity of disease as shown in Table 2. The severity of disease was diagnosed by endoscopic findings and a pathologist. The results show that there was no significant difference among these parameters with regard to the gastroduodenal patient
Table 1 Primer sequence and PCR conditions
Primer sequence (5' ! 3')
PCR product (bp)
PCR conditions
References
glmM AAGCIIIIAGGGGIGIIAGGGGIII 294 93 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35 cycles) 29
AAGCTTACTTTCTAACACTMCGC
s1/s2 ATGGAAATACAACAAACACAC 259/286 94 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min (35 cycles) 12,30
CTGCTTGAATGCGCCAAAC
s1a GTCAGCATCACACCGCAAC 190 94 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min (35 cycles) 30
CTGCTTGAATGCGCCAAAC
sib AGCGCCATACCGCAAGAG 187 94 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min (35 cycles) 30
CTGCTTGAATGCGCCAAAC
sic CTCTCGCTTTAGTGGGGYT 213 94 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min (35 cycles) 31
CTGCTTGAATGCGCCAAAC
m1/m2 CAATCTGTCCAATCAAGCGAG 567/642 94 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min (35 cycles) 30
GCGTCAAAATAATTCCAAGG
cagA ATAATGCTAAATTAGACAACTTGAGCGA 298 94 °C, 1 min; 60 °C, 1 min; 72 °C, 1 min (45 cycles) 32
TTAGAATAATCAACAAACATCACGCCAT
cagE TTGAAAACTTCAAGGATAGGATAGAGC 508 94 °C, 1 min; 53 °C, 45 s; 72 °C, 45 s (35 cycles) 16
GCCTAGCGTAATATCACCATTACCC
iceAi GTGTTTTTAACCAAAGTATC 247 95 °C 1 min; 57 ° 'C, 1 s; 72 °C, 1 min (35 cycles) 7
CTATAGCCATTATCTTTGCA
iceA2 GTTGGGTATATCACAATTTAT 229 95 °C 1 min; 57 ° 'C, 1 s; 72 °C, 1 min (35 cycles) 7
TTTCCCTATTTTCTAGTAGGT
babA2 CCAAACGAAACAAAAAGCGT 271 94 °C, 1 min; 45 °C, 1 min; 72 °C, 1 min (30 cycles) 33
GCTTGTGTAAAAGCCGTCGT
Table 2 Distribution of 112 patients with different clinical outcomes, according to age, gender and ethnic group
Clinical status Total (%)
Non-ulcer GT1 (%) (N = 62) Peptic ulcer GCAd (%) (N =16)
GUb (%) (N = 20) DUc (%) (N = 14)
Age (years)
<20 0(0) 0(0) 2 (14.3) 0 (0) 2 (1.8)
21—40 16 (25.8) 4 (20) 3 (21.4) 0 (0) 23 (20.5)
41—60 36 (58.1) 11 (55) 6 (42.9) 7 (43.7) 60 (53.6)
>60 10 (16.1) 5 (25) 3 (21.4) 9 (56.3) 27 (24.1)
Gender
Male (M) 28 (45.2) 11 (55) 9 (64.3) 7 (43.7) 55 (49.1)
Female (F) 34 (54.8) 9 (45) 5 (35.7) 9 (56.3) 57 (50.9)
M:F 1:1.2 1:0.8 1:0.6 1:1.3 1:1
Ethnic group
Thai 41 (66.1) 12 (60) 7(50) 8 (50) 68 (60.7)
Thai-Chinese 15 (24.2) 6(30) 5 (35.7) 6 (37.5) 32 (28.6)
Chinese 5(8.1) 2(10) 2 (14.3) 2 (12.5) 11 (9.8)
Loa-Loa 1 (1.6) 0(0) 0(0) 0(0) 1 (0.9)
a Helicobacter pylori-infected gastritis patients.
b Helicobacter pylori-infected gastric ulcer patients.
c Helicobacter pylori-infected duodenal ulcer patients.
d Helicobacter pylori-infected gastric cancer patients.
groups. Nevertheless, the age groups of 41—60 years and >60 years had an increased rate of gastric cancer disease (Table 2).
The presence of the vacA, cagA, cagE, iceA, and babA2 genes was examined in all 112 of the H. pylori-infected patients with gastrointestinal diseases. All vacA genes were the s1 signal sequence allele (100%). The vacA m1 allele and m2 allele were found in 65 (58%) and 47 (42%) of the samples. There was no statistical association between vacAs1m1 and vacAs1m2 and clinical outcome, though the frequency of the vacAs1m1 allele (64.3%) was higher than the vacAs1m2 allele (35.7%) in the duodenal ulcer patients (p > 0.05) (Table 3).
For detection of vacAs1 subtypes, we did not have sufficient template DNA extracted from all of the gastric biopsies used for detecting several of the genes; we only checked 68 samples (38 gastric biopsies and 30 H. pylori isolates) of the 112 H. pylori-infected patients for the vacAs1 (a, b, c) subtypes. The results showed that vacAs1c was the predominant genotype in our study albeit there was no significant difference between the gastroduodenal diseases groups (data not shown).
The cagA gene was detected in 98.2% (110/112) of the H. pylori-infected patients. Of the 112 H. pylori-infected patients, only two (1.8%) showed an absence of cagA, and those samples were obtained from patients with gastritis. The cagE gene was detected in 88.4% (99/112) of the H. pylori-infected patients and was common in all of the patient groups, similarly to cagA. cagE was found more commonly in patients with gastric cancer than in the other patient groups (93.8%; 15/16). The combination of the cagA and cagE gene was detected in 87.5% (98/112) of the patients (Table 3).
The iceA gene was detected in 78.5% (88/112) of the H. pylori-infected patients. Of the 88 H. pylori-infected
patients, iceA1 and iceA2 were detected in 45.5% (51/112) and 33.1% (37/112), respectively. iceA1 was most commonly found in the duodenal ulcer patients (57.1%; 8/14), whereas iceA2 was most commonly found in the gastric ulcer patients (40%; 8/20). The iceA-negative strain, in which neither iceA1 nor iceA2 was detected, was found in 21.4% of the 112 H. pylori strains. This finding is similar to that reported by Han et al.34
The babA2 gene was detected in 92% (103/112) of the H. pylori-infected patients. The babA2 gene was commonly found in all patient groups; however, there was no statistically significant difference in each of the individual genes among the patient groups (p > 0.05) (Table 3).
The frequency distributions of the combination genotypes of H. pylori are presented in Table 4. The four major genotypes found were: (1) vacAs1m1, cagA, cagE, iceA1, and babA2 (22.3%); (2) vacAs1m2, cagA, cagE, iceA1, and babA2 (16.1%); (3) vacAs1m1, cagA, cagE, iceA2, and babA2 (15.2%); and (4) vacAs1m2, cagA, cagE, iceA2, and babA2 (11.6%). No significant difference was found among the patient groups (p > 0.05) (Table 4).
Discussion
The clinical relevance of the putative virulence-associated genes of H. pylori and geographical region is still a matter of controversy. The present study reported the relationship between some virulence genes (vacA, cagA, cagE, iceA, babA) of H. pylori and the clinical status among Thai patients.
All strains of H. pylori contain the vacA gene, but they vary in terms of their ability to produce cytotoxin.9 Type s1 and m1 strains demonstrate more toxin activity than s2 and m2 strains.1'12'26'35 In Western studies, the presence of vacAs1
Table 3 The vacA, cagA, cagE, iceA, babA2 status of H. pylori strains obtained from 112 patients with different clinical outcomes Genotypes Clinical status Total (%)
Non-ulcer GT (%) (N = 62) Peptic ulcer GCAd (%) (N =16)
GUb (%) (N = 20) DUc (%) (N =14)
slml 36 (58.1) 12 (60)
s1m2 26 (41.9) 8 (40)
Positive 60 (96.8) 20 (100)
Negative 2 (3.2) 0 (0)
Positive 54 (87.1) 18 (90)
Negative 8 (12.9) 2 (10)
iceA1 29 (46.8) 7 (35)
iceA2 19 (30.6) 8 (40)
iceA- 14 (22.6) 5 (25)
Positive 57 (91.9) 17 (85)
Negative 5(8.1) 3(15)
cagA, cagE 53 (85.5) 18 (90)
9 (64.3) 8 (50) 65 (58)
5 (35.7) 8 (50) 47 (42)
14 (100) 16 (100) 110 (98.2)
0(0) 0(0) 2(1.8)
12 (85.7) 15 (93.8) 99 (88.4)
2(14.3) 1(6.2) 13(11.6)
8 (57.1) 7 (43.7) 51 (45.5)
4 (28.6) 6 (37.5) 37 (33.0)
2(14.3) 3(18.8) 24(21.5)
14 (100) 15 (93.8) 103 (92)
0 (0) 1 (6.2) 9 (8)
12 (85.7) 15 (93.8) 98 (87.5)
a Helicobacter pylori-infected gastritis patients. b Helicobacter pylori-infected gastric ulcer patients. c Helicobacter pylori-infected duodenal ulcer patients. d Helicobacter pylori-infected gastric cancer patients.
and cagA has been shown to be significantly associated with peptic ulcers.1,10 However, several studies in Asian populations have not confirmed this relationship, indicating that there are important geographic differences.19,27,36 All vacA genotypes from our 112 H. pylori-infected dyspeptic patients contained the s1 signal region while 58% and 42% of H. pylori strains possessed the m1 and m2 middle region, respectively. Our results are in agreement with previous reports that show a predominance of s1 in Asian populations; the s1 and m1 were predominant among the vacA subtype of H. pylori strains.19,37 The cagA-positive vacAs1c-m1 and iceA1 have been shown to be predominant in Japan and Korea,16,20 while Qiao et al.30 reported that type s1 of vacA is more common than type s2, and m1 and m2 are equally represented in the Xi'an area of China.
The cagA gene has been shown to be present in about 60—70% of H. pylori strains isolated from Western populations including those of Europe and America.6,9,10 H. pylori cagA-positive strains have been reported to be associated with more severe H. pylori disease such as gastric mucosal atrophy and gastric cancer.9,32,38 In this study, cagA was found in 98.2% of H. pylori-infected dyspeptic patients. This prevalence is similar to that reported by others, who have shown cagA-positive H. pylori in more than 90% of cases in East Asian countries, and no association with severity of disease.37,39 There was no significant association between either the vacA subtype or cagA gene and severity of gastroduodenal dis-eases.37,39 However, recent studies have reported the importance of the diversity of CagA in relation to gastrointestinal
diseases. They have indicated that the diversity of the tyrosine CagA phosphorylation occurs at the unique Glu— Prol—Ile—Ala (EPIYA) motifs present in the C-terminal region, affected by protein-tyrosine phosphatase (SHP-2), and actively involved in the regulation of the spreading, migration, and adhesion of cells. It may induce abnormal proliferation and movement of gastric epithelial cells and be associated with the mortality rate of gastric cancer in Asia.40 These findings should be further studied in H. pylori cagA-positive strains isolated from Thai dyspeptic patients in the future.
The cagE gene, also within the pathogenicity island and shown to stimulate production of several cytokines from infected epithelial cells, was found in 88.4% of H. pylori and 87.5% of cagA-positive H. pylori in this study. This result corresponds to those found in a previous report on children in the USA;9 however, we found that when cagA was positive, cagE was negativein 10.7% of samples (12/112), whereas only one sample was cagE-positive and cagA-negative.
The iceA gene may be associated with peptic ulcer dis-ease;9,18 however, some studies have failed to confirm this correlation, and some groups have suggested a reverse rela-tionship.19 There are two distinct allelic variants of iceA, namely iceA1 and iceA2.7,19,37 One study has suggested that iceA1 is associated with the development of peptic ulcers, and that iceA1-positive strains produce more of the proinflammatory factor IL-8 than iceA1-negative strains.41 Peek et al.18 demonstrated that iceA1 expression is significantly related to the host mucosal response, which led to the
Table 4 Frequency distribution of combination genotypes of 112 H. pylori in the gastrointestinal dyspeptic patients
Combination genotypes
Clinical status
Non-ulcer GTa (%) (N = 62)
Peptic ulcer
GUb (%) (N = 20) DUc (%) (N =14)
GCAd (%) (N =16)
Total (%)
vacAs1m1, cagA, cagE, iceA1, babA2 13 (21)
vacAs1m2, cagA, cagE, iceA1, babA2 11 (17.7)
vacAs1m1, cagA, cagE, iceA2, babA2 11 (17.7)
vacAs1m2, cagA, cagE, iceA2, babA2 4 (6.5)
Others Total
23 (37.1) 62 (100)
4 (20) 2(10) 1 (5)
5 (25)
8 (40) 20 (100)
5 (35.7) 2 (14.3)
1 (7.1)
2 (14.3)
4 (28.6) 14 (100)
3 (18.8)
3 (18.8)
4 (25)
2 (12.5)
4 (25) 16 (100)
25 (22.3) 18 (16.1) 17 (15.2) 13 (11.6)
39 (34.8) 112 (100)
a Helicobacter pylori-infected gastritis patients. b Helicobacter pylori-infected gastric ulcer patients. c Helicobacter pylori-infected duodenal ulcer patients. d Helicobacter pylori-infected gastric cancer patients.
hypothesis that the levels of transcription within the host environment may contribute to disease development. In contrast, iceA2 expression may be more influenced by gene structure, which has a repeated protein structure but it does not have homology with known proteins. Indeed, our H. pylori study of the iceA allele demonstrated that iceA1 (45.5%) was the most frequent genotype detected in our population. This finding agrees with previous reports that have shown the iceA1 allele more frequently found than the iceA2 allele in Chinese, Japanese, Korean and Dutch patients;7'19'34'37 iceA2 has been found to be predominant among Brazilian, European and American patients.9,19,42
The babA2 gene has been shown to be associated with a higher risk of ulcer or adenocarcinoma development, and has been strongly associated with vacAs1 (79% babA2-positive) and cagA genotypes (80% babA2-positive) in German adults.21 H. pylori with triple positive genotypes, vacAs1, cagA and babA2, has been reported in only 31% of dyspeptic children with H. pylori infection.10 A previous study showed that H. pylori strains carrying babA2, cagA, and vacAs1m1 genotype were associated with the highest risk of developing intestinal metaplasia.27 We, however, did not find any specific disease association between H. pylori genotype and the clinical outcome of infection, even though all of our H. pylori had vacAs1, 92% babA2 and 98% cagA. Our results agree with Kim et al.,37 who did not find any association with cagA, vacA subtype, iceA1 and babA of H. pylori isolates from Korean patients, and Han et al.34 who also did not find any association with iceA1 and babA2 of H. pylori isolates from Shanghai patients.
Several factors involved in the pathogenesis of H. pylori have been studied, including bacterial genotypes.1,7,9,10 We found a high prevalence of vacAs1, cagA, cagE, iceA and babA2 in our H. pylori-infected dyspeptic patients in accord with research in other East Asian countries,19,30,37 and no significant difference was found between the various genes and severity of diseases.
Past studies have reported high incidences of gastric cancer among Japanese and Chinese people and very low incidences in the Thai and Vietnamese populations.43 In fact, we found no significant difference between the various genes and severity of diseases, indicating that the presence of cagA or subtypes of vacA cannot serve as real virulence markers for
the development of gastric cancer, as was found in Japan and Korea.
In conclusion, this is the first report of the high prevalence of H. pylori virulence genes in Thai dyspeptic patients. There was no significant difference in any one specific bacterial gene and the gene pattern being associated with a particular clinical outcome. It is therefore necessary to define both the environmental and host factors in association with the bacterial characteristics for use in the prediction of the severity of disease.
Acknowledgements
This research was supported by Khon Kaen University, Thailand. We would like to thank the staff of the endoscopy unit for their kind help with specimen collection and Mr Bryan Roderick Hamman for assistance with the English language. Conflict of interest: No conflict of interest to declare.
References
1. Atherton JC. The clinical relevance of strain types of Helicobacter pylori. Gut 1997;40:701-3.
2. De Luca A, laquinto G. Helicobacter pylori and gastric diseases: a dangerous association. Cancer Lett 2004;213:1-10.
3. Nguyen TN, Barkun AN, Fallone CA. Host determinants of Heli-cobacter pylori infection and its clinical outcome. Helicobacter 1999;4:185-97.
4. Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev 1997;10:720-41.
5. Hopkins RJ, Morris Jr JG. Helicobacter pylori: the missing link in perspective. Am J Med 1994;97:265-77.
6. Rudi J, Kolb C, Maiwald M, Kuck D, Sieg A, Galle PR, et al. Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases. J Clin Microbiol 1998;36: 944-8.
7. van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, Quint W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998; 115: 58-66.
8. Nogueira C, Figueiredo C, Carneiro F, Gomes AT, Barreira R, Figueira P, et al. Helicobacter pylori genotypes may determine gastric histopathology. Am J Pathol 2001;158:647-54.
9. Podzorski RP, Podzorski DS, Wuerth A, Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn Microbiol Infect Dis 2003;46:83-8.
10. RibeiroML, GodoyAP, BenvengoYH, MendoncaS, Pedrazzoli Jr J. Clinical relevance of the cagA, vacA and iceA genotypes of Helicobacter pylori in Brazilian clinical isolates. FEMS Immunol Med Microbiol 2003;36:181-5.
11. van Doorn LJ, Figueiredo C, Sanna R, Pena S, Midolo P, Ng EK, et al. Expanding allelic diversity of Helicobacter pylori vacA. J Clin Microbiol 1998;36:2597-603.
12. Atherton JC, Cao P, Peek Jr RM, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem 1995;270:17771-7.
13. Atherton JC. CagA: a role at last. Gut 2000;47:330-1.
14. Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH, et al. Infection with Helicobacter pylori strains possessing cagA is associated with an increased riskof developing adenocarcinoma of the stomach. Cancer Res 1995;55:2111-5.
15. Day AS, Jones NL, Lynett JT, Jennings HA, Fallone CA, Beech R, et al. cagE is a virulence factor associated with Helicobacter pylori-induced duodenal ulceration in children. J Infect Dis 2000;181:1370-5.
16. Tomasini ML, Zanussi S, Sozzi M, Tedeschi R, Basaglia G, De Paoli P. Heterogeneity of cag genotypes in Helicobacter pylori isolates from human biopsy specimens. J Clin Microbiol 2003;41:976-80.
17. Fallone CA, Barkun AN, Gottke MU, Beech RN. A review of the possible bacterial determinants of clinical outcome in Helico-bacter pylori infection. Can J Microbiol 1998;44:201-10.
18. Peek Jr RM, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ, et al. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc Assoc Am Physicians 1998; 110:53144.
19. Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol 1999;37:2274-9.
20. IlverD, Arnqvist A, Ogren J, FrickIM, KersulyteD, IncecikET, etal. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science 1998;279:373-7.
21. GerhardM, LehnN, NeumayerN, BorenT, Rad R, ScheppW, etal. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc Natl Acad Sci USA 1999;96:12778-83.
22. Atisook K, Kachinthorn U, Luengrojanakul P, Tanwandee T, Pak-diratP, Puapairoj A. Histology of gastritis and Helicobacter pylori infection in Thailand: a nationwide study of 3776 cases. Helicobacter 2003; 8:132-41.
23. Chomvarin C, Kulsuntiwong P, Mairiang P, Sangchan A, Kulabkhow C, Chau-in S, et al. Detection of H. pylori in dyspeptic patients and correlation with clinical outcomes. Southeast Asian J Trop Med Public Health 2005;36:917-22.
24. Mitipat N, Siripermpool P, Jadwattanakul T, Chaunthongkum S. The prevalence of Helicobacter pylori infection in patients with gastrointestinal symptoms in Chon Buri, Thailand. Southeast Asian J Trop Med Public Health 2005;36:341-6.
25. Mahachai V, Tangkijvanich P, Wannachai N, Sumpathanukul P, Kullavanijaya P. CagA and VacA: virulence factors of Helicobacter pylori in Thai patients with gastroduodenal diseases. Helicobac-ter 1999;4:143-7.
26. Vivatvakin B, Theamboonlers A, Semakachorn N, Wongsawadi L. Prevalence of cagA and vacA genotype of Helicobacter pylori in Thai children. J Med Assoc Thai 2004;87:1327-31.
27. Hocker M, Hohenberger P. Helicobacter pylori virulence factors-one part of a big picture. Lancet 2003;362:1231-3.
28. Hazell SL, Markesich DC, Evans DJ, Evans DG, Graham DY. Influence of media supplements on growth and survival of Campylobacter pylori. Eur J Clin Microbiol Infect Dis 1989;8:597-602.
29. Lu JJ, Perng CL, Shyu RY, Chen CH, Lou Q, Chong SK, et al. Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol 1999;37:772-4.
30. Qiao W, Hu JL, Xiao B, Wu KC, Peng DR, Atherton JC, et al. cagA and vacA genotype of Helicobacter pylori associated with gastric diseases in Xi'an area. World J Gastroenterol 2003; 9:17626.
31. Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol 2005;43:3906-16.
32. Hamlet A, Thoreson AC, Nilsson O, Svennerholm AM, Olbe L. Duodenal Helicobacter pylori infection differs in cagA genotype between asymptomatic subjects and patients with duodenal ulcers. Gastroenterology 1999;116:259-68.
33. Sheu BS, Sheu SM, Yang HB, Huang AH, Wu JJ. Host gastric Lewis expression determines the bacterial density of Helicobacter pylori in babA2 genopositive infection. Gut 2003;52:927-32.
34. Han YH, Liu WZ, Zhu HY, Xiao SD. Clinical relevance of iceA and babA2 genotypes of Helicobacter pylori in a Shanghai population. Chin J Dig Dis 2004;5:181-5.
35. Ashour AA, Magalhaes PP, Mendes EN, Collares GB, de Gusmao VR, Queiroz DM, et al. Distribution of vacA genotypes in Heli-cobacter pylori strains isolated from Brazilian adult patients with gastritis, duodenal ulcer or gastric carcinoma. FEMS Immunol Med Microbiol 2002;33:173-8.
36. Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rappuoli R. Helicobacter pylori virulence and genetic geography. Science 1999;284:1328-33.
37. Kim SY, Woo CW, Lee YM, Son BR, Kim JW, Chae HB, et al. Genotyping cagA, vacA subtype, iceA1, and babA of Helicobacter pylori isolates from Korean patients, and their association with gastroduodenal diseases. J Korean Med Sci 2001;16:579-84.
38. Andreson H, Loivukene K, Sillakivi T, Maaroos HI, Ustav M, Peetsalu A, et al. Association of cagA and vacA genotypes of Helicobacter pylori with gastric diseases in Estonia. J Clin Microbiol 2002;40:298-300.
39. Maeda S, Ogura K, Yoshida H, Kanai F, Ikenoue T, Kato N, et al. Major virulence factors, VacA and CagA, are commonly positive in Helicobacter pylori isolates in Japan. Gut 1998;42: 338-43.
40. Azuma T, Yamakawa A, Yamazaki S, Ohtani M, Ito Y, Muramatsu A, et al. Distinct diversity of the cag pathogenicity island among Helicobacter pylori strains in Japan. J Clin Microbiol 2004;42: 2508-17.
41. Xu Q, Blaser MJ. Promoters of the CATG-specific methyltransfer-ase gene hpyIM differ between iceA1 and iceA2 Helicobacter pylori strains. J Bacteriol 2001;183:3875-84.
42. Ashour AA, Collares GB, Mendes EN, de Gusmao VR, Queiroz DM, Magalhaes PP, et al. iceA genotypes of Helicobacter pylori strains isolated from Brazilian children and adults. J Clin Microbiol 2001;39:1746-50.
43. Ferlay J, Parkin DM, Pisani P. GLOBOCAN 1: cancer incidence and mortality worldwide. Lyon: IARC/WHO, IARC; 1998.
